ID: 1156474179

View in Genome Browser
Species Human (GRCh38)
Location 18:37395162-37395184
Sequence TGGCAGAGCCTTAGTGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156474172_1156474179 6 Left 1156474172 18:37395133-37395155 CCTCGTCTATGCCATGTTCACTG 0: 1
1: 0
2: 1
3: 2
4: 80
Right 1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG 0: 1
1: 1
2: 1
3: 14
4: 182
1156474169_1156474179 20 Left 1156474169 18:37395119-37395141 CCCTCACCATGTCACCTCGTCTA 0: 1
1: 0
2: 0
3: 3
4: 107
Right 1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG 0: 1
1: 1
2: 1
3: 14
4: 182
1156474170_1156474179 19 Left 1156474170 18:37395120-37395142 CCTCACCATGTCACCTCGTCTAT 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG 0: 1
1: 1
2: 1
3: 14
4: 182
1156474171_1156474179 14 Left 1156474171 18:37395125-37395147 CCATGTCACCTCGTCTATGCCAT 0: 1
1: 0
2: 1
3: 10
4: 159
Right 1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG 0: 1
1: 1
2: 1
3: 14
4: 182
1156474168_1156474179 21 Left 1156474168 18:37395118-37395140 CCCCTCACCATGTCACCTCGTCT 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG 0: 1
1: 1
2: 1
3: 14
4: 182
1156474174_1156474179 -5 Left 1156474174 18:37395144-37395166 CCATGTTCACTGTCTCCCTGGCA 0: 1
1: 0
2: 1
3: 38
4: 517
Right 1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG 0: 1
1: 1
2: 1
3: 14
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156474179 Original CRISPR TGGCAGAGCCTTAGTGGACA GGG Intronic
900271237 1:1790081-1790103 TTACAGAGCCTTACTGGTCAGGG - Intronic
901850312 1:12010936-12010958 TGGCAGAGCCAGAGGGGAGATGG + Intronic
902438251 1:16411920-16411942 GGGCAGAGCCTGATTGGAGATGG - Intronic
903415480 1:23179486-23179508 GGGCAGAGCCTTAGTCAACCTGG + Intergenic
904381899 1:30117043-30117065 TGACAGAGCCTTGGGGGACATGG + Intergenic
905111516 1:35598093-35598115 TAGCAGAGCCTTGGGGCACAAGG - Intergenic
907389906 1:54151503-54151525 TGGCTGGGTCCTAGTGGACAAGG - Intronic
908589084 1:65609640-65609662 GGGTAGAGGATTAGTGGACAGGG + Intronic
910737883 1:90482250-90482272 TAGCTGAGCCTTAGTGTGCAAGG - Intergenic
912524409 1:110270497-110270519 TCGCAGTGCCTATGTGGACAGGG - Intronic
914747191 1:150509372-150509394 TGGGAGAGGATTAGGGGACACGG + Intronic
919669794 1:200328246-200328268 GGGCAGAGCCTTGGTGAATACGG - Intergenic
919981904 1:202647064-202647086 TGGCAGAGCCATGGTGGCCAGGG + Intronic
922165483 1:223112383-223112405 TAGCAGAGTCTCAGTGGACTGGG - Exonic
1062996446 10:1871046-1871068 TAGCAGAGCCTCAGTGGTCCTGG + Intergenic
1064247425 10:13680129-13680151 GGGCAGAGCCTTAGGGCTCAGGG + Intronic
1069959726 10:72072679-72072701 TGGCAGGGCCTGGGTGGACAGGG - Intronic
1074211375 10:111338405-111338427 TGGCAGAGCCAAAGGGGACATGG - Intergenic
1074790445 10:116881241-116881263 GGGCAGAGGCTTAGCGGAAAGGG - Intronic
1076470702 10:130716281-130716303 TGGCAGGCCCTTTGGGGACAGGG - Intergenic
1080391954 11:31856238-31856260 GGGTAGAGCCTTAGTTCACAAGG - Intronic
1080931073 11:36811711-36811733 TGGCAGAGCCATATGGGAAAAGG - Intergenic
1083323584 11:61862322-61862344 TGGCAGAGAGACAGTGGACAGGG + Intronic
1084920991 11:72469456-72469478 TATCAGAGCCTAAATGGACAAGG - Intergenic
1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085361136 11:75888215-75888237 TGCCGGAGCCTGAGTGGTCAAGG - Intronic
1089639040 11:119834933-119834955 TGGCAGACTCTCAGTGGGCAAGG + Intergenic
1089653069 11:119927488-119927510 TGGCAGAGCCTAAGTTTACCGGG + Intergenic
1089869413 11:121658864-121658886 TGGCAGAGGCAAAGTGAACATGG + Intergenic
1091637750 12:2210652-2210674 TGGCAGAATCTGAGAGGACAGGG + Intronic
1091688338 12:2579255-2579277 TGGAAAAGCCTTAATGGTCATGG - Intronic
1093752832 12:22820154-22820176 TGGCAGAGCCTTTGTGGACAGGG - Intergenic
1095544843 12:43354089-43354111 AGGCAGAGACATATTGGACATGG + Exonic
1095657658 12:44689201-44689223 TGGCAGAGACTCAGAGTACATGG - Intronic
1101217984 12:102604272-102604294 TGGCAGAGCCTGTGTACACATGG + Intergenic
1101499398 12:105288395-105288417 TGGCAGAGCCTCAGATGAAAGGG + Intronic
1102304119 12:111791816-111791838 TGCCAGAGCCTGAGAGGTCAAGG + Intronic
1103317467 12:120068080-120068102 TTGCAGAGCCTTAGGGGACCTGG - Intronic
1103322197 12:120098781-120098803 TGGCAGAGCCACAGTGGCCCAGG + Intronic
1103703546 12:122859876-122859898 GGGCAGAACCTTAGGGGCCACGG - Intronic
1103767656 12:123293121-123293143 TTGCAGAGGCAAAGTGGACATGG + Exonic
1104859676 12:131917597-131917619 TGGCAGCGCCCTAGCGGACGGGG + Intronic
1105069445 12:133225819-133225841 TGGCAGAGACCTGGGGGACATGG + Intronic
1108529252 13:51313660-51313682 TGGCAGAGCCTCTGTGGATCTGG - Intergenic
1109994712 13:70108123-70108145 TGGCAGAGCCTTAGTAGGGAAGG + Exonic
1113364318 13:109661952-109661974 TGGCACAGCATTACTGGGCAGGG + Intergenic
1114412067 14:22510264-22510286 TGGCTGAGCTTTAGTATACACGG - Intergenic
1114919007 14:27302754-27302776 TGGCGGAGCCTAAATGGAGAGGG + Intergenic
1115069462 14:29303224-29303246 TGGAAGAGCCTTAGACCACAGGG + Intergenic
1118912558 14:70073873-70073895 TCTCAGAGCTTGAGTGGACAGGG - Intronic
1119668569 14:76501430-76501452 TGGCAGCGCCTTAGAGGAGCTGG + Exonic
1121264043 14:92587577-92587599 TGGCCAAGCCTGAGTGTACATGG + Intronic
1121468908 14:94136765-94136787 TGGCAGAGACAGAGAGGACAGGG - Intergenic
1122126654 14:99582069-99582091 TGGCTGATCCTGAGTGAACATGG - Intronic
1122497502 14:102169288-102169310 TGGCAGTGCCTTTCTGGGCAGGG - Intronic
1123893709 15:24807305-24807327 TGGATGAGCCTCAGTGGACTTGG + Intergenic
1126744065 15:51807386-51807408 TGGCAAAGCCTGTCTGGACAAGG - Intronic
1129075593 15:72993163-72993185 TGGCAGAGCCTCCGTACACAGGG + Intergenic
1130561490 15:84962840-84962862 TGACAAGGCCTTAGAGGACATGG + Intergenic
1131622141 15:94079617-94079639 TGGCATAGGCTTTCTGGACAAGG + Intergenic
1132804559 16:1769539-1769561 AGGCAGAGCCTGGGGGGACACGG - Exonic
1132892254 16:2210112-2210134 GGGCAGAGCGTGAGTGGGCAGGG - Exonic
1133304037 16:4798952-4798974 GGGCACAGGCTTTGTGGACAGGG + Intronic
1134611019 16:15607806-15607828 TGGCAGAGCTGTAGTAGAGAGGG - Intronic
1136142318 16:28295316-28295338 AGGCAGAGAATTAGAGGACACGG - Intronic
1141278518 16:82609285-82609307 GGGCAGAGCCGGAGTGGCCAGGG + Intergenic
1144713215 17:17416553-17416575 CTGCAAAGCCATAGTGGACAAGG - Intergenic
1145110106 17:20155127-20155149 TGGCTGAGCTTTAGTGCCCAGGG + Intronic
1145121348 17:20263086-20263108 GGGCAGAGGCAGAGTGGACAGGG - Intronic
1146671561 17:34741439-34741461 GGGCACAGCTTTAGTGGAGAAGG + Intergenic
1149149528 17:53543675-53543697 TGGCAGAGTATTACTGGAAAGGG - Intergenic
1150462146 17:65361825-65361847 TGGCAGGGCCCTGGAGGACAGGG - Intergenic
1151770216 17:76155726-76155748 TGGCAGGGCCTTTGGAGACAGGG + Exonic
1152335627 17:79699023-79699045 TGGAAGGGCCTTCTTGGACAGGG - Intergenic
1152536190 17:80951506-80951528 TGGCACAGCCTTCGGGGACTGGG - Intronic
1154273148 18:12937195-12937217 TGGCAGAGGCATTGTGTACAGGG + Intergenic
1154332407 18:13440826-13440848 TGTCAGAGCCATTGTGTACACGG + Intronic
1156310745 18:35919426-35919448 TGGCTGGGGCTGAGTGGACAAGG + Intergenic
1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG + Intronic
1156963375 18:43060262-43060284 TGGCAGAGTAATACTGGACAGGG - Intronic
1158875750 18:61733097-61733119 TGGCAAAGCCCCAGTGGACCTGG - Intergenic
1160452727 18:78977084-78977106 CGGCAGAGCCTTGGAGGAGAGGG - Intergenic
1161772937 19:6241261-6241283 TGGCAGTGGCTTGGGGGACACGG - Intronic
1162095466 19:8307475-8307497 TGGGAGTGCCTGAGTGCACAGGG + Intronic
1163145285 19:15375398-15375420 GGGCAGAGCCTGAGAGCACAGGG - Intronic
1164965317 19:32478188-32478210 TGGCACGTCCTTAGTGGATATGG - Intronic
1167427073 19:49434800-49434822 TGACACAGCCATAGTGGACGCGG + Exonic
925372890 2:3360703-3360725 TAGCAAAGCTTTAATGGACACGG - Intronic
928367644 2:30715000-30715022 TGGCAGAGTCTCAGAGAACAAGG + Intergenic
929154590 2:38778029-38778051 AGGGATAGCCTTAGAGGACATGG + Intronic
932326875 2:70869059-70869081 AGGCAGGGCCTTTGGGGACATGG + Intergenic
932742452 2:74302193-74302215 TGGGAGAGCCTAGGAGGACAGGG - Intronic
933692598 2:85190913-85190935 TGGCAGAGCTTCAGTGGAAACGG + Intronic
935744592 2:106179302-106179324 GGGCAGGGCCTTTGTGGAGAGGG - Intronic
936034834 2:109102676-109102698 TGGCAGAGCCTTGGGGGAGAGGG + Intergenic
937407502 2:121644220-121644242 TGGCAGAGCCAGAATGCACAAGG + Intronic
938844898 2:135198130-135198152 TGGCAGATCCTGAGTGCAGAAGG - Intronic
939120389 2:138109610-138109632 TGGCCAAGGCTTTGTGGACAGGG + Intergenic
940116887 2:150219319-150219341 TGGGAGAGCATTAGAGGACCTGG + Intergenic
944238059 2:197458358-197458380 TAGCTGAGACATAGTGGACAAGG - Intronic
945020326 2:205564568-205564590 TGGCACATCCTTAGGGGACATGG + Intronic
946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG + Intergenic
947650580 2:231782766-231782788 TGGCAAAACTTTAATGGACAAGG + Intronic
948866451 2:240777493-240777515 TGGCAGAGCACGACTGGACAGGG - Intronic
1169287640 20:4322766-4322788 GGGCAGAGCCATAGTGAACTAGG - Intergenic
1169422453 20:5471344-5471366 TGGCAGAGTATTCGTGGTCAGGG + Intergenic
1169427021 20:5504435-5504457 TGGCAGAGTATTCGTGGTCAGGG - Intergenic
1170261617 20:14414661-14414683 TGGCAGGGCCTTGACGGACATGG - Intronic
1172192336 20:33069452-33069474 TAGCTGAGGCTTAGGGGACAAGG - Intronic
1173004511 20:39129512-39129534 TGGCAGTGCCTATGTTGACAGGG - Intergenic
1173327077 20:42043629-42043651 TTGCAGAGCCGCTGTGGACATGG + Intergenic
1174724220 20:52844492-52844514 TGGAAGAGCCTTAGTGAAATTGG - Intergenic
1175395112 20:58652172-58652194 AGGCAGAGCCGCAGTGCACACGG - Intronic
1176074939 20:63244174-63244196 AGGCAGGGCCTTGGTGGTCAGGG - Intronic
1176341780 21:5705596-5705618 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176474034 21:7137748-7137770 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176503047 21:7618860-7618882 TGCCTGAGCCTGAGTGGTCAAGG - Intergenic
1176536101 21:8103665-8103687 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1179091904 21:38274072-38274094 TGGCAAAGCCTCAGTGGTAAAGG - Intronic
1179274775 21:39882285-39882307 TGGCAGAGCCAATGTGGCCATGG + Intronic
1181138480 22:20786337-20786359 TGGCAGACACTTACTGGGCAGGG + Intronic
1181952619 22:26565309-26565331 TGGCAGACCCTTGGTGGCCAAGG + Intronic
1183357577 22:37367839-37367861 GGGCTAAGGCTTAGTGGACAGGG - Intergenic
1183590819 22:38778374-38778396 AGGCATAGCCCCAGTGGACATGG - Intronic
1184171996 22:42765325-42765347 AGGCAGAGCCTGGGTGGGCAAGG + Intergenic
1184646087 22:45896259-45896281 GGGCAGAGCCCTGGAGGACAGGG - Intergenic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
1203241047 22_KI270733v1_random:20062-20084 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
954387482 3:50251906-50251928 TGGCAGGGCCACAGTGGTCAAGG - Intronic
957994354 3:87670243-87670265 TGGTAAAGCCTTAGTGGTCTTGG - Intergenic
958628946 3:96664156-96664178 TACCAGAGCCTTAGCTGACATGG + Intergenic
960920354 3:122740551-122740573 TGGGAAAGACTTTGTGGACAAGG - Exonic
961362788 3:126378551-126378573 TTGGAGAGCCTTAGTTGGCATGG - Intergenic
961475034 3:127140929-127140951 TGGCAGAGCCAGTGTGGACAGGG + Intergenic
962209732 3:133467291-133467313 TGGCTGAGCCTTGGGGGGCAGGG - Intronic
966537429 3:181050489-181050511 TGGCAGAGCTTGAGAGGAAAAGG + Intergenic
967983819 3:195080840-195080862 TGGCAGAGACTCCGTGGACGTGG + Intronic
969682468 4:8650949-8650971 GGGGAGAGCATTAATGGACAAGG + Intergenic
971234324 4:24827571-24827593 TGGCAAAGCATTCGTGGACGAGG - Intronic
971236833 4:24849931-24849953 TTGCTGAGCCTTGGGGGACAAGG - Intronic
977494845 4:97761996-97762018 TGGCAGAGCCTAAGTGAACTGGG + Intronic
978541725 4:109823213-109823235 GGGCAGAGCCAAAGTGGAAAGGG + Intronic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
985424313 4:189813369-189813391 TGGCAGAGCCTGGGTGGGAAAGG + Intergenic
986240132 5:5953450-5953472 TGGCAGAGCCATTGTGCCCAGGG - Intergenic
986337210 5:6764138-6764160 TAGCAGAGCTTTAGTGGGTAAGG + Intergenic
992457662 5:76930905-76930927 TGGCAGAGGTTTTGTGGAAATGG + Intergenic
997627992 5:135344224-135344246 TTGCAGAGCATCTGTGGACAGGG - Exonic
1002075851 5:176707984-176708006 TGGCAGAGTCGGAGAGGACAGGG - Intergenic
1002431604 5:179207410-179207432 CGGCAGAGCCTCAGGGGACCTGG + Intronic
1003068344 6:2921885-2921907 TAGGAGAGCCTATGTGGACAAGG - Intergenic
1003435816 6:6087051-6087073 TGGCAGGGGCTTAGTAAACATGG - Intergenic
1006830037 6:36963094-36963116 AGGCAGAGCCTTGGTTGCCAGGG - Exonic
1009947408 6:70355852-70355874 AGGCAGAGCCTTAATGAACGGGG + Intergenic
1012222656 6:96668541-96668563 TGGCAGAAACATTGTGGACAGGG - Intergenic
1014024471 6:116629285-116629307 TAGCAGAACCTTAGTGAAAAAGG - Intronic
1017944940 6:159088515-159088537 TGGCATAGGCTAAGTGGAGATGG + Intergenic
1018900867 6:168051100-168051122 TGGCTCAGCCTGGGTGGACAAGG + Intergenic
1020073570 7:5243160-5243182 TGGCAGAGGCTGAGGGAACAGGG + Intergenic
1021285728 7:18778926-18778948 TGGTAGAGCATTAATGCACATGG + Intronic
1022036069 7:26535923-26535945 TGGCAGAGCCATCAGGGACAAGG + Exonic
1022320723 7:29285372-29285394 TGGCAGCTCCTTTGTGGTCATGG - Intronic
1023982102 7:45076268-45076290 TGGCTGAGCCCTGGTGGACAAGG - Exonic
1025862738 7:65347129-65347151 TGGCAGAGACATAGTGAAAAAGG - Intergenic
1027912191 7:84264985-84265007 TGGTAGAGCCTTAGTGTACTAGG - Intronic
1032274990 7:130446492-130446514 TGGCAGAGCACTAGGGGAAAAGG + Intergenic
1033110556 7:138570830-138570852 TGGCAGATCAGCAGTGGACAGGG + Exonic
1034077435 7:148245762-148245784 TGTTAGAGCCTTAATGCACATGG + Intronic
1038585497 8:28784984-28785006 TGTCAGAGACCTAGAGGACAAGG - Intronic
1039204965 8:35141813-35141835 TGGCAGTGCCTTGGTGGAGTTGG - Intergenic
1039646670 8:39292021-39292043 AGGCTGAGCCTTAGAGGCCATGG - Intergenic
1042678397 8:71349255-71349277 TGGCAGAGGCTTTGATGACAAGG - Intronic
1042867368 8:73367657-73367679 TGGCAAAGAGTTAGTGGGCAAGG + Intergenic
1045324481 8:101108117-101108139 TGGAGGAGGCTCAGTGGACAAGG - Intergenic
1046568498 8:115932052-115932074 TAGCAGAGCCTTCCTGAACAAGG + Intergenic
1049256052 8:141614457-141614479 TGGTACAGCCAGAGTGGACAAGG + Intergenic
1049333305 8:142067308-142067330 TGACAGTGCCTCAATGGACATGG - Intergenic
1049478247 8:142806834-142806856 TGGCAGAGCCAAGGTGCACAGGG + Intergenic
1052802305 9:32980393-32980415 TGCCAGAGCCACATTGGACAAGG - Intronic
1054198660 9:62059546-62059568 TGGCTGAGCCTGAGTTGGCATGG - Intergenic
1056927739 9:90849033-90849055 TGGCAGAGAGTGAGTGGAGAAGG + Intronic
1057694463 9:97313455-97313477 TCACAGAGCCTTAGACGACATGG + Intronic
1058892555 9:109373480-109373502 TGGCAGTGGCTTAGTGGAATTGG + Intergenic
1060168657 9:121442284-121442306 TGGCAGAGCCTGTGTGAAAAGGG - Intergenic
1060252735 9:121999101-121999123 TGGAAGAGCCTTAATGGAGGCGG + Intronic
1203457373 Un_GL000220v1:3149-3171 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1185539252 X:889083-889105 TGGCAGATCCTTTGAGGTCAGGG - Intergenic
1186739780 X:12505358-12505380 TGGCTGAGCTTAAGAGGACATGG + Intronic
1186761686 X:12729755-12729777 GGGAAGAGCCTTGGTGGGCATGG - Intergenic
1192203573 X:69082125-69082147 TGGGAGTGGCTTAGTGCACAGGG + Intergenic
1192800340 X:74459487-74459509 TGGCAGAGCCCCAGTGGGGAGGG - Intronic
1197253435 X:124237904-124237926 TGCCAGAGCTGTTGTGGACAAGG + Intronic
1199538488 X:148930791-148930813 TAGCACTGCCTTAGTGGCCATGG - Intronic
1200118383 X:153779125-153779147 TGGCAGAGCCTGGGGGCACAGGG + Exonic
1200827380 Y:7658825-7658847 TGGCTGACCCTGAGTGGTCATGG - Intergenic
1202232476 Y:22670822-22670844 TGGCTGACCTTTAGTGGTCACGG + Intergenic
1202310680 Y:23525336-23525358 TGGCTGACCTTTAGTGGTCACGG - Intergenic
1202560122 Y:26145258-26145280 TGGCTGACCTTTAGTGGTCACGG + Intergenic