ID: 1156474576

View in Genome Browser
Species Human (GRCh38)
Location 18:37397538-37397560
Sequence TCCCCACCCATGGACTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 220}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156474576_1156474583 -8 Left 1156474576 18:37397538-37397560 CCTGGGGAGTCCATGGGTGGGGA 0: 1
1: 0
2: 0
3: 25
4: 220
Right 1156474583 18:37397553-37397575 GGTGGGGAGGGATGGAGGCTGGG 0: 1
1: 1
2: 12
3: 215
4: 1915
1156474576_1156474582 -9 Left 1156474576 18:37397538-37397560 CCTGGGGAGTCCATGGGTGGGGA 0: 1
1: 0
2: 0
3: 25
4: 220
Right 1156474582 18:37397552-37397574 GGGTGGGGAGGGATGGAGGCTGG 0: 2
1: 2
2: 31
3: 519
4: 3751
1156474576_1156474587 18 Left 1156474576 18:37397538-37397560 CCTGGGGAGTCCATGGGTGGGGA 0: 1
1: 0
2: 0
3: 25
4: 220
Right 1156474587 18:37397579-37397601 GCTGGGCTCTGAGCTACTCCTGG 0: 1
1: 0
2: 4
3: 38
4: 308
1156474576_1156474584 -4 Left 1156474576 18:37397538-37397560 CCTGGGGAGTCCATGGGTGGGGA 0: 1
1: 0
2: 0
3: 25
4: 220
Right 1156474584 18:37397557-37397579 GGGAGGGATGGAGGCTGGGCAGG 0: 1
1: 1
2: 18
3: 459
4: 8018
1156474576_1156474586 1 Left 1156474576 18:37397538-37397560 CCTGGGGAGTCCATGGGTGGGGA 0: 1
1: 0
2: 0
3: 25
4: 220
Right 1156474586 18:37397562-37397584 GGATGGAGGCTGGGCAGGCTGGG 0: 1
1: 0
2: 8
3: 90
4: 855
1156474576_1156474585 0 Left 1156474576 18:37397538-37397560 CCTGGGGAGTCCATGGGTGGGGA 0: 1
1: 0
2: 0
3: 25
4: 220
Right 1156474585 18:37397561-37397583 GGGATGGAGGCTGGGCAGGCTGG 0: 1
1: 2
2: 13
3: 193
4: 1683

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156474576 Original CRISPR TCCCCACCCATGGACTCCCC AGG (reversed) Intronic
900701808 1:4053294-4053316 CCCCACCCCGTGGACTCCCCAGG + Intergenic
901642316 1:10698998-10699020 CCCCCACCCATGGCCTGGCCTGG + Intronic
902830278 1:19007986-19008008 TGCCCACCCATGGAGGCCACAGG + Intergenic
902870032 1:19308354-19308376 GCCCCACCCTGGGACTGCCCTGG + Intronic
903180426 1:21602413-21602435 CCCACACTCATGGACCCCCCAGG + Intronic
903341223 1:22655756-22655778 TTCCCATCCATGGTCTCACCTGG + Intronic
904035427 1:27556234-27556256 CCCCCACCCACTGCCTCCCCAGG + Intronic
904715640 1:32465456-32465478 GCCCCTCCCATGGCCTCCCGCGG - Intronic
906104593 1:43284324-43284346 TCTGCCCCCAAGGACTCCCCTGG - Intronic
911690654 1:100830080-100830102 TTCCAACCCATAGAGTCCCCTGG + Intergenic
913284010 1:117210842-117210864 TCCCCAGCCATGGCTTCCCTGGG - Exonic
914844124 1:151271621-151271643 ACCCCACCCATGGAGTTTCCAGG - Intergenic
916254682 1:162774779-162774801 TCCCAAGCCATGGAAACCCCTGG + Intronic
917449178 1:175132718-175132740 TCCCCACCCATCCCCTGCCCAGG + Intronic
918738456 1:188096886-188096908 TCCCCACCCCTAGAATCCCCAGG + Intergenic
918934243 1:190899411-190899433 TGCCCAGCCATCAACTCCCCTGG + Intergenic
920123647 1:203676726-203676748 TCCCCACCACTGGGCTCTCCAGG + Intronic
921164935 1:212500129-212500151 TGCCCACTCATGGCCTCCACGGG - Intergenic
922473549 1:225890797-225890819 TCCCCATCCATGGAGGCCCCAGG - Intronic
923100773 1:230814955-230814977 TCCCCACAACTGGACTCACCCGG + Intergenic
1063174964 10:3543152-3543174 GCCACACCCATGGAGTCTCCTGG + Intergenic
1063351086 10:5355641-5355663 TGACCCCCCATGGAATCCCCAGG + Intergenic
1064479525 10:15725564-15725586 TTCCCACCCGTGCACGCCCCAGG + Intergenic
1067428120 10:46224520-46224542 GCATCCCCCATGGACTCCCCAGG + Intergenic
1067448025 10:46364818-46364840 CCCACACCCCTGGACTTCCCCGG + Intergenic
1067589355 10:47495943-47495965 CCCACACCCCTGGACTTCCCCGG - Intergenic
1067636479 10:48004022-48004044 CCCACACCCCTGGACTTCCCCGG - Intergenic
1067687896 10:48478837-48478859 GCCCACCCCATGGACTCTCCTGG + Intronic
1067877010 10:50016303-50016325 CCCGCACCCCTGGACTTCCCTGG + Intergenic
1069924417 10:71838367-71838389 GCCCCACCCAGAGAGTCCCCTGG + Intronic
1070096211 10:73340407-73340429 GCCCCACCCATGGCCTCCCATGG - Intronic
1070133028 10:73668006-73668028 CCCACACCCCTGGACTTCCCCGG - Intergenic
1070890099 10:79936787-79936809 TCCTCACCCCTGCACTGCCCAGG - Intergenic
1075392283 10:122100978-122101000 TCCCGACCCTTCCACTCCCCAGG + Intronic
1075621909 10:123934317-123934339 TCCCCACCTATGGTCTCCAGAGG - Intronic
1076727153 10:132419272-132419294 CTTCCACCCATGGGCTCCCCAGG + Intergenic
1076886667 10:133266220-133266242 TCTCCAGCCATGGTCCCCCCAGG - Intronic
1077167866 11:1151957-1151979 TGCCCTCCCCTGGTCTCCCCAGG + Intergenic
1078733517 11:13998658-13998680 TGGCCACCCCTGTACTCCCCTGG + Intronic
1082758289 11:57100023-57100045 TCCCCATCCAGGGAGTCCTCTGG + Intergenic
1082782710 11:57300023-57300045 TCCTCACCCAGGGACCCCACAGG + Exonic
1083303021 11:61748611-61748633 TCCCCACCGTGGGACTCTCCTGG - Intergenic
1084310367 11:68312992-68313014 TCCCCACCCGGGCCCTCCCCGGG + Intronic
1084603640 11:70160631-70160653 CCACCTCCCAGGGACTCCCCTGG - Intronic
1084978253 11:72814874-72814896 TCCCCACCCGGGCAGTCCCCGGG + Intronic
1088467713 11:110159310-110159332 TCTCCTCCCCTGGACTCGCCGGG - Exonic
1089504340 11:118953600-118953622 TCCCCACCCCAGCCCTCCCCAGG - Intronic
1089619213 11:119713009-119713031 GCCCCACCCATTGACTCACTTGG - Intronic
1095955221 12:47802188-47802210 CTCCCTACCATGGACTCCCCCGG + Intronic
1096803729 12:54127683-54127705 TCCCCGCCCAGGAACACCCCGGG - Intergenic
1097173448 12:57129525-57129547 TCCCCACCCACAGCCTTCCCGGG - Intronic
1099543053 12:83938853-83938875 TCCCCAACAATGGATTTCCCAGG - Intergenic
1099589115 12:84563724-84563746 TCTCCACCCATGGAAACCCATGG - Intergenic
1100843114 12:98632997-98633019 TCACCATCCATGGAATCCCCTGG + Intronic
1101560487 12:105853121-105853143 TCCCCACCCCTGGTATCCCCAGG - Intergenic
1104047709 12:125174714-125174736 TCCCCTCCAGTGGCCTCCCCAGG + Intergenic
1105813300 13:24012577-24012599 TCCCCTCTCAGGGGCTCCCCTGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106571936 13:30935042-30935064 CCTGCACCCTTGGACTCCCCAGG + Intronic
1108635931 13:52334187-52334209 TCCCCCTCCATGGTTTCCCCAGG - Intergenic
1108651879 13:52489061-52489083 TCCCCCTCCATGGTTTCCCCAGG + Intergenic
1110247929 13:73348062-73348084 TCTCCATCCAGGGAGTCCCCTGG - Intergenic
1110721081 13:78762779-78762801 TCCTTACCCATGAACTCCTCTGG - Intergenic
1115777511 14:36731872-36731894 TCTCAACCCAGGGAGTCCCCTGG + Intronic
1119764956 14:77182256-77182278 CCCCCACCCAGGGATTCCCCGGG + Intronic
1122578194 14:102755118-102755140 CCCCCACCCTTGAGCTCCCCCGG + Intergenic
1122901091 14:104782602-104782624 TGCCCATCCCAGGACTCCCCAGG - Intronic
1202860590 14_GL000225v1_random:79127-79149 AGCCCCACCATGGACTCCCCTGG + Intergenic
1123723839 15:23083198-23083220 TCCTCTGCCATGCACTCCCCAGG - Intergenic
1124249805 15:28099347-28099369 CCCCCACCCAGGCACGCCCCCGG + Exonic
1124407582 15:29405528-29405550 ACCCCACCCATGGAGTGACCTGG - Intronic
1125246824 15:37650275-37650297 TACCCACCCAAGGACCCTCCAGG + Intergenic
1126109978 15:45169351-45169373 TCCCCAGGCATGGAGTCCTCAGG + Intronic
1126677323 15:51171726-51171748 ACCCCACCCATGGCTTCCACTGG + Intergenic
1128215143 15:65929701-65929723 TCCCCACCCTGGCACTCACCGGG + Exonic
1128223036 15:65982171-65982193 TCCCCACCCAGGCACCCTCCAGG + Intronic
1128865046 15:71108536-71108558 TCTCCACCCATGGACTTCCAAGG + Intronic
1129117952 15:73375671-73375693 TCCCCACTCCTTGACCCCCCAGG - Intergenic
1131979157 15:97979089-97979111 TGCTCACCCATTGCCTCCCCTGG + Intergenic
1135047668 16:19168341-19168363 TCCCCACCGAGGCGCTCCCCAGG - Exonic
1135250691 16:20899587-20899609 TCCTCCCCCATGCACACCCCTGG - Intronic
1135435857 16:22426179-22426201 TCCCCACCCATGGACTCAGGAGG + Intronic
1136629233 16:31479649-31479671 TCCTCTCCCATGGTCTTCCCAGG + Intergenic
1138096157 16:54213570-54213592 TCCCCACCCCCAGACTCTCCTGG - Intergenic
1142045066 16:87920009-87920031 TCCCCATCCATGGACTCAGGAGG + Intronic
1143083309 17:4397185-4397207 TACCCCACCCTGGACTCCCCCGG - Intergenic
1143407519 17:6687251-6687273 ACCCCTTCCAAGGACTCCCCTGG + Intronic
1143479053 17:7218309-7218331 TCCCCACCCCAGGCCTCTCCAGG + Intronic
1147192062 17:38743778-38743800 TCCCCACCCCAGGAGGCCCCAGG + Intronic
1148460528 17:47836872-47836894 TCCCCAGCCATGGGCACCCCAGG - Exonic
1149042072 17:52202202-52202224 TCCCTGCTCATGAACTCCCCTGG - Intergenic
1149467128 17:56888793-56888815 GCCCCACCCAAGGGCTCCCAAGG - Exonic
1151888746 17:76939677-76939699 TCCCCACTCTGGGAGTCCCCAGG + Intronic
1152206619 17:78977710-78977732 TCCCCTCCCATCCACTCTCCAGG - Intronic
1152322763 17:79617411-79617433 TCCACACCCACGGACACCCCAGG + Intergenic
1153486622 18:5605140-5605162 TCCCCACTCCAGTACTCCCCAGG + Intronic
1155159700 18:23185583-23185605 AGCCCACCCAGGGCCTCCCCAGG + Intronic
1155215745 18:23641668-23641690 TTCCCACCCATGGCTTCCCATGG + Intronic
1156474576 18:37397538-37397560 TCCCCACCCATGGACTCCCCAGG - Intronic
1157307014 18:46524917-46524939 TCCCCACATCTGGGCTCCCCAGG - Exonic
1160746021 19:710867-710889 TCCCCACCCATTGTCAGCCCGGG - Intronic
1161042991 19:2120052-2120074 TCCCCACCCTGGGCCTGCCCCGG - Intronic
1161276895 19:3423504-3423526 GCCCCACCCATGGATCACCCAGG - Intronic
1162361540 19:10223581-10223603 TCCCCTGCCCTGGCCTCCCCAGG + Intronic
1162918280 19:13885716-13885738 TCCCCACCCAGAAGCTCCCCAGG - Intronic
1162985560 19:14267112-14267134 TCCCCACCCAGAGACCCCCTGGG - Intergenic
1163158083 19:15449759-15449781 GCCCCACCCGCGGGCTCCCCAGG + Intronic
1163426048 19:17241578-17241600 CCCCTGCCCTTGGACTCCCCTGG + Intronic
1163977487 19:20866032-20866054 TCCTCACCCATGGTGTCCTCAGG - Intergenic
1164381523 19:27740477-27740499 TCCCTATCAATGGACTCCCTGGG + Intergenic
1164711036 19:30357390-30357412 ACCCCACCCATCCTCTCCCCAGG - Intronic
1164721840 19:30438254-30438276 TCCCCACTTTTGGAGTCCCCAGG + Intronic
1164876445 19:31693998-31694020 GCCCCACCCAGGGCCTTCCCTGG + Intergenic
1165072142 19:33261674-33261696 TCCCCAACCGAGCACTCCCCTGG - Intergenic
1165150083 19:33755081-33755103 CCACCACCCATGCACCCCCCAGG + Intronic
1165527274 19:36366684-36366706 TCCCCACCCACCTACTGCCCAGG - Intronic
1166679826 19:44759466-44759488 TCTCCCCCCAGGGACCCCCCTGG + Exonic
1167035196 19:46991067-46991089 TCCCCACCCACTAACTCCCCTGG - Intronic
1167077236 19:47257170-47257192 GCCCCGCCCATGGCTTCCCCAGG - Intronic
1167786698 19:51643551-51643573 TCCTCACCTATGGCCTCACCTGG - Exonic
1168695170 19:58400158-58400180 GCCCCACCCCTGGCCTCCCCAGG - Intergenic
925342024 2:3144656-3144678 TCCCCATCCATGCTCACCCCAGG + Intergenic
927149600 2:20188034-20188056 TCCCCACCCAAATTCTCCCCAGG - Intergenic
927698308 2:25252152-25252174 TCCCCGCCCCCGGTCTCCCCGGG + Intronic
927849676 2:26491026-26491048 TCCCCTCCCATGCTCTCCCCAGG - Intronic
928111719 2:28515772-28515794 TCCCCACCCAATGCCTGCCCAGG - Intronic
928404515 2:31004379-31004401 TCCCTCCCCTTGGACTCTCCTGG - Intronic
932614506 2:73223394-73223416 TCCCCAACCATGGGCTGCCTGGG + Intronic
932792009 2:74662071-74662093 TCCTCACCCAGGGACTCCAGAGG - Intronic
934663367 2:96154650-96154672 TCCCCTCCCTTGGCCTCCTCTGG - Intergenic
936443903 2:112581088-112581110 TCCCAACTCAGGGACACCCCTGG + Intergenic
937937683 2:127259277-127259299 TCCTCACCCATTTACTCACCTGG + Exonic
938560206 2:132465519-132465541 TTGCCATCCAGGGACTCCCCAGG - Intronic
938942261 2:136179594-136179616 TCCCACCCCCTTGACTCCCCAGG + Intergenic
939373969 2:141339939-141339961 TCCCCACCACTGGAGTCTCCAGG + Intronic
946408852 2:219506655-219506677 TCCCCTCCCATGACCTCCCCTGG + Intronic
946660942 2:221998689-221998711 TCCCATTCCATGAACTCCCCAGG - Intergenic
947753011 2:232542525-232542547 CCCCCACCCAAGGGCTCCCCAGG + Intronic
1169632338 20:7647510-7647532 GGCCCACCCATGGTCACCCCTGG - Intergenic
1169728518 20:8761963-8761985 GCCCCCCCCTTGGCCTCCCCAGG - Intronic
1170073542 20:12394915-12394937 TCACCACACATGCACTCCACAGG - Intergenic
1170693383 20:18635423-18635445 TCACCACACATGGAATCACCTGG + Intronic
1172166578 20:32903243-32903265 ACCCCTCCCCTGGGCTCCCCGGG + Intronic
1172736507 20:37129902-37129924 CCCCCACCCCTGAAGTCCCCAGG + Intronic
1173350905 20:42244558-42244580 TCCGCACCCCTGGACTTGCCTGG - Intronic
1173878728 20:46394341-46394363 TCCTCTGCCATGCACTCCCCAGG + Intronic
1174391360 20:50220202-50220224 CCACCACCCAAGGGCTCCCCAGG - Intergenic
1175444785 20:59012600-59012622 AGCCCACCCATGAACTCACCAGG + Intergenic
1175922955 20:62458626-62458648 TCCCCACCTAGGGAGACCCCAGG + Intergenic
1176088035 20:63306932-63306954 TCCCCACCCATGCAGGCCTCAGG + Intronic
1179442847 21:41407681-41407703 CCCCCAGCCCAGGACTCCCCTGG - Intronic
1180133330 21:45842757-45842779 TCCCCACCGGTGGTGTCCCCAGG - Intronic
1181312499 22:21952785-21952807 TCCTCACCCCTGGTCTCCGCGGG + Exonic
1182020651 22:27078956-27078978 TCAGCTCCCATGGCCTCCCCTGG + Intergenic
1183137542 22:35903644-35903666 TCACCACCCTTGAAGTCCCCTGG + Intronic
1183583173 22:38737633-38737655 TCCTCACTCCAGGACTCCCCCGG + Intronic
1183639397 22:39083921-39083943 TCCCAACCCAGGGACACCCATGG + Intronic
1183687093 22:39367417-39367439 TCCCCACCTTTGCACGCCCCAGG - Intronic
1183883580 22:40857266-40857288 TCTCCTCCCATGGTGTCCCCTGG + Intronic
1184444978 22:44541771-44541793 TCCCCACCCAAGATCTGCCCAGG + Intergenic
1185051139 22:48554944-48554966 CCCCCGCCCAGGGACTCCCGAGG - Intronic
1185224822 22:49646514-49646536 TCCCCACCCCTGCATGCCCCAGG + Intronic
1185330279 22:50249219-50249241 TCCCCACCCACCCCCTCCCCCGG - Intronic
954391502 3:50270296-50270318 TCCCAACCCCAGCACTCCCCAGG + Intronic
954654173 3:52183926-52183948 TCCAGACCCCTGGACTCCCAGGG - Intergenic
954692506 3:52403154-52403176 TCCCCACTCAAGGGCTCGCCAGG + Exonic
955738547 3:62065316-62065338 TACACAACCATGGACTTCCCTGG - Intronic
960846313 3:122007306-122007328 ACCCCACCCATAGCCTGCCCAGG - Intronic
961956990 3:130814854-130814876 CCCCGACCCATCGACTGCCCAGG - Intergenic
962032214 3:131613087-131613109 GACCCAACCATGGACTCCTCTGG - Intronic
963074265 3:141331885-141331907 TCCCCAGCCGAGGACTCCCAGGG - Intronic
969132845 4:5004340-5004362 TCCCCAGCCATGGACTCAATGGG - Intergenic
969585683 4:8090118-8090140 TCCCCTCCCATCCACTGCCCAGG + Intronic
969618013 4:8265032-8265054 TCCCCACCCGTGGAGTCTCTAGG + Intergenic
969625965 4:8305927-8305949 TCACCACCCACCGCCTCCCCAGG - Intronic
972397836 4:38672686-38672708 TTCCCTCCCGTGCACTCCCCGGG - Intronic
977425471 4:96862724-96862746 TCCCCACCCTTGTGCTTCCCAGG - Intergenic
978087327 4:104669392-104669414 TCCCCATTCATGCACTCTCCTGG + Intergenic
983885411 4:172975461-172975483 GGCCCACCCATGGCCTCCCATGG - Intronic
984566946 4:181342584-181342606 TCTCCACCAATGAACTCCCCTGG - Intergenic
985673360 5:1217845-1217867 TCCCCACCCCTGGCAGCCCCAGG + Intronic
985964085 5:3326463-3326485 TCCCCACCGAGGGTCGCCCCTGG + Intergenic
986255556 5:6100313-6100335 TCTCACCCCATGGACTTCCCCGG + Intergenic
986466596 5:8032453-8032475 TCACCATCGATGGACTTCCCAGG + Intergenic
991967817 5:72108799-72108821 TGCCCACCCAGGGACTCCCAGGG - Intronic
992272742 5:75082299-75082321 TCCCTACCCAGGGCCTCCCTGGG - Intronic
992492130 5:77255574-77255596 TCCCCAGCCCCGAACTCCCCTGG + Intronic
998151455 5:139759781-139759803 TCCCCACCCATGGGCACACAGGG - Intergenic
1000277643 5:159752916-159752938 ACCACACCCATGGCTTCCCCTGG + Intergenic
1001762319 5:174218474-174218496 TCCCCAGCCCAGGACTCCTCAGG + Intronic
1004205821 6:13591462-13591484 TCCCCATCCTGGGACTGCCCAGG - Intronic
1004957580 6:20747002-20747024 TCCCCACCCCGGTAATCCCCAGG + Intronic
1005889347 6:30123953-30123975 CCACCACCCATCTACTCCCCAGG - Intergenic
1006133910 6:31884330-31884352 TCCCCACCCATACCCTCCCCAGG - Intronic
1006436505 6:34028432-34028454 TTCCCACCCAGGGACCCACCCGG + Intronic
1006912465 6:37572262-37572284 TGCCCACCCAGGGTCTCCGCTGG + Intergenic
1007291539 6:40790973-40790995 TCCACACCCAAGGACCCTCCTGG - Intergenic
1007348487 6:41251074-41251096 TCCACACCCATGGAATCCCAAGG - Intergenic
1008109596 6:47478003-47478025 TCCTCACCCCTGGCCTCCCCAGG - Exonic
1008942745 6:57064833-57064855 TCACCAGCCCTGCACTCCCCAGG + Intergenic
1018890173 6:167977244-167977266 CTCCCACCCCTGGACTTCCCTGG + Intergenic
1019689394 7:2402133-2402155 CCCCCTCCGATGGACTCCCGAGG - Intergenic
1022035955 7:26534824-26534846 TCCTCACCCCTGGGCTCCCAGGG + Exonic
1023734239 7:43220789-43220811 TCCACCCCCATGGCCTGCCCTGG + Intronic
1023897345 7:44445031-44445053 GTCCCACCCTTGGACTACCCAGG + Intronic
1023973051 7:45005889-45005911 TCCCAGCCCAAGGACTTCCCAGG - Intronic
1026853059 7:73736841-73736863 TCCACACCCAAGGCCTCCCCTGG + Intronic
1029381727 7:100219691-100219713 GCCCCTCCCCTGGCCTCCCCAGG + Exonic
1029401894 7:100352141-100352163 GCCCCTCCCCTGGCCTCCCCAGG + Intronic
1029479992 7:100806536-100806558 TCCCATCCGATGGACTGCCCCGG - Exonic
1032435055 7:131893882-131893904 TCATCACTCATGCACTCCCCAGG + Intergenic
1034559030 7:151867923-151867945 CCCCCAGCAATGAACTCCCCTGG + Intronic
1035143859 7:156792820-156792842 TCTACTCCCATGGATTCCCCTGG - Intronic
1036919191 8:12835368-12835390 CCTCCCTCCATGGACTCCCCTGG - Intergenic
1037396846 8:18452238-18452260 TCCCCACCCAGGGACTTCAGAGG - Intergenic
1037727086 8:21491649-21491671 TCCCTCCCCATGCATTCCCCAGG - Intergenic
1040392041 8:46958520-46958542 CCCCCACCAATGGGCACCCCAGG + Intergenic
1042426257 8:68651736-68651758 TCCCCACTTTTGGAATCCCCAGG - Intronic
1042700030 8:71602060-71602082 TCCCAACCCATAGACCCCCGGGG - Intergenic
1044354480 8:91204646-91204668 TCACAGCCCATGGCCTCCCCAGG + Intronic
1045472656 8:102526170-102526192 CCCCCCCCCTTGGCCTCCCCAGG + Intergenic
1045481515 8:102596707-102596729 TCCCTACCCTTGGCCTCCCTTGG + Intergenic
1049404010 8:142443561-142443583 TCCCCACCCAGGCCCGCCCCCGG - Intergenic
1049444425 8:142623499-142623521 TCTCCACCCCTGGGCTCCCCCGG - Intergenic
1049446564 8:142634150-142634172 TCCCCTCCCATGGCCACCCCAGG - Intergenic
1049753043 8:144294699-144294721 TCCCCACCAATGGGGTCTCCTGG - Intronic
1049757923 8:144318977-144318999 GCCCCACCCATGGCCTGTCCAGG - Intronic
1049783290 8:144438758-144438780 TCACCTCCCACGGACTCCCCTGG - Intronic
1050705282 9:8389746-8389768 TCCTCACCCATGTGCTTCCCAGG + Intronic
1051369275 9:16344449-16344471 TCCCTACCCAGGCACTCCCTCGG + Intergenic
1051694568 9:19754226-19754248 GCCCCACTCATTGCCTCCCCAGG + Intronic
1052035020 9:23670592-23670614 TCCTCTCCCTTGGACACCCCCGG - Intergenic
1053103489 9:35390861-35390883 TGCCCACCCAAGGTCTCCCGGGG - Intronic
1053135381 9:35647281-35647303 ACCCCACCCTGGGCCTCCCCAGG - Intergenic
1057527624 9:95816638-95816660 TCAACTCCCATGGACTCACCAGG - Intergenic
1057821557 9:98335243-98335265 TCTGCACACATGAACTCCCCAGG + Intronic
1059483186 9:114607985-114608007 TCCCCACCCACAGCCTACCCTGG - Intergenic
1059563027 9:115353514-115353536 TCTCCACCCAGGGACTTCCCTGG - Intronic
1061876738 9:133547793-133547815 TCCCCTGACATGGCCTCCCCAGG + Intronic
1062250645 9:135592091-135592113 GCCCCTCCCATGTTCTCCCCAGG + Intergenic
1062567881 9:137171322-137171344 TCCTCCTCCAGGGACTCCCCTGG + Intronic
1190739838 X:53281508-53281530 TCCAGACCCATGGAGCCCCCCGG - Intronic
1192239848 X:69320347-69320369 TCCCCTCCCATGGCTACCCCTGG + Intergenic
1192299630 X:69886392-69886414 TGCCCACCCAGGGACCCACCAGG + Intronic
1198593711 X:138213001-138213023 TCCCCACCCTTGGAATACCATGG + Intergenic
1200076470 X:153553744-153553766 TCCCCTCATCTGGACTCCCCTGG - Intronic