ID: 1156475995

View in Genome Browser
Species Human (GRCh38)
Location 18:37405726-37405748
Sequence CTCTACCTGTTGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156475988_1156475995 -1 Left 1156475988 18:37405704-37405726 CCGCTAAAAGCAGGAGTCCCCTC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 187
1156475985_1156475995 17 Left 1156475985 18:37405686-37405708 CCTGTGGCTATGTTCTTCCCGCT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 187
1156475987_1156475995 0 Left 1156475987 18:37405703-37405725 CCCGCTAAAAGCAGGAGTCCCCT 0: 1
1: 0
2: 2
3: 9
4: 112
Right 1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 25
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156475995 Original CRISPR CTCTACCTGTTGAGGGAAGA GGG Intronic
901481801 1:9530318-9530340 CCCAAACTGTTGAGGGCAGATGG - Intergenic
902712752 1:18251787-18251809 GTCTTCCTGATGAGGGATGATGG + Intronic
902723802 1:18322357-18322379 CTCCACCAGAAGAGGGAAGACGG - Intronic
904441461 1:30534611-30534633 CTCCACCTGTTCTGGGGAGAGGG - Intergenic
905907925 1:41631993-41632015 CTGAACCTCCTGAGGGAAGATGG - Intronic
906396386 1:45469623-45469645 CTCACCCTGTTGAGGGAAGTTGG - Intronic
906732174 1:48092222-48092244 CCTTTCATGTTGAGGGAAGAAGG - Intergenic
907182339 1:52581858-52581880 TTCAAGCTCTTGAGGGAAGATGG - Intergenic
907972424 1:59396485-59396507 CCCTAACTGGTGAGTGAAGAAGG + Intronic
908075644 1:60514872-60514894 GGCCACCTGTTGAGAGAAGATGG - Intergenic
912255139 1:108050714-108050736 CTCTACCTGCTGTGGGGAGGAGG + Intergenic
913158712 1:116126271-116126293 CTGTACCTTTTGAAAGAAGAAGG + Intronic
915075785 1:153307308-153307330 GTCGACCTGTTGGGGGAAGATGG - Intronic
916077932 1:161213632-161213654 CTCTCCCTGTTCAAGGAAGAAGG - Exonic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
921165009 1:212500553-212500575 CTCCTCCTGTGGAGGGGAGAGGG + Intergenic
922377199 1:224980390-224980412 CTCTGCCTGTGGAGAGAGGAAGG + Intronic
922460036 1:225808903-225808925 CTCTACATGTGGATGGAGGAGGG + Intergenic
923414762 1:233745830-233745852 CTTTTCCTGTTGGGGGAGGATGG + Intergenic
1063136839 10:3224636-3224658 CCCCACGTGTTGAGGGAGGAAGG + Intergenic
1065343203 10:24724448-24724470 CTCTTCCTGTGGTGGGAAGGGGG + Intergenic
1065542621 10:26785274-26785296 CTGTACCTGTTGTGAGTAGAGGG + Intronic
1066595861 10:37049493-37049515 TTCGACCAGTTGAGAGAAGAAGG - Intergenic
1069591896 10:69647254-69647276 CTTTTCCTGTTGAGAGGAGATGG + Intergenic
1071373073 10:84973092-84973114 CTTGACCAGTTGAGAGAAGAAGG + Intergenic
1075318230 10:121469025-121469047 CCCTACGTGTTGAGGGGAGGAGG - Intergenic
1076038332 10:127220580-127220602 CCCTAGCTGTAAAGGGAAGAAGG + Intronic
1076848929 10:133083564-133083586 CTCACCCTGGCGAGGGAAGACGG + Intronic
1077613654 11:3660217-3660239 CTCTTCCTCTCCAGGGAAGAAGG - Exonic
1077918486 11:6626069-6626091 CTCCACCTGGTGAGGGTAGGAGG + Exonic
1080833525 11:35918670-35918692 CTCCATCTATTGAGGGAACACGG - Intergenic
1083533349 11:63445826-63445848 CTCTAGCTGCTGTTGGAAGAAGG + Intergenic
1084554570 11:69868215-69868237 CTCTGCCGGTGGACGGAAGAAGG - Intergenic
1085346194 11:75769389-75769411 CTCTACCTGGTGAAGGGAGAGGG - Intronic
1086033147 11:82384243-82384265 CTCTGCCTGTGGAAAGAAGAAGG + Intergenic
1087814039 11:102638845-102638867 CCCCACGTGTTGAGGGACGAAGG - Intergenic
1088818591 11:113437983-113438005 CTCTCCCAGTTGATGGAAGCAGG + Intronic
1089497207 11:118913815-118913837 CCCTACCTGGGGAGGGTAGAGGG + Intronic
1090026902 11:123175419-123175441 CCCCACATGTTGAGGGAGGAAGG - Intronic
1090266172 11:125354240-125354262 CTCCACATGTTCAGGGAAGCAGG + Intronic
1090714844 11:129421402-129421424 ATCTACCTGTTGAAGTAAGGAGG - Intronic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1096100295 12:48966767-48966789 TACTAGCTGTTGATGGAAGATGG - Intronic
1096165218 12:49416865-49416887 CTCTACCTTTTGATGGGAGAAGG + Intronic
1102783047 12:115582171-115582193 CTCAACCTGTGTAGGGAAGGTGG + Intergenic
1104511178 12:129379834-129379856 TGCTGCCTGTTGAGGTAAGAGGG + Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105987045 13:25577858-25577880 CTTTACCAGTTGTGGCAAGAAGG + Intronic
1108408161 13:50124862-50124884 CTCTAACTGCTGTGGGAGGATGG - Intronic
1114264987 14:21068733-21068755 CTCTAACTGTGCGGGGAAGATGG + Intronic
1114549383 14:23524332-23524354 CTCTAGCTGCTCAGGCAAGATGG + Exonic
1114720271 14:24874169-24874191 CTCTTCCTTTTGAGGGTACAGGG + Intronic
1114861866 14:26532716-26532738 TTGTACCTTTTGAGGGCAGAGGG + Intronic
1115243288 14:31270353-31270375 CTCTGCTGGTGGAGGGAAGAGGG - Intergenic
1118888515 14:69887405-69887427 CTCTACCTTTTTGGGGGAGAGGG + Intronic
1121459366 14:94062297-94062319 TTCTCCCTGATCAGGGAAGAAGG + Exonic
1121492397 14:94369786-94369808 CTCCACCTGTAGAGGCAGGAAGG - Intergenic
1121647331 14:95527885-95527907 GTCTATCTGGAGAGGGAAGAAGG + Intergenic
1122242463 14:100377906-100377928 CTCCACCTGTTGGGGGATGGAGG + Intronic
1123502610 15:20903493-20903515 CTCTGCCTGTTGAGTAAGGAGGG + Intergenic
1123508587 15:20972089-20972111 CTCTGCCTGTGGAAGGAAGAGGG - Intergenic
1123559858 15:21477160-21477182 CTCTGCCTGTTGAGTAAGGAGGG + Intergenic
1123565809 15:21545838-21545860 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1123596095 15:21914459-21914481 CTCTGCCTGTTGAGTAAGGAGGG + Intergenic
1123602071 15:21983125-21983147 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1125901659 15:43353780-43353802 CTGTACCTGAAGAGGGTAGAGGG + Exonic
1126369071 15:47926772-47926794 CTCTTCCTGCTGAGAGAAGCTGG - Intergenic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1129123844 15:73421204-73421226 CTCTAGAGGTTGAGGCAAGAGGG - Intergenic
1202968202 15_KI270727v1_random:204322-204344 CTCTGCCTGTTGAGTAAGGAGGG + Intergenic
1202974178 15_KI270727v1_random:272931-272953 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1133499897 16:6356149-6356171 CTCTACCTCTTCAAGGATGAAGG - Intronic
1133668205 16:7991789-7991811 ATCTTCCTGTTAAGGAAAGATGG + Intergenic
1133827409 16:9290738-9290760 GGCTCCCTGTTGAGGGAAGAAGG - Intergenic
1135760745 16:25136220-25136242 ATCTCCCTGTGGAGGGAAGCAGG + Intronic
1138897142 16:61220513-61220535 CTGTACATGTTGGGGGAGGAGGG + Intergenic
1141251275 16:82361171-82361193 CTCTCCTTGTTGGGGCAAGATGG - Intergenic
1143510062 17:7390383-7390405 CTCTAACTGGTGACGGCAGAGGG + Exonic
1152464452 17:80457976-80457998 CTCTCCCTGTTGTGGGAATTCGG - Intergenic
1152493945 17:80657339-80657361 CTCTCCCTGCTGAGTGGAGAGGG + Intronic
1152869184 17:82742884-82742906 CTCTCCCTGGTGTGGGTAGAGGG + Intronic
1153607162 18:6846212-6846234 TCCTTCCTGTTAAGGGAAGAAGG + Intronic
1156475995 18:37405726-37405748 CTCTACCTGTTGAGGGAAGAGGG + Intronic
1160372006 18:78381290-78381312 CTCTACGTGTCGAGGGAGGGTGG + Intergenic
1162138012 19:8568019-8568041 CTCTGCCAGATGAGGAAAGAGGG - Intronic
1163943702 19:20517188-20517210 CTCCACCTGCTGAGGGAAGCCGG - Intergenic
1164816025 19:31204137-31204159 CTCCACATGTGGAGGGAAGGAGG - Intergenic
1166972208 19:46576712-46576734 CCCCACCTGTTAAGGGAAGGAGG + Exonic
927437189 2:23076792-23076814 CCCTACCTGGTGAAGGAAGTTGG + Intergenic
930201148 2:48553199-48553221 GTCTTCCTCTTGATGGAAGAGGG + Intronic
931153249 2:59598522-59598544 CCCCACGTGTTGAGGGAAGCAGG - Intergenic
933023193 2:77220363-77220385 TTCTACGAGTTGAGAGAAGAAGG + Intronic
937288226 2:120766384-120766406 CCCCACCTGTGGAGGGAAGGTGG + Intronic
938981350 2:136530258-136530280 CTCTACCTGCTCAAGGAACAGGG - Intergenic
943513463 2:188855191-188855213 CTTTACATTTTGAAGGAAGATGG + Intergenic
945062183 2:205918970-205918992 CTCCACGTGTTGAGGGAGGGAGG + Intergenic
948187655 2:236034402-236034424 CTCCACCTGCTGTGGAAAGAGGG - Intronic
1169205935 20:3740401-3740423 CTCCACCTTTTGAAGGAGGAGGG + Intronic
1169313534 20:4568860-4568882 CTCTACCAGTTTAGGGGAGCTGG - Intergenic
1170395222 20:15918837-15918859 CTCCACCTGTTTAGGGAGGAAGG + Intronic
1172042162 20:32052993-32053015 CTAGACCTGTTGTGGGAGGAGGG - Intronic
1172440690 20:34964383-34964405 CTCTGCCTGTTGTTGGAGGATGG + Intergenic
1174683563 20:52431600-52431622 CCCCACCTGTTGAGGGAGGGAGG - Intergenic
1174740910 20:53013272-53013294 CTCTACTTGTTAATGGAAGGTGG + Intronic
1175677465 20:60959061-60959083 GGCTACCTGCTGAGGGAAGCTGG - Intergenic
1175843612 20:62047493-62047515 GTCTCGCTGTAGAGGGAAGAGGG - Intronic
1177355275 21:19998832-19998854 CTCCACCTGCTGAGGGAGGTCGG - Intergenic
1177724678 21:24951504-24951526 CTCTGCATTTTGAGGGGAGAGGG - Intergenic
1178630316 21:34253727-34253749 ATCTCCCTGGTGTGGGAAGAGGG - Intergenic
1180021168 21:45128187-45128209 CTCTACCTGCTGCAGGCAGACGG + Intronic
1181322749 22:22021264-22021286 CTCTGTCTGTTGGGGGGAGATGG - Intergenic
1181362765 22:22351371-22351393 CTCTGCCTGTTGGGAGAAGATGG - Intergenic
1181365526 22:22374153-22374175 CTCTGCCTGTTGGGAGAAGATGG - Intergenic
1183457956 22:37932953-37932975 CTGTTACTGATGAGGGAAGAGGG - Intronic
952834153 3:37590013-37590035 CTCTACCTGTTAGGGGATGGCGG - Intronic
953606425 3:44415887-44415909 CTCAGACTGTTGGGGGAAGATGG - Intergenic
954861646 3:53695466-53695488 GTCCACCTGTTCAGGGAAGAAGG - Intronic
955612100 3:60768638-60768660 CTCTACCTTTTGTGGTAAGGTGG + Intronic
956170678 3:66431227-66431249 CTCTGCCCCTTGAGGGAAGGAGG + Intronic
959299189 3:104577090-104577112 CCCTACATGTGGAGTGAAGAGGG + Intergenic
961911322 3:130319328-130319350 GTCTCCCTGGTGAGGGCAGAGGG - Intergenic
962636037 3:137332294-137332316 CTCTACCTCTTGATAGAAGGAGG - Intergenic
962678871 3:137778270-137778292 CACTATCTCTTGAGGGTAGAGGG + Intergenic
964710248 3:159664237-159664259 CTCTGCCTGGTGTGGGCAGAGGG + Intronic
966778298 3:183562042-183562064 CACTACTTGTTGAGGGTAGACGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
970106915 4:12595490-12595512 CTCTCCCTGGTGAGGGGGGATGG - Intergenic
971743228 4:30546630-30546652 CGCCACCTGTGGAGGGAAGGGGG - Intergenic
972374504 4:38457966-38457988 CTCCACATGTTGAGGGAGGGAGG - Intergenic
977649878 4:99457213-99457235 CTCTACCTCCTGAGGGGAGGAGG - Intergenic
977744275 4:100526755-100526777 CTCTAACTCTTGAAGGAAAATGG + Intronic
978508377 4:109486234-109486256 CCCTAACAGTTGAGGGAAAATGG - Intronic
979993934 4:127408527-127408549 CTCATCCTGTGGAAGGAAGATGG + Intergenic
980225044 4:129972053-129972075 AACTACCTGTTGAGGAAAGATGG - Intergenic
980308334 4:131094493-131094515 CTCTACAGGTTGAGGGAGGATGG + Intergenic
980956104 4:139430805-139430827 CTCTCACTGCTGAGGGCAGAAGG - Intergenic
982277525 4:153651736-153651758 CTCTGCCTGTTTGAGGAAGAGGG + Intergenic
982865250 4:160501968-160501990 CTCTGGCTGCTGTGGGAAGAAGG + Intergenic
983156964 4:164360313-164360335 GACTCCCTGTTGAGTGAAGAAGG + Intronic
984082400 4:175263844-175263866 CTCTACCTCTTGATGGAAAAGGG + Intergenic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
987514879 5:18892432-18892454 CCCTGCATGTTGAGGGAAGGAGG - Intergenic
987537346 5:19206360-19206382 CTCCACCTGAGGAGAGAAGAAGG + Intergenic
990618924 5:57538978-57539000 TTCTAACTCTTGAAGGAAGAGGG - Intergenic
991001849 5:61790941-61790963 CTCACCCTGTTGTGGGCAGATGG - Intergenic
992103826 5:73433755-73433777 CTGTTTCTGTTGAGGGAAGGAGG + Intergenic
995319994 5:110823713-110823735 GTCTGCCAGTGGAGGGAAGATGG - Intergenic
996493380 5:124125567-124125589 CGATACCTGATGAGGGAAAACGG - Intergenic
996897280 5:128500378-128500400 CTATATCATTTGAGGGAAGAGGG - Intronic
1000941997 5:167373039-167373061 CACTACCTGTGCAGTGAAGAGGG - Intronic
1004101977 6:12621991-12622013 CCCTACGTGTCGAGGGAAGCAGG - Intergenic
1005321822 6:24663075-24663097 GTCCACCTGTTGAGGAAAGTAGG - Intronic
1006257582 6:32843922-32843944 CTCTCCCGGTTGCGGGAAGCGGG - Exonic
1006314326 6:33280982-33281004 ATGTACCTGGTGAGAGAAGAGGG + Exonic
1007316768 6:40995490-40995512 ATCTACCTCTTGATGGAAGGAGG - Intergenic
1007529084 6:42524741-42524763 CCCCACGTGTTGAGGGAGGAAGG - Intergenic
1011333284 6:86233958-86233980 CTCTGCCTGATGAGAGGAGAGGG - Intergenic
1017569316 6:155726111-155726133 CTTTACGTGTCGAGGGAAGGAGG + Intergenic
1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG + Intergenic
1018080418 6:160254988-160255010 CTCTACCTGGTGGCGGAGGAGGG + Intronic
1021213474 7:17886220-17886242 ATCTTCCTGTAGAGGGAGGAGGG - Intronic
1022324555 7:29319347-29319369 TTCTACATGTTGAGGGGAGGAGG + Intronic
1022586537 7:31618530-31618552 CTCTACCTTTTCTGAGAAGAAGG - Intronic
1026552134 7:71377708-71377730 CTCCACGTGTTGAGGGATGGAGG + Intronic
1026731436 7:72914998-72915020 CTCCACCTCTGCAGGGAAGAGGG + Intronic
1027112604 7:75452821-75452843 CTCCACCTCTTCAGGGAAGAGGG - Intronic
1027230612 7:76269679-76269701 GTTTAGCTGGTGAGGGAAGAGGG + Intronic
1027284850 7:76637427-76637449 CTCCACCTCTTCAGGGAAGAGGG - Intergenic
1032352589 7:131179346-131179368 GTCTACCTATTGAAGGAAGAAGG + Intronic
1033573432 7:142656682-142656704 CTCTGGATGTTGAGGGAAGCAGG - Intergenic
1033710593 7:143939089-143939111 CCCTCCCTGTGGAGGGAAGTAGG + Intergenic
1035789944 8:2295713-2295735 CTCCACCTGTGGAGGGGACACGG - Intergenic
1035802861 8:2425992-2426014 CTCCACCTGTGGAGGGGACACGG + Intergenic
1036471025 8:9052940-9052962 CTCAACCTCTGGAGAGAAGAGGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037458622 8:19086916-19086938 CTGTACCTGAGGAGGAAAGAAGG + Intergenic
1038156900 8:24999971-24999993 CTGCACCAGTTCAGGGAAGAGGG - Intergenic
1039413295 8:37373619-37373641 CCCCACATGTTGAGGGAGGAAGG - Intergenic
1041441560 8:57902230-57902252 TTCTACTTGATCAGGGAAGAAGG + Intergenic
1042887678 8:73569965-73569987 TTCTACAAGTTGAGAGAAGAAGG + Intronic
1046089622 8:109485574-109485596 CTATAATTGTTGAGGAAAGAAGG + Intronic
1046730657 8:117722405-117722427 ATCCTCCTGTTGAGGGAGGATGG + Intergenic
1050583972 9:7090728-7090750 CTATACCTGCTGAGGGAAGGAGG - Intergenic
1051994765 9:23201623-23201645 CCCCACGTGTTGAGGGAAGGAGG - Intergenic
1052386599 9:27830366-27830388 CCCCACATGTTGAGGGAGGAAGG + Intergenic
1052739751 9:32382165-32382187 CCCCACCTGTGGAGGGAAGGAGG + Intergenic
1052782313 9:32794212-32794234 GTCTCCCTGCTGAGGGAAGAGGG - Intergenic
1052886038 9:33649076-33649098 CTCTGGATGTTGAGGGAAGCAGG - Intergenic
1056279852 9:85030380-85030402 CACTACCTGTAGATGGCAGATGG - Intergenic
1057277879 9:93685891-93685913 CTTTCCCTGTTCAGGGAGGAGGG + Intergenic
1057855317 9:98596816-98596838 CTCTAGCTGTTAAGGGGAGGGGG - Intronic
1057856435 9:98604498-98604520 TTCTACATGTTGTGGGTAGAAGG - Intronic
1058704936 9:107630256-107630278 CTCTGCCTGTGGAGGGAGGCTGG + Intergenic
1059218196 9:112586969-112586991 CTCTACCTGTGGGGAGAAGGGGG - Intronic
1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG + Intergenic
1062176208 9:135164447-135164469 CTCTGCCTGTGGAGGGAGGGGGG - Intergenic
1062722293 9:138050750-138050772 CTCCGCCAGCTGAGGGAAGAGGG - Intronic
1186276095 X:7939665-7939687 CTCCACCTGCTGAGTGAGGAAGG + Intergenic
1186403748 X:9283456-9283478 TTTTACCAGTTGAGGGAGGATGG - Intergenic
1188940215 X:36229075-36229097 CTCTGCTTGTTGAAGCAAGAAGG - Intronic
1189161435 X:38813228-38813250 TTCTACCTCTTGAAGGAAGGTGG - Intergenic
1189785548 X:44555888-44555910 CTTCACCTTTTGAGGTAAGAGGG + Intergenic
1190374284 X:49774368-49774390 CTCTGCCTGTGGAAGGAGGAGGG - Intergenic
1190902561 X:54692240-54692262 TTCTACCTGTTAAGAGTAGATGG + Intergenic
1191718839 X:64212195-64212217 CTCTACCTGCTCTGGGAGGAAGG + Intergenic
1192908861 X:75582072-75582094 CTCTACCAGTTCTGGGAAAATGG + Intergenic
1193912094 X:87317917-87317939 TGCTACCTGTGGTGGGAAGAAGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1196740711 X:119023564-119023586 TTCTTACCGTTGAGGGAAGAAGG + Intergenic
1198428263 X:136541209-136541231 CCCTGCCTGCTGAGGGAAGTTGG + Intronic
1199149339 X:144411370-144411392 TTCTACCTCTTGATGGAAGAAGG + Intergenic
1200925124 Y:8647484-8647506 CTCCACCTGATGAGGGAAGTTGG + Intergenic