ID: 1156480347

View in Genome Browser
Species Human (GRCh38)
Location 18:37432336-37432358
Sequence CTCCCCCTCTGGGCCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156480347_1156480357 -6 Left 1156480347 18:37432336-37432358 CCCACCTGGGCCCAGAGGGGGAG 0: 1
1: 0
2: 3
3: 36
4: 351
Right 1156480357 18:37432353-37432375 GGGGAGCTTGGAGGTGGGATGGG 0: 1
1: 0
2: 8
3: 73
4: 628
1156480347_1156480358 1 Left 1156480347 18:37432336-37432358 CCCACCTGGGCCCAGAGGGGGAG 0: 1
1: 0
2: 3
3: 36
4: 351
Right 1156480358 18:37432360-37432382 TTGGAGGTGGGATGGGAAAGAGG 0: 1
1: 0
2: 7
3: 75
4: 865
1156480347_1156480356 -7 Left 1156480347 18:37432336-37432358 CCCACCTGGGCCCAGAGGGGGAG 0: 1
1: 0
2: 3
3: 36
4: 351
Right 1156480356 18:37432352-37432374 GGGGGAGCTTGGAGGTGGGATGG 0: 1
1: 0
2: 4
3: 127
4: 1367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156480347 Original CRISPR CTCCCCCTCTGGGCCCAGGT GGG (reversed) Intronic
900140790 1:1138841-1138863 CTGCCCGTCTGGGGACAGGTTGG + Intergenic
900409120 1:2504918-2504940 CTCCCCAGCCGGGCCCAGGCTGG - Exonic
900463759 1:2813680-2813702 ATCCCCCTCTGGGCCCGGGAGGG - Intergenic
900524999 1:3124215-3124237 CTCCAGCTCAGGGCCCAGGCTGG - Intronic
900525630 1:3127031-3127053 CTCCAGCTCGGGGCCCAGGCTGG - Intronic
900562010 1:3311862-3311884 CAGCCCCTCTGGACCCAGGGTGG - Intronic
900651013 1:3730131-3730153 CTCACCCACGGGCCCCAGGTTGG - Exonic
900998782 1:6136993-6137015 CTGCCCCTCTGGTCCTAGGCTGG - Intronic
901049051 1:6417137-6417159 CTAACCCTCTGGGCACAGGGAGG + Exonic
901051646 1:6428532-6428554 CTGGCCCTCTGGCCCCAGGATGG - Intronic
902329975 1:15726526-15726548 GTCCCACTCTGGTTCCAGGTTGG - Intronic
902482677 1:16719829-16719851 CTGGCCCTCTGGCCCCAGGATGG + Intergenic
902656275 1:17870569-17870591 ATCTCCCTCTGTGCCCAGGCTGG + Intergenic
904699984 1:32352195-32352217 CTCCCCCTCCTCGCCCAGGCAGG - Intronic
904858047 1:33514755-33514777 CTCTCCCTCCAGGCCCAGGGGGG + Exonic
905182736 1:36176825-36176847 CACCGCCTCTGAGCTCAGGTGGG + Exonic
906511059 1:46410695-46410717 CCTCCCCCCAGGGCCCAGGTCGG - Intronic
907540958 1:55215197-55215219 CGCCGCCTCCGCGCCCAGGTTGG + Intergenic
909072840 1:71017215-71017237 CTCTCCCTCTGGCCACAGCTGGG - Intronic
910629887 1:89343642-89343664 CTCCCTCTATAGGTCCAGGTTGG + Intergenic
910818934 1:91325088-91325110 CTCCCCCTCTGGCCCAGGGCAGG - Intronic
910936171 1:92485666-92485688 CTCACCGTCCGGGCCCAGGAAGG + Intronic
911591727 1:99755395-99755417 CTCCCCCTCCGACCCCAGGCTGG - Intronic
912340418 1:108908940-108908962 GTCTCCCTGTGTGCCCAGGTCGG - Intronic
912478276 1:109957051-109957073 CTCCTCCTTTGGTCTCAGGTAGG - Intergenic
915117967 1:153612275-153612297 CTCCACCTCAGGACCCAGGCAGG - Intronic
915166226 1:153949162-153949184 CATGCCCACTGGGCCCAGGTGGG + Exonic
915333894 1:155129609-155129631 CCCCCACGCTGGGCCCAGCTTGG - Intronic
915926967 1:160029920-160029942 CTCACCATCTTGCCCCAGGTGGG + Exonic
917525323 1:175783239-175783261 CTGCCCCTCTTGGCCCAGTCAGG - Intergenic
917629574 1:176878965-176878987 CTCCACCTCTGGGCAGAGGACGG - Intronic
919925235 1:202188686-202188708 CTCCCTCCCTGGGCCCAGGCTGG + Intergenic
920237270 1:204516465-204516487 CTCCCCCGCCGAGCCCGGGTGGG - Exonic
920398561 1:205663200-205663222 CTCCTCCTGGGTGCCCAGGTAGG + Exonic
922568675 1:226618805-226618827 CTCCTGCTCTGGGCACAGATAGG - Intergenic
923612108 1:235504577-235504599 GTCCCGCTCTGGGCCCAGGCAGG + Intergenic
923623164 1:235594381-235594403 CTCCACCTGTGGCCCCAGATGGG - Intronic
1064334143 10:14423274-14423296 CTCCACCCCAGGGCGCAGGTCGG - Intronic
1064841724 10:19599952-19599974 CTCCCCATCTGGGCCCTGGAAGG - Intronic
1069987635 10:72295402-72295424 GTCCCTCTCTGGGACCAGGCAGG - Intergenic
1072753034 10:97997421-97997443 GTCTCCCTCTGTGCCCAGGCTGG - Intronic
1073291118 10:102413828-102413850 CTCCCTCCCTGGGGCCAGCTTGG + Exonic
1073436429 10:103519458-103519480 CTTCCCCTCAGTGCCCAGGCAGG + Intronic
1073729835 10:106274352-106274374 CTCCCTCTATAGGCCCAGATTGG + Intergenic
1076444846 10:130507384-130507406 CTCCTCCTCTGGGGCCACATGGG - Intergenic
1076687319 10:132204000-132204022 CAGCCCCTCTGGGCACAGGCTGG - Intronic
1076770257 10:132659047-132659069 CTCATCCCCAGGGCCCAGGTCGG - Intronic
1077260934 11:1619939-1619961 CTCTCCTTCTGGGAACAGGTTGG - Intergenic
1077645026 11:3916026-3916048 ATCACCCTGTGGGCCCAGGCTGG - Intronic
1078847161 11:15128739-15128761 CCTCACCTCTGGGTCCAGGTGGG - Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1081836707 11:46161428-46161450 CTCCCTCTCTGTGTCCACGTGGG - Intergenic
1084225110 11:67710939-67710961 CTCGCCCTCTGGACCCATGGGGG + Intergenic
1084262929 11:67990781-67990803 CTCGCCCTCTGGACCCATGGGGG + Intergenic
1084312843 11:68326729-68326751 CTCCAGCTGTGAGCCCAGGTGGG + Intronic
1084460058 11:69292141-69292163 CTCCCCAGCAGGACCCAGGTGGG + Intergenic
1084689312 11:70715925-70715947 GCTCCCCTCTGGGCCCAGGCCGG - Intronic
1084799163 11:71530502-71530524 CTCTCCTTCTGGGAACAGGTTGG + Intronic
1084810464 11:71608335-71608357 CTCGCCCTCTGGACCCATGGGGG - Intergenic
1084872208 11:72105925-72105947 CTCCACCCCAGGGCCCAGGTAGG + Exonic
1085386560 11:76161322-76161344 CTCCCATTCAGGGCCCAGGGTGG + Intergenic
1089288084 11:117420365-117420387 CACCTCCACTGGGCCCAGGAAGG + Intergenic
1089350623 11:117819720-117819742 GTACCCCCCTGGGCCAAGGTGGG - Intronic
1090201629 11:124861828-124861850 CTCCCCATATGGCCCCAGCTTGG + Intergenic
1090423835 11:126593502-126593524 GACCCCCTCTGGGTACAGGTGGG + Intronic
1090455301 11:126843882-126843904 CTCCCCTTTTGAGCCCAGGTAGG - Intronic
1091140316 11:133228825-133228847 CTGCTCCTCTTGGCCCAGCTTGG - Intronic
1091704377 12:2683914-2683936 CTCCCGCCCTGGGCCCCCGTGGG - Intronic
1095703646 12:45216130-45216152 CTCCGGCTCTGGGCTCCGGTCGG + Exonic
1096522729 12:52193290-52193312 CTCTTCCTCTGGGCCCAGAGGGG - Intergenic
1096562091 12:52443022-52443044 CTCCCACTCTGGCCCCAGGAGGG - Intergenic
1096982673 12:55737427-55737449 CTCCCTCTCTGGGCCCATGGTGG - Intergenic
1098508583 12:71284380-71284402 CACACCTTCTGGGCCCTGGTTGG + Intronic
1102083304 12:110115775-110115797 CTCCCCCTCTTTGTCCAGGGAGG + Intergenic
1102749633 12:115281090-115281112 CTCTCACTCTGTCCCCAGGTTGG - Intergenic
1106099374 13:26681260-26681282 CTCCCCCTCAGGCCCCAGAGGGG + Exonic
1106452852 13:29899074-29899096 GTCTCGCTCTGCGCCCAGGTTGG - Intergenic
1106558640 13:30830820-30830842 CTTCCCCTCTGGTCTCTGGTTGG - Intergenic
1107479173 13:40771235-40771257 CTCCCCCTTTGCGCTCCGGTGGG + Intergenic
1109936417 13:69291467-69291489 CTCCCCCCTTGGACCTAGGTAGG + Intergenic
1113577723 13:111405726-111405748 TTCTCCCTCTGGGTGCAGGTGGG + Intergenic
1113723002 13:112574924-112574946 CTCCCCACCTGGGCCCTGGCTGG - Intronic
1113842117 13:113366156-113366178 CTCCCAGTCAGGTCCCAGGTTGG - Intergenic
1113875139 13:113589569-113589591 CTCCGCCTCAGGGCCTAGGGAGG + Intronic
1114139429 14:19894144-19894166 CTCCACCTTTGGGCACATGTGGG + Intergenic
1115398210 14:32933207-32933229 CTGCCCCTCTGGGTCCCGGCGGG + Intergenic
1116430096 14:44836142-44836164 CACCCCGGCGGGGCCCAGGTTGG + Intergenic
1117402342 14:55369790-55369812 CTCCCAGTCTGTGCCCAGGTCGG + Exonic
1118314928 14:64720274-64720296 CTCCCTGTCTGGGGCCAAGTAGG + Intronic
1118325716 14:64779089-64779111 CTACCCCCGTGGGGCCAGGTGGG + Intronic
1118549352 14:66932492-66932514 GTCCCCTTCTGGCCCAAGGTGGG + Intronic
1118736791 14:68706736-68706758 CTCCTCCTCTAGGCCCAGCAGGG + Intronic
1118765089 14:68904268-68904290 CTCACCCTCTGAGCCCTGGGTGG - Intronic
1119749675 14:77068315-77068337 CCCCCTACCTGGGCCCAGGTGGG + Intergenic
1119749678 14:77068318-77068340 ATACCCACCTGGGCCCAGGTAGG - Intergenic
1120442597 14:84559207-84559229 CTCCCTCTCTAGGCCCAGATTGG - Intergenic
1120701416 14:87703424-87703446 GTCTCACTCTGTGCCCAGGTTGG + Intergenic
1120963630 14:90148393-90148415 CTCCCCTTCTGGGCCATGATGGG - Intronic
1121223140 14:92301435-92301457 CTGCCCCTCTGGCCTCAGGATGG - Intergenic
1121269419 14:92627996-92628018 CTCCCCCTGTGGGCTGGGGTCGG + Intronic
1122222147 14:100246404-100246426 CTCCCCTGGTGTGCCCAGGTTGG + Intronic
1125569365 15:40704101-40704123 GTCTCCCTCTGTGCCCAGGCTGG + Intronic
1126042785 15:44609159-44609181 CTCACTCTGTGGGCCCAGGCTGG + Intronic
1127721303 15:61702704-61702726 CTGCACCTCTGGGGCCAGGATGG - Intergenic
1128032691 15:64495646-64495668 CTCCACCTGGAGGCCCAGGTGGG - Intronic
1128732297 15:70029468-70029490 CTGCACAGCTGGGCCCAGGTCGG + Intergenic
1129224568 15:74161230-74161252 GTCTCTCTCTGAGCCCAGGTTGG + Intergenic
1129681924 15:77662988-77663010 CTCCGCCTCTGGGGGAAGGTGGG + Intronic
1129697906 15:77751066-77751088 CTCCCTCTCTGTGTCCAGGGCGG + Intronic
1130027595 15:80283224-80283246 CTCACCTGCTGGTCCCAGGTGGG + Intergenic
1130260765 15:82352738-82352760 CTCCCCTTCTAGGACCACGTGGG + Intergenic
1130930844 15:88426464-88426486 CTCCTCCCCTGGGCTCTGGTAGG + Intergenic
1131527940 15:93167511-93167533 CTCCCACACTGGGCCCAAGGAGG + Intergenic
1132565285 16:619657-619679 CCCCCCATGTGGGCCCAGGGAGG + Intronic
1132843662 16:1990337-1990359 CTCCCCCGCCGGCCTCAGGTTGG + Intronic
1132844400 16:1993195-1993217 CACCCCCTCTTGGCCCCGGATGG - Exonic
1133346125 16:5071760-5071782 CTCGCCCTCTCGGCCCACTTCGG + Intronic
1133352095 16:5108500-5108522 CTCCACCTGTGGCCCCAGGGCGG - Intergenic
1133363003 16:5188755-5188777 CACCCCCTTTGAGCTCAGGTGGG + Intergenic
1133456552 16:5947282-5947304 CTCCCCCTCTGACCTCAGCTTGG - Intergenic
1134002466 16:10793434-10793456 CTCCACCTCTGGGCACTGCTTGG + Intronic
1134316217 16:13121127-13121149 CTCCCCCTGTGGCCCAAGCTGGG - Intronic
1134834248 16:17347873-17347895 CTCCCCTTCAGGCCCCAGGGTGG - Intronic
1136420044 16:30126201-30126223 GTCTCCCTCTGTGCCCAGGCTGG + Intergenic
1137435201 16:48448984-48449006 CTCCCCATCTGGTCCCAGTGTGG + Intergenic
1137676031 16:50304302-50304324 CCTCCCCTCTCGGCCCAGGAAGG - Intronic
1138446476 16:57067369-57067391 CTCCCTGTCTGTGTCCAGGTTGG + Exonic
1141413484 16:83852520-83852542 CTCCCCTTTTGAGCCCATGTAGG - Intergenic
1141635516 16:85312018-85312040 CTCGACCTCTGGGACCAGGGTGG + Intergenic
1141800041 16:86301255-86301277 CTCCTGCTCTGAGCCCAGGAGGG + Intergenic
1141829407 16:86501322-86501344 CTTCCCCTCTGGGCTCTGGGAGG - Intergenic
1142238465 16:88934302-88934324 CCTCCCCTATGGGCCCAAGTCGG - Intronic
1142693462 17:1620799-1620821 CTCTCCCTCTGGTCCCACCTGGG + Intronic
1142712932 17:1733140-1733162 CTTCCCCTCTGGGCCCTGCACGG + Intronic
1144738231 17:17566763-17566785 CTGCCCCCCTGCGCCCAGTTGGG - Intronic
1145181805 17:20759660-20759682 CTCCCTCTGTTGGCCCAGGCTGG + Intergenic
1145991160 17:29080271-29080293 CTCCAGGTCTGGGTCCAGGTAGG + Intronic
1146063288 17:29618043-29618065 CTCGCGCTCTGGGACCCGGTAGG - Intronic
1146655960 17:34635319-34635341 CTCCCCCTCTGCTCTCAGGGAGG - Intronic
1146656378 17:34637491-34637513 CGCCCCCGCCGGGCCCTGGTTGG - Exonic
1147594243 17:41706379-41706401 CACCACCCCTGGGCCCAGGCTGG - Intergenic
1148125240 17:45233316-45233338 CTTCCTCTCTGGGCCTAGGAAGG + Intronic
1148153448 17:45409914-45409936 CTCCTCCTCTGGCCTGAGGTCGG - Intronic
1148153656 17:45410780-45410802 CACTCCCTCTAGGCCCAGGGAGG + Intronic
1148617804 17:49013808-49013830 CTCCCCCTCGGGGCCCAGGGCGG + Intronic
1148875363 17:50683931-50683953 CTTCCCTTCTCCGCCCAGGTGGG + Exonic
1149500626 17:57149654-57149676 CTTCCCCTCTGTGCCCAGCAGGG - Intergenic
1151315616 17:73320255-73320277 CTCCCTTTCTGTGCCCAGGATGG - Intergenic
1151521593 17:74634227-74634249 GTCTCACTCTGGGCCCAGGCTGG - Intergenic
1151682475 17:75629277-75629299 CCTCCCCTCTGGGCCCAGGGAGG + Exonic
1151827246 17:76530250-76530272 CTCCCCTTGGGGGCCCAGGGAGG + Intronic
1152377542 17:79926559-79926581 CTCCCCATCTGGGCCTGGGGCGG + Intergenic
1152559895 17:81072678-81072700 CTCCCACTCTGAGCACAGGCGGG + Intronic
1153392528 18:4578552-4578574 CTCTCGCTCTGGTCCCAGGAAGG + Intergenic
1154299753 18:13182765-13182787 GTCCCCCTCTAGGCTCAGATGGG - Intergenic
1155268683 18:24118465-24118487 CTTCCCCTCTGGGCCTGGCTTGG + Intronic
1156480347 18:37432336-37432358 CTCCCCCTCTGGGCCCAGGTGGG - Intronic
1157195018 18:45614023-45614045 CTAGGCCTCTGGGCCCAGGATGG - Intronic
1157284026 18:46364936-46364958 CTGGCCCTCTGGTCCCAGCTGGG + Intronic
1160755578 19:755299-755321 TTGTCCCGCTGGGCCCAGGTGGG - Intronic
1160941250 19:1621405-1621427 GTCCCCTTCTGGGCCTGGGTGGG + Intronic
1160941259 19:1621431-1621453 GTCCCCCTCTGGGCCTGGATGGG + Intronic
1160941277 19:1621483-1621505 GTCCCTCTCTGGGCCTGGGTGGG + Intronic
1160941286 19:1621509-1621531 GTCCCTCTCTGGGCCTGGGTGGG + Intronic
1161126631 19:2561444-2561466 CTGCCCTTCTGTGCCCAGGAGGG + Intronic
1161348019 19:3777654-3777676 CTCCCCATCTTGGCCCATGGAGG - Intergenic
1161488584 19:4549329-4549351 GTCTCCCTCTGGCCCCAGGTTGG + Intronic
1162356152 19:10186285-10186307 CTGCCACTCTGGGGCCAGGCAGG - Intronic
1162948018 19:14055143-14055165 GTCCCCCTCTGAGCCCAGGGAGG - Exonic
1163233483 19:16018654-16018676 CTCTCCCACTGTGCCCTGGTGGG + Intergenic
1163577907 19:18121542-18121564 CTCCCACTCTGCCCCCAGCTGGG - Intronic
1163675150 19:18651999-18652021 CTCACCCTCATGGCCCAGCTGGG - Intronic
1163762905 19:19146753-19146775 GTCCCCCTCGGGGCCCAGCCAGG + Exonic
1163784966 19:19270271-19270293 CTCTCCCTGTGGGGGCAGGTGGG + Exonic
1163810583 19:19429103-19429125 CTCCTCCTCCGTGCCCACGTGGG + Intronic
1164564236 19:29314632-29314654 CTCCTCCTCTGGGCCCTGGGAGG - Intergenic
1164595598 19:29529151-29529173 CTCCTCCCCTGCGCCCCGGTGGG - Intronic
1164933998 19:32197187-32197209 CCACCCCTCTGGCCCCAGGTAGG + Intergenic
1165403289 19:35615280-35615302 CTCCTCCTCCGGGCCCAAGCTGG + Exonic
1166748758 19:45154667-45154689 CAGCCCCTCTGGCCCCACGTGGG + Intronic
1167323888 19:48812516-48812538 CCCCCCCCCTGGGTCCAGCTGGG + Intergenic
1167323892 19:48812519-48812541 CTCCCCAGCTGGACCCAGGGGGG - Intergenic
1167449174 19:49556964-49556986 GACCCACACTGGGCCCAGGTTGG + Exonic
924985481 2:265314-265336 CCCCTCCAATGGGCCCAGGTAGG + Intronic
925266015 2:2566836-2566858 CTTCCCATCTAGGCCCAGGCCGG - Intergenic
925338069 2:3113260-3113282 CTCCTCCTGTGGGCCCTGGTGGG - Intergenic
925902461 2:8518240-8518262 CTCCGCCTCTGGCCCATGGTAGG + Intergenic
925975463 2:9138984-9139006 CTCCCCCGCTGGGCCAGGGTGGG + Intergenic
926060205 2:9800358-9800380 CTGGCCCTGTGGGGCCAGGTGGG + Intergenic
926217515 2:10914460-10914482 CTCCCCCTGCAGGCCCAGGATGG + Intergenic
927357969 2:22195359-22195381 GTCTTGCTCTGGGCCCAGGTTGG - Intergenic
928204076 2:29271697-29271719 CACCCCCACTGGGCCCTGGCTGG - Intronic
930662442 2:54068355-54068377 GTCCACCTCTGGTCACAGGTAGG + Intronic
931429364 2:62196596-62196618 CTCTCCCTCTGGGCTGAGGTTGG - Intronic
932408359 2:71529086-71529108 CTGCCCCTCTGAGCCCTGGAGGG + Intronic
933551698 2:83785911-83785933 GTCCCGCACTGTGCCCAGGTTGG + Intergenic
933637821 2:84726339-84726361 ATGCCCCTCAGGGCCCTGGTGGG + Intronic
935179648 2:100677916-100677938 CGCTCCCTCTGTCCCCAGGTGGG - Intergenic
935728761 2:106047329-106047351 CACCCCCTCTGTGCCCAGCATGG + Intergenic
937081251 2:119141664-119141686 CCCACCCAGTGGGCCCAGGTAGG + Intergenic
937093842 2:119223609-119223631 CTCCTCCCCTGGCCCCAGGCGGG - Intergenic
937223175 2:120353612-120353634 CTGTCCCACTGGTCCCAGGTGGG - Intergenic
938253053 2:129831119-129831141 CTCACCCTCTGGGCTCTTGTTGG - Intergenic
942178152 2:173354828-173354850 CCGCCCCTCCGGGCCCGGGTCGG + Intronic
942768184 2:179482432-179482454 CTGCCCCTCTGGGCCCATGACGG - Intronic
943739146 2:191391787-191391809 CACACCCTCCTGGCCCAGGTTGG + Intronic
945724903 2:213463969-213463991 CTCCCTCTCTAGGCCCAGATTGG - Intronic
947731824 2:232435490-232435512 CTGCCCCGCTGTGCCCAGTTGGG + Intergenic
948596163 2:239081188-239081210 CTCTCCTTCTGGCCACAGGTGGG - Exonic
948615866 2:239198411-239198433 CTCACCCTCTAGTCCCAGGATGG - Intronic
948704087 2:239778600-239778622 CTCCACTCCTGGGCCCAGGCAGG - Intronic
948781137 2:240322672-240322694 CTCCACCTCGGGCCCCAGCTGGG + Intergenic
1169074997 20:2754973-2754995 CCCCCCCACAGGGCCCAGGCTGG + Intronic
1172662069 20:36574499-36574521 CTCCCCCTCCGGGCCCAGTTCGG + Intronic
1173446939 20:43127664-43127686 ACATCCCTCTGGGCCCAGGTTGG - Intronic
1173650710 20:44662407-44662429 CTCCCCCACTGGGACCAGCTGGG - Intergenic
1174266834 20:49338105-49338127 CTCCCCACCTGGGGCCAGGCTGG + Intergenic
1176124915 20:63471099-63471121 ACACCCCTCTCGGCCCAGGTGGG + Intronic
1176886826 21:14266586-14266608 CTCCTCCTCTGTGACCTGGTAGG + Intergenic
1179791698 21:43759607-43759629 CCCCTGCTCTGGGCCCAGGCAGG - Exonic
1180177346 21:46097411-46097433 GTCCCCGGCTGGGCTCAGGTGGG + Intergenic
1180796345 22:18607640-18607662 TTCTCCTTCTGAGCCCAGGTTGG + Exonic
1181225378 22:21387631-21387653 TTCTCCTTCTGAGCCCAGGTTGG - Exonic
1181253255 22:21547182-21547204 TTCTCCTTCTGAGCCCAGGTTGG + Exonic
1181393245 22:22599294-22599316 CTTCCCCTCTGGGCTTTGGTGGG - Intergenic
1181808709 22:25390799-25390821 CTCCAGCTGTGAGCCCAGGTGGG - Intronic
1182115564 22:27754415-27754437 CACCCTCTCTGAGCCCAGGGTGG - Intronic
1182736476 22:32534830-32534852 CTCCCTCTCTGGGCCTCAGTAGG - Intronic
1183184771 22:36285619-36285641 CTCCCACTCTGGGCTCTGGCTGG - Intronic
1183542069 22:38435246-38435268 CTCCCCATCTAGGCCCAGGAGGG - Intronic
1183929841 22:41229726-41229748 CTACTCTTCTGTGCCCAGGTGGG - Exonic
1184100207 22:42338057-42338079 TGCCCCCACTGGACCCAGGTGGG - Intronic
1184403426 22:44286755-44286777 CATCCACTCTGGGCACAGGTCGG - Intronic
1184738425 22:46412511-46412533 CTCCCTCTCTGGGCCAGGATTGG + Intronic
1184755848 22:46515259-46515281 CTCCCCAGGAGGGCCCAGGTGGG - Intronic
1185121735 22:48975377-48975399 CTCCACGTCTGTGCCAAGGTCGG + Intergenic
1185170688 22:49292008-49292030 CACCTCCTCTGGGCCCAGGGTGG + Intergenic
1185249020 22:49789861-49789883 CTCCAGCTCTCGGCCCAGCTAGG + Intronic
1185249700 22:49794242-49794264 CTGCTCCTCCAGGCCCAGGTGGG + Exonic
951313302 3:21157376-21157398 CTCCCTCTCTGAACACAGGTGGG + Intergenic
952684885 3:36135888-36135910 CTCCATCTCTAGGCCCAGATTGG + Intergenic
953172981 3:40524686-40524708 CTCGCCCTCTAGGCACAAGTGGG - Intergenic
953320159 3:41964109-41964131 CTCTCCCTCTGGGCACAAGCTGG - Intergenic
954426620 3:50446778-50446800 CAATCCCTCTGGGCACAGGTTGG - Intronic
954577769 3:51686218-51686240 CTGCCTCTGTGGGACCAGGTAGG + Intronic
954881025 3:53836168-53836190 CACCGCCTCTGGGCCCAGCCAGG - Intronic
954907616 3:54076312-54076334 CTCCCCCTGTGGGCTGGGGTAGG - Intergenic
955075170 3:55606879-55606901 CTCCCACTCTAGGCAAAGGTTGG + Intronic
959684934 3:109134673-109134695 ATTCACCTCTGGGCCCAGTTGGG + Intergenic
961358289 3:126352355-126352377 CTCTCCCGCTGGACCCAGGATGG + Exonic
961425018 3:126838320-126838342 CTCTCCCTCCTGGCACAGGTAGG + Intronic
961478314 3:127162976-127162998 CCCCAGCTCTGGGCCCAAGTCGG - Intergenic
961509747 3:127393598-127393620 CTTCCCCTGGGGGCCCTGGTAGG - Intergenic
961512368 3:127410888-127410910 GTCCACCTCTGTGCCCAGGCAGG - Intergenic
961628900 3:128282088-128282110 CCCCTCCTCTGGGCCCTGGTGGG - Intronic
962308733 3:134311268-134311290 ATTTCCCACTGGGCCCAGGTAGG - Intergenic
963968565 3:151402555-151402577 CTCCCCCACTGGCCCTAGGGCGG + Intronic
964006800 3:151839577-151839599 CTCCCTCTCTCAGCCCAGGCTGG - Intergenic
964159794 3:153633259-153633281 GTCTCCCTCTGGGACCAGCTGGG - Intergenic
965293849 3:166917736-166917758 CACCCCTTCTGTGCCCAAGTTGG + Intergenic
965371196 3:167864157-167864179 TTTCCTTTCTGGGCCCAGGTGGG - Intergenic
968233140 3:197015968-197015990 CTCCCCCGCTGCGGCCAGGTGGG + Intronic
968286112 3:197509926-197509948 GTCCCCCTCTGGGCTCTGGAGGG + Exonic
968793896 4:2688955-2688977 CTGCCCCACAGGGCCCAGGGCGG + Intronic
969021436 4:4142697-4142719 CTCGCCCTCTGGACCCATGGGGG + Intergenic
969098101 4:4749475-4749497 CTCCCCAGCGGGGCCAAGGTAGG - Intergenic
969685858 4:8673731-8673753 GTCCCCCTCTGGGCCTCCGTTGG + Intergenic
969792009 4:9498802-9498824 CTCGCCCTCTGGACCCATGGGGG - Intergenic
970594234 4:17585255-17585277 CTCCCCATGTGGACCCAAGTGGG - Intronic
972583926 4:40419472-40419494 ATCCCCCCCTGGGGCCAGGAAGG + Intergenic
972675746 4:41257720-41257742 TTTCCCCTCACGGCCCAGGTAGG + Exonic
972986356 4:44770509-44770531 GTCTCCCTCTGTGCCCAGGCTGG - Intergenic
973175073 4:47195335-47195357 GTCTCCCTCTGTGCCCAGGCTGG - Intronic
974469763 4:62303042-62303064 CTCCACCTCTGGCTCCAGGCAGG + Intergenic
974741690 4:66014715-66014737 CTCCCTCCCTGGGCCAAGGGAGG - Intergenic
975224677 4:71858041-71858063 CTCCCCCTGTGCGATCAGGTTGG - Intergenic
975614669 4:76234594-76234616 CTCCACCCCAGGGCGCAGGTTGG + Intronic
980366306 4:131809037-131809059 CTCTCCCTCTGTCCCCAGGCTGG + Intergenic
981324065 4:143426511-143426533 GTCTCCCTCTGTGCCCAGGCTGG - Intronic
985010866 4:185580771-185580793 CTCCCACTCTGAGCCCAGGCTGG + Intergenic
987155137 5:15081593-15081615 CTCCACCCCAGTGCCCAGGTTGG + Intergenic
988381529 5:30502759-30502781 GTCTCACTCTGTGCCCAGGTTGG - Intergenic
988559624 5:32268628-32268650 CTCCCCCACTGGCTTCAGGTGGG + Intronic
988603725 5:32662837-32662859 CTCCCTCTATAGGCCCAGATTGG - Intergenic
992864157 5:80940921-80940943 GTCTCGCTCTGGGCCCAGGCTGG + Intergenic
992944709 5:81798714-81798736 CTCCCCGCCTGGGCCCTGCTGGG - Intergenic
993120942 5:83773685-83773707 CTCCCCCTCTCAGACCACGTAGG - Intergenic
993468699 5:88280182-88280204 CTGCCAATCTGTGCCCAGGTGGG - Intergenic
994092259 5:95819867-95819889 GTCTCCCTCTGTGCCCAGGCTGG - Intronic
996429048 5:123350328-123350350 TTCGGCCTCTGGGCCCAAGTAGG + Intronic
999256899 5:150214587-150214609 CGCCCCCTCTGGCCACAGGGAGG + Intronic
999379527 5:151110487-151110509 CTCCCCTTCCGGGCCCTGCTTGG - Intronic
999531738 5:152470584-152470606 ATCTCCCTCTGACCCCAGGTAGG - Intergenic
1000045096 5:157515895-157515917 CTCGCTCCCTGGGCCTAGGTGGG - Intronic
1001717649 5:173829758-173829780 CAGCCCCTCAGGGCCCAGGTAGG + Intergenic
1002074207 5:176698434-176698456 CTCGGGCTCTGGCCCCAGGTGGG - Intergenic
1002321846 5:178381069-178381091 CAGACCCTCTAGGCCCAGGTAGG - Intronic
1002634130 5:180598765-180598787 GTCCCCCACTGGGCCCAGGAAGG + Intergenic
1005151033 6:22751034-22751056 CTCTCCCTCTGGGACAATGTGGG - Intergenic
1005978707 6:30819631-30819653 CACCCCCGCTGGGTCCAGTTTGG - Intergenic
1006078313 6:31548422-31548444 CTCACCATCTGGGCCCTGGCGGG - Exonic
1006400597 6:33814954-33814976 CTCTCCCTCTGCCCCCAGATGGG - Intergenic
1006765443 6:36500986-36501008 CTCCCTTTGTGGGCCCAGGCTGG + Intronic
1007255466 6:40525154-40525176 GTCCCCCTCTGGGGCCATGCTGG + Intronic
1007596409 6:43053706-43053728 CCCCCTCGCGGGGCCCAGGTGGG - Exonic
1007777595 6:44232474-44232496 TTCCCTCTCTGGGTCCAGGCTGG - Intronic
1009417802 6:63434771-63434793 CTTCCCCTCTGGTTTCAGGTTGG - Intergenic
1010056967 6:71577989-71578011 TTCCCCTTCTGGCCCCAGATAGG - Intergenic
1011651297 6:89508930-89508952 CTTCCCTCCTTGGCCCAGGTGGG - Intronic
1011662546 6:89606824-89606846 CTCTCACTCTGTGCCCAGGCTGG - Intronic
1012750288 6:103152805-103152827 CCCCACCTCTGGACCTAGGTGGG - Intergenic
1012955749 6:105567979-105568001 CTCCTCCTCCTGGCCCAGGGGGG - Intergenic
1013665477 6:112343019-112343041 GTCCCCCTCTGGCCCCTGCTTGG + Intergenic
1014097763 6:117479140-117479162 CTCCCGCTCTTCGCCCAGGCTGG + Intronic
1015320338 6:131865964-131865986 GTCCCGCTCTGTGCCCAGGCTGG - Intronic
1017739992 6:157398096-157398118 CTCCCCAGATGGCCCCAGGTAGG + Intronic
1017882638 6:158572479-158572501 CTCCTCCTCAGGGCACAGGGCGG + Intronic
1019195763 6:170281787-170281809 CGCCCCGTCTGGGGCCATGTTGG + Intergenic
1019500549 7:1362411-1362433 CCCCCACACTGGGCCCAGGCTGG + Intergenic
1020268312 7:6576704-6576726 CGCCCCCACCAGGCCCAGGTCGG + Intergenic
1020308859 7:6854726-6854748 CTCGCCCTCTGGACCCATGGGGG + Intergenic
1021994910 7:26170002-26170024 CTTCCCCTGTGGCCTCAGGTGGG + Intronic
1022020872 7:26398538-26398560 CTCCCCCTCCCGGCCCGGCTCGG + Intergenic
1022988590 7:35685205-35685227 CTCTCCCTCTGTTGCCAGGTTGG - Intronic
1024193797 7:47039041-47039063 CACCCACTCTGTGCTCAGGTAGG - Intergenic
1024716685 7:52087633-52087655 GTCCCACTCTGTGCCCAGGCTGG + Intergenic
1026020318 7:66700475-66700497 CTCCCCCTCCGGGGCCCGCTTGG - Intronic
1026480712 7:70776893-70776915 CTCCCCCTCTCTCCCCACGTGGG - Intronic
1028941347 7:96525665-96525687 CTCCACCCCTGGCCCCAGGCTGG + Intronic
1029023926 7:97394419-97394441 CTCGCTCTGTTGGCCCAGGTTGG + Intergenic
1029262858 7:99315190-99315212 GTCTCCCTCTGTGCCCAGGCTGG + Intergenic
1029501490 7:100933572-100933594 CTAACCCACTGTGCCCAGGTGGG - Intergenic
1029663046 7:101976101-101976123 GTCTCTCTCTGTGCCCAGGTTGG - Intronic
1030273678 7:107696795-107696817 GTTCCCCTCTAGGCCCAGGAGGG - Intronic
1030560682 7:111081491-111081513 CACTCCCTCTGTGCACAGGTTGG - Intronic
1031386673 7:121160451-121160473 TTCCCCCTCTGGGAGCAGGTTGG - Intronic
1033477006 7:141701687-141701709 CTCTCCCTCGGGGCGCAGCTGGG - Intronic
1033489213 7:141825030-141825052 CTCCCCCTCTGGCCCAGGGCAGG + Intergenic
1034486722 7:151369909-151369931 CTCCCTCTCTGGCATCAGGTAGG - Intronic
1035396127 7:158536217-158536239 CTCCTCCTCTGGGTCCAGACAGG + Intronic
1036652554 8:10654597-10654619 CTCACCCTCCAGGTCCAGGTGGG + Intronic
1038264320 8:26025976-26025998 GTCTCACTCTGGGCCCAGTTTGG - Intronic
1039882972 8:41637831-41637853 GTCTCACTCTGTGCCCAGGTTGG - Intergenic
1039947149 8:42140072-42140094 CTGCGCGTCTGGGCCCAGGCGGG + Intergenic
1040706285 8:50132646-50132668 CTCACTCTCTTGGCCCAAGTAGG + Intronic
1040871127 8:52100996-52101018 CTTCCCCTCTGCGCCCTGGCAGG - Intergenic
1045510845 8:102810823-102810845 CCCGCCCGCTGCGCCCAGGTCGG + Intergenic
1048015446 8:130492429-130492451 CCTCCCCTCTGTGCCCAGGATGG + Intergenic
1049385458 8:142340871-142340893 CTTCCCCTCTGGGCCCAGGGAGG - Intronic
1049386827 8:142347097-142347119 CTCCAGCTCTGGGCCCTGGTGGG + Intronic
1049416799 8:142499069-142499091 CTCCCCCACTTGGCACAGCTGGG - Intronic
1049496415 8:142936370-142936392 CTGCACCACAGGGCCCAGGTGGG + Intergenic
1049757312 8:144316427-144316449 ATCCTCCTCTGGTCCCAGGGAGG - Exonic
1049773972 8:144396284-144396306 CTCCCCCTCAGCCCCCAGCTGGG + Intronic
1049806866 8:144545045-144545067 CTTCACCTCAGTGCCCAGGTGGG + Intronic
1049841826 8:144777940-144777962 CTCACCCCCTGGGCACAGATAGG - Intronic
1054938335 9:70712993-70713015 CTCTCCCACTGGAACCAGGTTGG + Intronic
1054940026 9:70730986-70731008 CTCTCCCACTGGAACCAGGTTGG + Intronic
1056380379 9:86052454-86052476 CTCCTTCTCTAGGCCCAGGTGGG - Intronic
1056622397 9:88225211-88225233 GTCCCTCCCTGGGCCCTGGTGGG - Intergenic
1056779341 9:89537880-89537902 CTGCCAGTTTGGGCCCAGGTTGG + Intergenic
1057206281 9:93174873-93174895 GTCTCGCTCTGTGCCCAGGTTGG - Intergenic
1057877798 9:98771176-98771198 CTCCCCAGCTGGGCCCTGGCAGG - Intronic
1057920988 9:99096785-99096807 CTCCCCCACTGGGCGCAATTTGG + Intergenic
1058022272 9:100102121-100102143 GTCTCCCTCTGTGCCCAGGCTGG + Intronic
1060770353 9:126327343-126327365 TTCCCAGTCTGTGCCCAGGTGGG - Intronic
1060996500 9:127877280-127877302 CTCCCTCTCTGGGCCCAAGCTGG + Intronic
1061032312 9:128092687-128092709 CTCACGCTCTGGGCTCAGGAAGG - Intronic
1061421991 9:130477659-130477681 CCCTCCCTCTGAGCCCAGGCGGG - Intronic
1061591921 9:131603276-131603298 CTCCCCCCATGAGCCCAGGTGGG - Intronic
1061926457 9:133808309-133808331 CTGCCCCCTTGGGCCCAGGCTGG - Intronic
1061956132 9:133962152-133962174 ATCCCCCTCTGTGCCCAGGAGGG - Intronic
1062172827 9:135144912-135144934 GCCCGCCTCTGGGCCCTGGTTGG - Intergenic
1062282066 9:135756627-135756649 CGCCCACTCTAGGCCCAGGGTGG - Intronic
1062341182 9:136094667-136094689 CTCGCCCTCCCGGTCCAGGTGGG - Intronic
1062398113 9:136360683-136360705 CAGCACCTCTGGGCCCAGGCTGG - Intronic
1186826275 X:13343208-13343230 CTCTCCCTCTGGATCCAGGAAGG - Intergenic
1189333732 X:40157717-40157739 ATCTCCCGCTGGGCTCAGGTTGG - Intronic
1189413303 X:40792536-40792558 CTCTCTCTATAGGCCCAGGTTGG - Intergenic
1192433746 X:71129598-71129620 CTACCTCTGTGGGCCCAGGGTGG + Intronic
1192546844 X:72021453-72021475 CTTCTCCTCAGGGCCCAGGTAGG + Intergenic
1192863658 X:75107310-75107332 CACCATCTCTGGGCCCAGTTCGG - Intronic
1193330328 X:80229186-80229208 CTCCCTCTCTAGGCCCAGATTGG + Intergenic
1197391881 X:125877789-125877811 GTCCCCCTCTGGCCCAAGGAAGG + Intergenic
1200828288 Y:7665630-7665652 CTTGCCCACTGGGTCCAGGTGGG + Intergenic
1200885009 Y:8258954-8258976 CTTGCCCACTGGGTCCAGGTAGG + Intergenic
1200953500 Y:8923090-8923112 CTTGCCCACTGGGTCCAGGTAGG - Intergenic
1201058250 Y:10017361-10017383 CTTGCCCACTGGGTCCAGGTAGG + Intergenic
1202231594 Y:22664444-22664466 CTTGCCCACTGGGTCCAGGTAGG - Intergenic
1202311564 Y:23531721-23531743 CTTGCCCACTGGGTCCAGGTAGG + Intergenic
1202559238 Y:26138873-26138895 CTTGCCCACTGGGTCCAGGTAGG - Intergenic