ID: 1156480347

View in Genome Browser
Species Human (GRCh38)
Location 18:37432336-37432358
Sequence CTCCCCCTCTGGGCCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156480347_1156480357 -6 Left 1156480347 18:37432336-37432358 CCCACCTGGGCCCAGAGGGGGAG No data
Right 1156480357 18:37432353-37432375 GGGGAGCTTGGAGGTGGGATGGG No data
1156480347_1156480356 -7 Left 1156480347 18:37432336-37432358 CCCACCTGGGCCCAGAGGGGGAG No data
Right 1156480356 18:37432352-37432374 GGGGGAGCTTGGAGGTGGGATGG No data
1156480347_1156480358 1 Left 1156480347 18:37432336-37432358 CCCACCTGGGCCCAGAGGGGGAG No data
Right 1156480358 18:37432360-37432382 TTGGAGGTGGGATGGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156480347 Original CRISPR CTCCCCCTCTGGGCCCAGGT GGG (reversed) Intronic