ID: 1156480643

View in Genome Browser
Species Human (GRCh38)
Location 18:37434444-37434466
Sequence GAAGCGCTTTTGCCCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156480643_1156480647 1 Left 1156480643 18:37434444-37434466 CCTTCATGGGGCAAAAGCGCTTC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1156480647 18:37434468-37434490 GTGGCCCCTGTCTAAAACAGGGG 0: 1
1: 0
2: 0
3: 9
4: 106
1156480643_1156480648 2 Left 1156480643 18:37434444-37434466 CCTTCATGGGGCAAAAGCGCTTC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1156480643_1156480646 0 Left 1156480643 18:37434444-37434466 CCTTCATGGGGCAAAAGCGCTTC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1156480646 18:37434467-37434489 AGTGGCCCCTGTCTAAAACAGGG 0: 1
1: 0
2: 0
3: 7
4: 69
1156480643_1156480645 -1 Left 1156480643 18:37434444-37434466 CCTTCATGGGGCAAAAGCGCTTC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1156480645 18:37434466-37434488 CAGTGGCCCCTGTCTAAAACAGG 0: 1
1: 0
2: 0
3: 4
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156480643 Original CRISPR GAAGCGCTTTTGCCCCATGA AGG (reversed) Intronic
902856560 1:19210356-19210378 GTCGCGTTTTTGACCCATGACGG - Intergenic
905270999 1:36787392-36787414 GCTGCGGGTTTGCCCCATGAAGG + Intergenic
912531188 1:110323905-110323927 GAAGAGCATTTGCCCCAGGATGG + Intergenic
917160052 1:172047156-172047178 GAAGCCCTCTTTGCCCATGAAGG + Intronic
918902129 1:190435997-190436019 GAATCATTTTTTCCCCATGATGG + Intronic
921925364 1:220706498-220706520 GAATCGCTTCTGCCCCATCTCGG + Intergenic
923362108 1:233221912-233221934 GGAGCACTTTTGCTGCATGAAGG - Intronic
1067551250 10:47237975-47237997 GAAGCACTTTAACCCCATCAGGG + Intergenic
1073882761 10:108002593-108002615 GAAGCTCTTTTCCCCTATGCTGG + Intergenic
1074276376 10:112006239-112006261 GAAATGCATTTGCCCCATGGTGG + Intergenic
1076343772 10:129766869-129766891 GAATGGCTTCTGGCCCATGAAGG + Exonic
1087213130 11:95463345-95463367 CAAGAGCTTTTACCCCATTAAGG - Intergenic
1091727301 12:2855069-2855091 GAAGCTGTTTTGCCCCATCCAGG + Intronic
1094542071 12:31370965-31370987 GTAGCGCCCTTCCCCCATGAGGG + Intergenic
1095062882 12:37722728-37722750 GGAGCCCTTTTGACCGATGATGG + Intergenic
1096665142 12:53159551-53159573 GATGCGCTTCTGCCCCCTGTTGG - Intronic
1100527567 12:95433814-95433836 GAGGCGATTTTGCCCCACAAGGG - Intergenic
1105478941 13:20755426-20755448 AGAGCCCTTTTGGCCCATGAAGG - Intronic
1113681349 13:112247294-112247316 GAAGGAATTCTGCCCCATGATGG - Intergenic
1121815588 14:96925683-96925705 GAAGAGCCTTTCCCCCATGGTGG - Intronic
1135592146 16:23712483-23712505 TGATCGCTTTTGCCCCATGGGGG + Intronic
1136620044 16:31422619-31422641 CAAACGCCTTTGCCCCATGTAGG + Intronic
1138083422 16:54113348-54113370 GAAGAGCTTTTGCCTATTGAAGG + Exonic
1139237563 16:65355927-65355949 GAAGCACTTCTGCCCAATGGAGG + Intergenic
1147608095 17:41785573-41785595 GAAGGGGTTTTGCACCAGGAAGG + Intronic
1156227860 18:35126998-35127020 GAAGCCCTTTTGGCTGATGAGGG - Exonic
1156480643 18:37434444-37434466 GAAGCGCTTTTGCCCCATGAAGG - Intronic
1158135563 18:54204045-54204067 GAAGGGCTTTGGACCCAGGAAGG - Intronic
1159112102 18:64071304-64071326 TAGCTGCTTTTGCCCCATGATGG + Intergenic
1164065191 19:21708942-21708964 GAAACGGTGTTGCCCCATGTTGG + Intergenic
1165428961 19:35761091-35761113 AAAGCCATTTTGCACCATGAAGG - Intronic
1167965512 19:53142346-53142368 GGAGTGCTTTTGACCCAAGAAGG - Exonic
931811115 2:65856077-65856099 CTAGCTTTTTTGCCCCATGAAGG - Intergenic
932326361 2:70864619-70864641 GGAGCGCTTTTGGCCCAGGCAGG - Intergenic
934079776 2:88458086-88458108 GCAGCCCTTTCCCCCCATGAAGG + Intergenic
937202158 2:120210540-120210562 GCAACGCCTTTTCCCCATGATGG - Intergenic
940480809 2:154228433-154228455 GAAGCCCTGTTTCTCCATGAGGG + Intronic
941463449 2:165797769-165797791 GAAACAGTTTTGCCTCATGAGGG + Intergenic
942460361 2:176163989-176164011 GAAGGGCTTTTCCCACTTGAAGG - Intronic
946991476 2:225335151-225335173 GAAGCTCTTTTGCCCAATGTAGG + Intergenic
948268715 2:236657425-236657447 GGAGAGCCTTTGCCCCGTGAGGG - Intergenic
948307933 2:236963643-236963665 CAAGGGCCTTTGCCCCACGAGGG + Intergenic
1171821324 20:29844793-29844815 GAAGCCCTTTGGCCCCATGGTGG + Intergenic
1180325180 22:11366518-11366540 GAAGCCCTTTGGCCCTATGGTGG + Intergenic
1185348189 22:50319727-50319749 GAAGCACCCCTGCCCCATGATGG + Intronic
950065356 3:10107765-10107787 GAAGCGCTCTCGTCCCATGTTGG - Intronic
953915830 3:46920669-46920691 GAAGGGTTTCTGCCCCATGTGGG + Intergenic
955512012 3:59690918-59690940 GTGGATCTTTTGCCCCATGAAGG + Intergenic
958069898 3:88596842-88596864 GAAGGGCCTTTGTCCCATTAAGG - Intergenic
966614772 3:181901866-181901888 GAAGCCCTGTTGCCCCAAAAGGG + Intergenic
970366302 4:15361973-15361995 GATGCTCTTTTGCCCCTCGAGGG - Intronic
972407183 4:38757963-38757985 GATGCCATTTTGTCCCATGAGGG + Intergenic
981219710 4:142217277-142217299 AAAGCACATTTGCCCCATGTTGG - Intronic
988321504 5:29703881-29703903 AAAGCAATTTTGCCCCAGGATGG - Intergenic
988931568 5:36040337-36040359 GAAGTGATTTTGCCCCCCGAAGG + Intronic
989672645 5:43936487-43936509 CAAGAGCTTTTGGACCATGAGGG + Intergenic
991507498 5:67340516-67340538 GCAGTGCTTTTGCCCCATAGGGG - Intergenic
996608014 5:125346607-125346629 GAAGCTCTTGTGCTCCATGAAGG + Intergenic
999319364 5:150603842-150603864 GAATCGCTTTAGCCTCATCAAGG - Intronic
1001250810 5:170145490-170145512 GATGTGATTTTGCCCCATGGTGG + Intergenic
1009330166 6:62409344-62409366 GATGGGGTTTTGCCCCATGTTGG - Intergenic
1010443098 6:75920578-75920600 GAAGTGGTAGTGCCCCATGAGGG - Intergenic
1011414725 6:87106375-87106397 GAAGTGCCATTGCCCCATCAAGG + Intergenic
1013601698 6:111711493-111711515 GAAGCACCTTTGCCCCTTGCTGG + Intronic
1015058165 6:128929590-128929612 GAAGCGCTTTTGCGGCATCTGGG - Intronic
1015768759 6:136747344-136747366 GAAGCCCTGCTGCCCTATGAAGG - Intronic
1019078705 6:169412508-169412530 GAAGCCCTCTTGCCCCAGGTGGG - Intergenic
1023993830 7:45146588-45146610 AAAGCCCTTTTGCCCCATGTTGG - Intergenic
1024204745 7:47147933-47147955 AAAGTGCTTTTCTCCCATGATGG - Intergenic
1024280551 7:47715666-47715688 GTAGCCATTTTGACCCATGAAGG + Intronic
1024716884 7:52088740-52088762 GAGGCGCTTTGGCACCATCACGG - Intergenic
1031159024 7:118143751-118143773 GAAGAGATTTTTTCCCATGATGG - Intergenic
1031562303 7:123253319-123253341 GAAGCTCTAGTGCACCATGAAGG - Intergenic
1032080692 7:128857063-128857085 GAAGGGCTTGTGGCCCAAGAGGG - Intronic
1032091559 7:128914096-128914118 GAAGGGCTTGTGGCCCAAGATGG + Intergenic
1032280682 7:130498181-130498203 GAAGCGCTTTTGCGGCATCTGGG + Exonic
1047463379 8:125090004-125090026 TAATCTGTTTTGCCCCATGAAGG + Intronic
1049005154 8:139850404-139850426 CAAGAGCTCCTGCCCCATGAGGG - Intronic
1050134877 9:2452120-2452142 GATGCTCCTGTGCCCCATGAAGG + Intergenic
1061912326 9:133731728-133731750 GAAGCGACTTTGCCCCAGGTTGG - Intronic
1203373037 Un_KI270442v1:330652-330674 GAAGCCCTTTGGCCCTATGGTGG + Intergenic
1196703597 X:118697559-118697581 GAAGATCTGTTCCCCCATGAAGG + Intergenic
1197809676 X:130430038-130430060 GAAGAGATTTGGCCCCAGGAAGG + Intergenic
1198061732 X:133052779-133052801 GATGCCCTGTTGTCCCATGATGG - Intronic