ID: 1156480648

View in Genome Browser
Species Human (GRCh38)
Location 18:37434469-37434491
Sequence TGGCCCCTGTCTAAAACAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156480643_1156480648 2 Left 1156480643 18:37434444-37434466 CCTTCATGGGGCAAAAGCGCTTC 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1156480642_1156480648 9 Left 1156480642 18:37434437-37434459 CCAGTCACCTTCATGGGGCAAAA 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156480648 Original CRISPR TGGCCCCTGTCTAAAACAGG GGG Intronic
900952604 1:5866262-5866284 TGGCCCCTTCCTAAAATTGGGGG - Intronic
906326167 1:44847448-44847470 TGGCCCCTAAATATAACAGGTGG - Intergenic
907612435 1:55885990-55886012 TGGCCCCTTTCTGACTCAGGTGG - Intergenic
907880823 1:58547886-58547908 TGGCCCCTTTGGAAATCAGGTGG - Intergenic
913340697 1:117755039-117755061 CTGCTCCTTTCTAAAACAGGTGG + Intergenic
916177028 1:162050616-162050638 TGGGTCCTTTTTAAAACAGGTGG - Intergenic
919403331 1:197146842-197146864 TGGCCACCGTCTAAAACCCGGGG + Intergenic
920873175 1:209810894-209810916 TGGACGCTCTCTGAAACAGGTGG + Intergenic
921859692 1:220029100-220029122 TGGCCACTGCCAAAAAAAGGTGG + Intronic
924572413 1:245249063-245249085 TGGCAGCTGTCTATAACAGGTGG + Intronic
1062902057 10:1153945-1153967 TGGCCCTTGTCTGAGTCAGGCGG - Intergenic
1064825141 10:19390013-19390035 TGGCACCTTTGAAAAACAGGGGG - Intronic
1066290927 10:34013810-34013832 TTTCCCCATTCTAAAACAGGGGG + Intergenic
1074358345 10:112805230-112805252 TAGCCCGTGGCTAAAACAGGAGG - Intronic
1075086149 10:119415688-119415710 TGGCCCCAGTCAAAACCAGCTGG - Intronic
1076823427 10:132953769-132953791 TGGCCCCTGGCTAAAAGGAGGGG + Intergenic
1083294207 11:61706544-61706566 CAGGCTCTGTCTAAAACAGGCGG + Intronic
1083552765 11:63602730-63602752 TGGCTCCTCTCTACAACAGCAGG + Intronic
1087450318 11:98312928-98312950 AAGCCCCTGTTTAATACAGGTGG + Intergenic
1091560911 12:1612502-1612524 TGGCCGCTGGCTAAAGCATGCGG + Intronic
1092681138 12:10982345-10982367 TGGCCTCTGTCAAAACCAGATGG + Intronic
1098343410 12:69474450-69474472 TGGCATCTGTTTAAAACAGAAGG + Intronic
1102647348 12:114412393-114412415 TCTCCCCTGTTTAAAAAAGGGGG - Intergenic
1104681921 12:130758000-130758022 GGACCCCTGGCTGAAACAGGAGG - Intergenic
1110592960 13:77285985-77286007 GGGTCCCACTCTAAAACAGGAGG + Intronic
1110658763 13:78033084-78033106 TGGGCCCTGTCTAATACATTGGG + Intergenic
1112941225 13:104864377-104864399 TGGTCACTGTCTAAACCAGGTGG + Intergenic
1115451707 14:33555419-33555441 TGGCGCCTGTTGAAAACAGTGGG + Intronic
1115642948 14:35346989-35347011 TCGACCCTGTCTAACAGAGGAGG - Intergenic
1117830303 14:59743553-59743575 TTGCCCCTGCCTAAAACATGAGG - Intronic
1124666034 15:31593624-31593646 TGGCTCATGTATACAACAGGAGG + Intronic
1127254983 15:57282432-57282454 AGGTTCCTCTCTAAAACAGGGGG - Exonic
1127329823 15:57927780-57927802 TGGCCCCTGTCCAAGGCAGCAGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1127683047 15:61316110-61316132 TGGCCCATGTGTAACCCAGGGGG + Intergenic
1129294839 15:74594506-74594528 TGGGCCCTTGGTAAAACAGGTGG - Intronic
1130211720 15:81929799-81929821 TGACCCCTGTTAAAAACATGTGG - Intergenic
1132200973 15:99954507-99954529 TGGCCCCTGGCTGAAGCAAGGGG + Intergenic
1136142380 16:28295804-28295826 AGGGCCCTGTCTAAAGAAGGTGG - Intronic
1138577069 16:57914843-57914865 TGGTCTCTGTCTAAAAGATGGGG - Intronic
1138652167 16:58466823-58466845 TGGCCCCTGTCTCTAAGAGATGG + Intronic
1139373804 16:66484493-66484515 TGGCCCCTGGCACAGACAGGCGG - Intronic
1139665659 16:68453762-68453784 TGGCTGCTGTGGAAAACAGGAGG + Intergenic
1145968360 17:28937899-28937921 TGTCCCTTTTCCAAAACAGGTGG - Intronic
1147431114 17:40371393-40371415 TGGCCCTTTTCTGAGACAGGGGG - Intergenic
1147437144 17:40423516-40423538 TGGCCCCTGTCAAAGAAATGTGG + Intergenic
1148704861 17:49620817-49620839 TTGCACCTCTCTCAAACAGGTGG + Intronic
1153637817 18:7128296-7128318 TGGCACCTGTCTTCCACAGGTGG + Intergenic
1154271522 18:12924826-12924848 TGGCCCGTCTTTAGAACAGGAGG - Intronic
1155438151 18:25834197-25834219 TGGTGCCTGGCTAAAGCAGGCGG + Intergenic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1160002936 18:75044623-75044645 TGGCCCGTGTCAAAAACTTGCGG + Intronic
1160167945 18:76530367-76530389 TGGCCCCTGTCTTACAGATGAGG + Intergenic
1161484247 19:4526110-4526132 TGGGCCCTGTTTTACACAGGAGG + Intronic
1162340249 19:10087381-10087403 TGACCCCCCTCTGAAACAGGAGG + Intronic
1163434955 19:17289899-17289921 TGGCCCCTGTTTTACACTGGAGG - Intergenic
926004963 2:9366370-9366392 TGGCCCCTGGCTCATAGAGGGGG + Intronic
929766088 2:44845043-44845065 TGGCCCCTCTCTAACACATGGGG - Intergenic
932390055 2:71380692-71380714 TGGCCCCTGTATTAAGCAGGCGG + Intronic
936006279 2:108891975-108891997 TGTGCCCTGTCTGAAAGAGGGGG + Intergenic
937692679 2:124773495-124773517 TGATCCCTTTCTAAATCAGGGGG + Intronic
943529930 2:189066492-189066514 TGGCCCCTGTTAAAAACAGAAGG + Exonic
943723970 2:191233641-191233663 TGGGCCCTGACCAAAATAGGGGG + Intergenic
944939811 2:204611337-204611359 TGACCCCTGTCTAAGAAAGTGGG + Intronic
946255285 2:218437406-218437428 TAGCCCCTTTCTAAATCAGCAGG - Intronic
948135750 2:235634969-235634991 TGGCCACTGTCTACAGCGGGGGG - Intronic
948887794 2:240892734-240892756 TGGCCCCTGTCCCCCACAGGAGG + Intronic
1170210859 20:13845207-13845229 TGACCTCTGTTTAACACAGGAGG - Intergenic
1170667129 20:18395875-18395897 TGGGCCCTGTCTAACTCATGGGG - Intronic
1172055210 20:32150035-32150057 TGGCCTCTGACTACAAAAGGAGG - Intronic
1174510084 20:51044760-51044782 AAGACCCTGTCTAAAACAGGAGG - Intergenic
1175576614 20:60065295-60065317 TGGTCCCGGTCTAAAGCAGCTGG + Intronic
1175581417 20:60102617-60102639 TGGCCCCTGACAAGCACAGGTGG + Intergenic
1179580108 21:42338222-42338244 TGGGCCCTGTGGAAAACTGGCGG + Intergenic
1182034785 22:27189336-27189358 TTGCCCCTGACTGAATCAGGTGG - Intergenic
949987156 3:9550441-9550463 TTTCCTCTCTCTAAAACAGGGGG + Intronic
959017050 3:101146652-101146674 TGTCCCCTGTCTAAATGAGAAGG - Intergenic
964418303 3:156473077-156473099 ATGCCCCTTTCCAAAACAGGGGG + Intronic
967832144 3:193928766-193928788 AGACCCCTGACTAATACAGGTGG + Intergenic
972314804 4:37916432-37916454 TGTCCCCTGTATGAAGCAGGGGG + Intronic
974552429 4:63395907-63395929 TGGGCCCTGTCTCAAACAGAGGG + Intergenic
978039946 4:104047863-104047885 TGGACCCTGACCAAAACAAGAGG + Intergenic
980852200 4:138396375-138396397 TGGCTCCTGTCTTAATCAGTTGG - Intergenic
981570005 4:146141958-146141980 GGGACCCTGACTAATACAGGTGG - Intergenic
982716002 4:158808901-158808923 TGGCCACAGTGTAAAACAGACGG + Intronic
990645913 5:57844429-57844451 TGGACCCTGACTGACACAGGAGG - Intergenic
991987268 5:72301932-72301954 TGGCCCCTCACTGAAACATGAGG - Intronic
997645244 5:135477562-135477584 TGGCCCGTGTGTAAAAGTGGCGG - Intergenic
1001744779 5:174083924-174083946 TGGCCCCTATCTAACGCATGTGG - Intronic
1006919973 6:37621106-37621128 TGGGCTTTGTCTAAAACATGTGG + Intergenic
1007493870 6:42245427-42245449 TGGCCCCTGGCTGAGACAGATGG - Intronic
1015160445 6:130147128-130147150 ATGCCACTGTCAAAAACAGGAGG - Intronic
1016797571 6:148134093-148134115 TGAACCCTGTCTAAAGCATGTGG - Intergenic
1018332606 6:162747516-162747538 AGACCCCTGACTAATACAGGAGG + Intronic
1018545269 6:164928853-164928875 TATTCCCTGTGTAAAACAGGAGG + Intergenic
1019041117 6:169107123-169107145 TTGCCCCTGACTTAGACAGGAGG - Intergenic
1022634641 7:32120109-32120131 TGGCCGCCGTCTAACACAGCTGG - Intronic
1031433050 7:121696754-121696776 TGGTCTGTGTCTTAAACAGGAGG + Intergenic
1036156332 8:6345877-6345899 TGACCCCTGTATTAAACAGCAGG + Intergenic
1036505172 8:9348280-9348302 TGACCCCTGGATAAAACAAGTGG - Intergenic
1036517470 8:9458158-9458180 TGGCCCCCTACTACAACAGGTGG - Intergenic
1044760275 8:95510409-95510431 TGGCCTCAGCCTAAAGCAGGGGG - Intergenic
1045960434 8:107961684-107961706 ATGCCCCTGTTTAATACAGGAGG - Intronic
1050465701 9:5920942-5920964 TTTCCACTGACTAAAACAGGAGG + Exonic
1053221189 9:36314623-36314645 TGGCCCCTGGCTACCACAGGAGG + Intergenic
1053410294 9:37911863-37911885 TGGACCTTGCCTAAAACATGAGG - Intronic
1053427369 9:38019329-38019351 TGGGCCCTGTGGAAAACAAGGGG - Intronic
1057176222 9:93002278-93002300 TGCCCAATGTCAAAAACAGGAGG + Intronic
1062088122 9:134659003-134659025 TGGCCTCTGTGTAAGGCAGGAGG + Intronic
1186591354 X:10933243-10933265 TGGGCCCTGACTAAAATGGGTGG - Intergenic
1192940832 X:75910031-75910053 TGAACCCTGACTAATACAGGGGG + Intergenic
1193386875 X:80883232-80883254 TGGCCCCTGTGAAAGTCAGGGGG - Intergenic
1193800145 X:85925233-85925255 TGGCCCTTGTACAAACCAGGTGG - Intronic