ID: 1156481039

View in Genome Browser
Species Human (GRCh38)
Location 18:37436583-37436605
Sequence AGGTGGCCCCAGCACTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156481030_1156481039 20 Left 1156481030 18:37436540-37436562 CCCTCTGGGGGAGTTTCTGTTAT 0: 1
1: 0
2: 1
3: 21
4: 196
Right 1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG 0: 1
1: 0
2: 3
3: 30
4: 314
1156481029_1156481039 26 Left 1156481029 18:37436534-37436556 CCTCTGCCCTCTGGGGGAGTTTC 0: 1
1: 0
2: 1
3: 19
4: 239
Right 1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG 0: 1
1: 0
2: 3
3: 30
4: 314
1156481037_1156481039 -4 Left 1156481037 18:37436564-37436586 CCTGTTTGCTTAGGGGGACAGGT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG 0: 1
1: 0
2: 3
3: 30
4: 314
1156481031_1156481039 19 Left 1156481031 18:37436541-37436563 CCTCTGGGGGAGTTTCTGTTATT 0: 1
1: 0
2: 2
3: 21
4: 253
Right 1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG 0: 1
1: 0
2: 3
3: 30
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156481039 Original CRISPR AGGTGGCCCCAGCACTTCCC TGG Intronic
900099626 1:956119-956141 TGTTGGCCTCAGCACTTTCCTGG + Exonic
900114810 1:1023966-1023988 CGGTGGCCACAGCCCCTCCCGGG - Intronic
900164028 1:1237605-1237627 AGGTGGCCGCAGATCTTCCAGGG + Intergenic
900170520 1:1266101-1266123 ATGTGGCCCCAGGACATCGCTGG - Intronic
900524109 1:3120103-3120125 AGGTGGCCCCTGAGCTTCCGTGG + Intronic
900715414 1:4140792-4140814 AGGAGGCCACAGCACATCTCAGG + Intergenic
901017452 1:6240141-6240163 GTGTGGCCGCAGCTCTTCCCAGG + Intergenic
901692402 1:10982011-10982033 GGGGGTCCCCAGCACTTGCCTGG - Exonic
901958524 1:12806690-12806712 AGGTGGCCACTGCAATGCCCAGG - Intergenic
902586698 1:17443761-17443783 AGGAGGCCTCAGCATCTCCCTGG - Intergenic
903342976 1:22666076-22666098 AGCTGACCTCAGCACCTCCCTGG - Intergenic
904383622 1:30127678-30127700 AGGTCTCCCCAGCCCTCCCCTGG + Intergenic
904565506 1:31425952-31425974 AGGCAGCCCCAGCCCTGCCCAGG - Intronic
904823471 1:33259438-33259460 GGCTGGCCCTAGCCCTTCCCTGG + Intronic
905120939 1:35681404-35681426 ATGTAATCCCAGCACTTCCCAGG + Intergenic
905180173 1:36160800-36160822 AGGTAGCCCCAGCAGAGCCCAGG + Intronic
907421215 1:54348592-54348614 ACTTGGCCCCAGCAAGTCCCCGG - Intronic
907581738 1:55578333-55578355 AGCTTTCCCCAGCACTTCCAAGG - Intergenic
909451094 1:75798347-75798369 AGGTGGGCACAGCAATTCTCTGG - Intronic
910220104 1:84881150-84881172 AGGTGACCCCAGAACTCCACAGG - Intronic
911239463 1:95449368-95449390 GGGTGGCACAAGCACTTCCTTGG + Intergenic
912520978 1:110244495-110244517 AGGTGGCCTGGGCACCTCCCAGG - Intronic
912655355 1:111481782-111481804 AGGTGGCCACAGCACCACCAGGG + Intergenic
913488848 1:119359298-119359320 TTAGGGCCCCAGCACTTCCCAGG - Intergenic
915163661 1:153936297-153936319 AGGTAGCCCCAGGACCTGCCAGG - Intronic
915302461 1:154959373-154959395 AGGTGGGCCCAGCTCTGCTCTGG + Exonic
918047115 1:180948184-180948206 CGGAGGCCCCAGCACTCGCCAGG - Exonic
918448976 1:184641130-184641152 AGGTGGTCCCTGAAGTTCCCAGG + Intergenic
919470190 1:197968928-197968950 AGCTGGCCTCAGGACCTCCCTGG + Intergenic
919739364 1:200972952-200972974 AACTGGCCCCAACAGTTCCCTGG - Intronic
919819178 1:201462156-201462178 TGGTGGCAACAGCCCTTCCCTGG + Intergenic
922057362 1:222054476-222054498 AGGTGTCCTCAGCATTGCCCTGG + Intergenic
1063133034 10:3194921-3194943 AGGGGGCCCCAGCCCAGCCCAGG - Intergenic
1063520245 10:6734702-6734724 AGGTGACCCCTGCCCTCCCCTGG - Intergenic
1065869623 10:29945356-29945378 AGGTGGCCCCAAATCTTCCTGGG + Intergenic
1068989233 10:63133706-63133728 AGGGGGCGCCAGGACTTCCCGGG - Intronic
1071061127 10:81571340-81571362 ACCTGGGCCCAGCACTGCCCTGG + Intergenic
1071342132 10:84658953-84658975 AGATGCCCACAGCTCTTCCCAGG - Intergenic
1075802114 10:125160284-125160306 CGGCGGCCCCAGCCCTCCCCCGG + Intronic
1076138852 10:128064067-128064089 GCCTGGCCCCAGCAGTTCCCAGG + Intronic
1076808008 10:132869024-132869046 GGGTGGCCCGAGCCCCTCCCCGG - Intronic
1077302654 11:1854391-1854413 AGGTGGTCCCTGCACCGCCCCGG - Intronic
1078926856 11:15883008-15883030 AGGTGGCTGCAGCACTGCCCTGG + Intergenic
1079114722 11:17634009-17634031 AGGTGAGCCCAGACCTTCCCAGG - Intronic
1080701484 11:34647992-34648014 AGATGGCCACAGCACCTCCCAGG - Intronic
1082003894 11:47409283-47409305 AGGGAGCCCCAGGCCTTCCCTGG + Intronic
1082215433 11:49561731-49561753 AGGTGGACCTGTCACTTCCCTGG - Intergenic
1082564610 11:54661505-54661527 GGGTGGCACAAGCACTTCCTTGG + Intergenic
1082833095 11:57633935-57633957 ACGTGGCCCCACCCCTTCTCAGG - Intergenic
1082892246 11:58152148-58152170 AGCTGCCACCAGCACCTCCCCGG - Intronic
1083163098 11:60867637-60867659 AGGTGGCTCCAGCCCGACCCTGG + Exonic
1083308496 11:61772762-61772784 AAGTGGCCCAGGCACTTCCTGGG + Intronic
1083328054 11:61883674-61883696 AGGTGGCCCCAGAACTGACATGG - Intronic
1083779080 11:64908963-64908985 ACTTGGCCCCACCTCTTCCCAGG - Intronic
1084104347 11:66971347-66971369 AGCTGCAGCCAGCACTTCCCTGG + Intergenic
1084116205 11:67044498-67044520 AGGAAGCCCCAGCCTTTCCCTGG + Intronic
1084547403 11:69821305-69821327 TGGGGCCCCCAGCAGTTCCCAGG + Intergenic
1085147249 11:74212524-74212546 AGGTGGCGTAAGCACTCCCCTGG - Intronic
1085414037 11:76308490-76308512 AGGGGGCCCAGGCACTGCCCGGG + Intergenic
1085448144 11:76614943-76614965 AGGTGGCACCAGCACAGCTCGGG + Intergenic
1086440257 11:86822724-86822746 AGGTGGCCCCATCCCATTCCTGG - Intronic
1086634138 11:89062747-89062769 AGGTGGACCTGTCACTTCCCTGG + Intronic
1090347862 11:126085224-126085246 TGCTGTCCCCAGCACTGCCCTGG + Intergenic
1091632291 12:2171157-2171179 AGGCTGCCCCTGCCCTTCCCTGG - Intronic
1094359073 12:29610237-29610259 AGCTGGCTCCAGCACATCCCTGG + Intronic
1100360119 12:93870121-93870143 AGGTGGGAGCAGGACTTCCCAGG + Intronic
1100981445 12:100165855-100165877 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1101904563 12:108815007-108815029 ATGTGGCCCCAGCACCTGGCGGG + Intronic
1103699352 12:122840745-122840767 AGGTGGGGACAGCCCTTCCCTGG + Intronic
1104406344 12:128520333-128520355 AGCTGGGCCCAGGACTACCCAGG + Intronic
1105436222 13:20380600-20380622 TGGTGGCCCCAGCCGTTCCTTGG - Intergenic
1109289147 13:60452147-60452169 AGCTGGCTCCAGCACAACCCTGG + Intronic
1112557048 13:100478449-100478471 GGGAGGCCCCACCCCTTCCCTGG + Intronic
1115906482 14:38208613-38208635 AGGAGGGCCCGGAACTTCCCTGG + Intronic
1116495348 14:45553255-45553277 AGGTGATCCAAGCACTTCCTTGG + Intergenic
1121120228 14:91371783-91371805 GCGTGGCCCCAGCCCTGCCCTGG - Intronic
1121309937 14:92930176-92930198 CTGAGGCCCCACCACTTCCCAGG - Intronic
1121757853 14:96418229-96418251 AGGTGGACTCAGCTGTTCCCAGG + Intronic
1121884602 14:97531919-97531941 TGGTGGCCCAAGCACTCCACAGG - Intergenic
1122359342 14:101150320-101150342 AGCTGGCCCCCGCCCCTCCCAGG - Intergenic
1122413213 14:101536431-101536453 TGGATGCCCCAGCACTTGCCTGG - Intergenic
1123473167 15:20569516-20569538 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1123644839 15:22430837-22430859 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1123733468 15:23164527-23164549 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1123751598 15:23361902-23361924 AGGTGACCCCAGCACCCTCCAGG + Intronic
1124283971 15:28385827-28385849 AGGTGACCCCAGCACCCTCCAGG + Intronic
1124298726 15:28525787-28525809 AGGTGACCCCAGCACCCTCCAGG - Intronic
1125724651 15:41862097-41862119 AGCTGGCCCAAGCCTTTCCCAGG - Intronic
1127842988 15:62846567-62846589 AGGAGCCCCCAGCACATCCCAGG - Intergenic
1128498501 15:68211366-68211388 TTGGGGCCCCAGCACCTCCCTGG - Intronic
1128710043 15:69864923-69864945 AGCTGGCCCCAGCACATCACTGG + Intergenic
1129057761 15:72833956-72833978 AGGTTGCCACAGAAGTTCCCAGG - Intergenic
1129516814 15:76162104-76162126 GGGAGGACCCAGCCCTTCCCTGG - Intronic
1129756629 15:78102920-78102942 AGGAGCCGTCAGCACTTCCCAGG - Intronic
1129839613 15:78735569-78735591 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1130259451 15:82344128-82344150 AGGTGACCCCAGCACCCTCCGGG - Intronic
1130269227 15:82435040-82435062 AGGTGACCCCAGCACCCTCCGGG + Intronic
1130281815 15:82525057-82525079 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130473182 15:84241220-84241242 AGGTGACCCCAGCACCCTCCGGG + Intronic
1130480597 15:84355285-84355307 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130484792 15:84392721-84392743 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1130491115 15:84432474-84432496 AGGTGACCCCAGCACCCTCCGGG - Intergenic
1130502699 15:84511274-84511296 AGGTGACCCCAGCACCCTCCGGG - Intergenic
1130595467 15:85245810-85245832 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130960676 15:88656918-88656940 GGGTGGACCCAGCACCTGCCAGG - Intergenic
1131047703 15:89326621-89326643 AAGCGGCCCCAGCACCTTCCTGG - Exonic
1131113241 15:89778155-89778177 CTGTGGCTCCAGCACCTCCCGGG - Exonic
1131188103 15:90292572-90292594 AGGTGACCCCAGCACCCTCCAGG + Intronic
1131282682 15:91033893-91033915 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1132615893 16:840944-840966 AGGTGTCCCCACCCCTGCCCTGG + Intergenic
1132645725 16:998466-998488 ACTTGGGCCCAGCACTGCCCTGG - Intergenic
1133197500 16:4181852-4181874 CTGTGTCCCCAGCATTTCCCAGG - Intergenic
1133407775 16:5539296-5539318 AGCTGGCCCCATCACTCCCTTGG - Intergenic
1133935363 16:10264870-10264892 TGGTGGCCCCAGCACTCCTCGGG - Intergenic
1134038590 16:11050783-11050805 AGGTGATCCCAGCACGTGCCTGG + Intronic
1134257803 16:12626067-12626089 GGGAGTCCCCACCACTTCCCGGG - Intergenic
1135607021 16:23834201-23834223 AAGAGGCCCCACCACCTCCCAGG - Intergenic
1136109819 16:28057705-28057727 ACGTGGTCCCAGCACTCCACTGG - Intronic
1138447674 16:57074751-57074773 AGGTGGCCTCAGTGCTTCCCTGG - Intronic
1141128183 16:81416075-81416097 AGGTAGCCTCAGCCATTCCCTGG + Intergenic
1141151984 16:81570608-81570630 TGGAGGCCCCAGCAGGTCCCTGG + Intronic
1141178994 16:81739562-81739584 AAGGGGTCCCAGCCCTTCCCTGG - Intronic
1141427015 16:83951251-83951273 TGGTGGCCACAGCCCTGCCCTGG - Exonic
1141685719 16:85568759-85568781 AGCTGGCCCCAGCCCAGCCCTGG - Intergenic
1141805728 16:86340320-86340342 ACCTGCCCCCAGCACTGCCCTGG + Intergenic
1141812895 16:86387893-86387915 TGGTGGCCCCAGGCATTCCCTGG + Intergenic
1142009791 16:87708033-87708055 ACGTGGGCACAGCACTTGCCAGG + Exonic
1142261766 16:89045907-89045929 ATGTGTGCCCAGCACTTCCGAGG + Intergenic
1142324142 16:89403175-89403197 AGGTGGACCCCGCACTCCCTAGG + Intronic
1143474697 17:7195965-7195987 TGGTCATCCCAGCACTTCCCCGG - Intronic
1144391175 17:14794936-14794958 AGATGGCCCCAGCATATCTCAGG + Intergenic
1145013255 17:19381779-19381801 AGATGGCCCCAGCGCACCCCTGG + Exonic
1145207438 17:20992077-20992099 AGGTGGCCCCAGAAAGACCCAGG + Intergenic
1150124858 17:62629080-62629102 AGGTGGGCCCAGAATTGCCCCGG - Intronic
1150699873 17:67437403-67437425 TGGTGGCCCCAGGCGTTCCCTGG - Intronic
1151249246 17:72820872-72820894 GGGTCCCCCCAGCACTTCCTGGG + Intronic
1151268260 17:72973298-72973320 CAGTGGCCCCAGCACTGCCGGGG + Intronic
1151756754 17:76079623-76079645 AGGAGACCCCAGCACTATCCAGG - Intronic
1152118992 17:78406634-78406656 AGGTGGCCCCAGCCCGTGGCGGG + Intronic
1152195952 17:78918453-78918475 TGGTGTCCCCAGGACCTCCCAGG - Intronic
1152628977 17:81401286-81401308 GGGTCTCCCCAGCACTTCCCGGG + Intronic
1155345520 18:24853219-24853241 AGGTGGCCTCTGCAGGTCCCTGG - Intergenic
1155523180 18:26689848-26689870 ACGTTGTCCCAGCACTTCACTGG - Intergenic
1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG + Intronic
1158064253 18:53386655-53386677 AGGTCACCCCAGCAGTGCCCAGG + Intronic
1160392847 18:78548040-78548062 CGGGGGCCCCAGCTCTGCCCAGG + Intergenic
1160493198 18:79354934-79354956 AGGTGGGCACAGCCCTTCCCTGG - Intronic
1160720935 19:596668-596690 GGCGGGCCCCAGCACTCCCCGGG - Intronic
1160779433 19:871310-871332 AGGGGCTCCCAGCACGTCCCGGG - Intronic
1160813922 19:1026796-1026818 AGGCGCCCCCGGCACCTCCCGGG + Intronic
1161212390 19:3074191-3074213 AGGTGTTCCCAGCATTTCCCGGG + Intergenic
1161454200 19:4362018-4362040 GGGTGTCCCCAGCACTTCCCAGG - Intronic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163296746 19:16417692-16417714 AGGAGGCACCAGCAGTTCTCGGG + Intronic
1165783410 19:38446794-38446816 AGGTGACCCCAGCCTCTCCCTGG - Intronic
1166531155 19:43544264-43544286 ATGAGGCCCCAGGAGTTCCCAGG + Intronic
1166712280 19:44945094-44945116 TGGAGGCCCCAGCTCTCCCCAGG - Intronic
1166862842 19:45819678-45819700 CTGTGTCCCCAGCACTACCCAGG + Intronic
925190426 2:1877857-1877879 GGGGGACCCCAGCACTTCCCTGG - Intronic
926890879 2:17637880-17637902 AGGTTGACGCAGCACTTTCCCGG + Intronic
926973742 2:18492621-18492643 AGGTGCCTCCAGCAGCTCCCTGG + Intergenic
927206997 2:20617178-20617200 AGGTGGCTCCAGCTCTCCTCTGG - Intronic
927574402 2:24189556-24189578 TGGTGGTCCCAGCACTTAGCTGG + Intronic
927850363 2:26494874-26494896 GGGTGGCCCCAGCCCTCCCCAGG - Intronic
928366256 2:30705745-30705767 GGGTGGTCCCAGCAGTGCCCAGG - Intergenic
928440449 2:31287775-31287797 AGATGGCGCCAGCCCTTCCTTGG - Intergenic
928450256 2:31372098-31372120 AGGTGCCTCCAGGACCTCCCAGG - Intronic
932508094 2:72256156-72256178 TGGTGGCCCCAGGAGCTCCCTGG - Intronic
934653009 2:96103186-96103208 AGGTGGCCCCAGCCCAGGCCTGG + Intergenic
934903725 2:98181229-98181251 GGGAGGCCCCAGCCCCTCCCAGG - Intronic
937033614 2:118762375-118762397 AGGAGGCCCCAGCCATCCCCTGG - Intergenic
938303114 2:130229927-130229949 TGTTGGCCTCAGCACTTTCCTGG - Intergenic
938453557 2:131444302-131444324 TGTTGGCCTCAGCACTTTCCTGG + Intergenic
942956782 2:181782785-181782807 AGGTGGCCCCAGGCCTTCCTAGG - Intergenic
944466876 2:200010809-200010831 AGGTGGCCCCTGCACTTTCACGG + Intergenic
946189090 2:217998129-217998151 ACATTTCCCCAGCACTTCCCAGG + Intronic
946389032 2:219404594-219404616 GAGTGGCCTCAGCTCTTCCCTGG - Intergenic
947015543 2:225615784-225615806 AGAAGGCCCCAGCACTTGCCTGG - Intronic
947015605 2:225616424-225616446 AGAAGCCCCCAGCACTTGCCTGG + Intronic
947461154 2:230306044-230306066 TGGTGGCTCCAGCCCTTGCCAGG - Intronic
947743891 2:232497747-232497769 AGGAGCCCCCAGCCCTGCCCGGG + Intergenic
948260896 2:236603873-236603895 AGATGTCCCCAGCTCTCCCCTGG + Intergenic
948436630 2:237958141-237958163 AGGTGGCCCCAGTAGGACCCCGG + Intergenic
948814334 2:240502253-240502275 AGGTGGCTGCATCACTGCCCTGG - Intronic
948992115 2:241560527-241560549 AGGTGGCCCCTGCCCTTACGTGG + Intronic
1168813948 20:723933-723955 AGGTGGCTGGAGCTCTTCCCTGG + Intergenic
1168956590 20:1838618-1838640 AAGTGGCCCCAGCAGCTCCCAGG + Intergenic
1170494890 20:16915044-16915066 GGGTGGCAGCAGCACCTCCCAGG - Intergenic
1171243344 20:23588663-23588685 AGGTGTTCCCAGCATGTCCCTGG - Intergenic
1172773304 20:37393761-37393783 CGCTGGCCCCACCACCTCCCTGG + Intronic
1173162398 20:40662640-40662662 ATGGGGACCCAGCTCTTCCCAGG - Intergenic
1173189279 20:40863733-40863755 TGGTGGCCCCAGGCCTTCCTTGG - Intergenic
1173461915 20:43249689-43249711 ATGTGGCCCCAGGACCTCCACGG + Intergenic
1175284967 20:57831702-57831724 AGATGGCCCCAGTCCTGCCCAGG + Intergenic
1175723161 20:61299868-61299890 AGAAGCCGCCAGCACTTCCCCGG + Intronic
1175864859 20:62169984-62170006 AGGCGGCCCCAGCACTGCCCAGG - Intronic
1176081631 20:63276280-63276302 AGGTGGCCCCCAAGCTTCCCTGG - Intronic
1176109089 20:63403041-63403063 AGGAGGGCCCAGCACCTCCAGGG + Intergenic
1176360856 21:5995619-5995641 GGGTGGCCCAGGCATTTCCCTGG + Intergenic
1177494655 21:21873179-21873201 GGGTGGCACAAGCACTCCCCTGG + Intergenic
1178374315 21:32054426-32054448 TGGTGGCCCCAGGAGTTCCTTGG + Intergenic
1179430051 21:41315767-41315789 ATGTGTCCCTAGAACTTCCCAGG + Intronic
1179500052 21:41802982-41803004 GGGCAGCCCCAGCACTGCCCTGG + Intronic
1179762662 21:43542931-43542953 GGGTGGCCCAGGCATTTCCCTGG - Intronic
1180103890 21:45604917-45604939 GGGTGGCCCAGGCATTTCCCTGG + Intergenic
1180597502 22:16988298-16988320 AGGAGGCCCCAGCCCTCCTCTGG - Intronic
1180675068 22:17581197-17581219 AGGGGGCCCCATCCCTCCCCCGG - Intronic
1181039395 22:20184733-20184755 AATTGGCCCCAGCGCCTCCCAGG - Intergenic
1183061105 22:35336826-35336848 TGGAGGGCCAAGCACTTCCCTGG - Intronic
1183398812 22:37589023-37589045 AGTTGGCCCCAGCTCTGCCCTGG + Intergenic
1183608951 22:38884357-38884379 AGCTGGGCCCAGCACTTTCTCGG - Intergenic
1183658695 22:39205932-39205954 ACCTGGCCCCAACACATCCCTGG + Intergenic
1184117719 22:42431830-42431852 GGGTAGCCCCACCACTTGCCAGG + Intronic
1184118428 22:42435248-42435270 AGGTGTCCCCTGCAGTCCCCAGG + Intergenic
1184921709 22:47609949-47609971 TTGAGGCCCCAGCACTCCCCTGG + Intergenic
1185175640 22:49325035-49325057 AGGTGTCCTGACCACTTCCCTGG - Intergenic
1185199218 22:49491625-49491647 ATCAGGCCCCAGCACTTCCAAGG - Intronic
1185208098 22:49551727-49551749 GGGTGGCCACAGCCCATCCCTGG - Intronic
1185415979 22:50710475-50710497 CTGTGGCCCCAGCACATTCCTGG - Intergenic
950149824 3:10678368-10678390 AGATGTGCCCGGCACTTCCCAGG + Intronic
950859762 3:16137642-16137664 TGGTGCCCCCAGCACTTTCTAGG - Intergenic
952925359 3:38316007-38316029 AAGTGGCCCAAACACTTTCCAGG - Intronic
953350979 3:42215983-42216005 TGTTGTCCCCAGCACTTCCCAGG + Intronic
954004935 3:47583199-47583221 AGGTGACCTAAGCACTTCTCGGG + Intergenic
959174546 3:102889907-102889929 AGGAAGCCCCTGCACTTTCCTGG - Intergenic
960965812 3:123104061-123104083 AGGTGGCCCCAGCATGCCACTGG + Intronic
962807726 3:138938980-138939002 AGGTGGGCCCAGCTGATCCCCGG - Intergenic
965415248 3:168384806-168384828 AGGTGGCACAAGCACTCCCTTGG + Intergenic
965863053 3:173170224-173170246 AGGTGGGGCCAGCACCTCTCAGG + Intergenic
968228189 3:196989066-196989088 AAATGGCCCCAGCATTTCCCAGG - Intronic
968441167 4:625220-625242 AGGTGGCCCCAGGCCCTCCTGGG - Intergenic
968473362 4:791873-791895 CGGTGGCTCCAGCACGGCCCTGG - Intronic
968579089 4:1381411-1381433 AGGTGGCCACAGCTCTGTCCAGG + Intronic
968580057 4:1385589-1385611 AGGTGGCCCCAGCCCCACCTTGG - Intronic
968712831 4:2132079-2132101 ATGTGGCCTTACCACTTCCCAGG - Intronic
969286523 4:6205783-6205805 CGGTGGCTCCAGGACTTCCTTGG + Intergenic
969466724 4:7361692-7361714 TGGGGTCCCCAGCCCTTCCCCGG - Intronic
970194571 4:13542089-13542111 GGGTGGCCGCAGCACTTCGCCGG + Exonic
973762075 4:54126942-54126964 AGGAGGTCCCAGCTCTTCTCAGG + Intronic
976055912 4:81066727-81066749 AAATGGCCCCAGCACTTTCCAGG - Intergenic
976600828 4:86935773-86935795 AGGTGGCTCCAACTCCTCCCCGG - Intronic
978956804 4:114623851-114623873 ATGTGGGTCCACCACTTCCCTGG + Intronic
980179041 4:129381786-129381808 AGCTGGCCCCAGCACATCATTGG + Intergenic
981739120 4:147984420-147984442 AGGTGGCACCACCACAGCCCTGG - Intronic
982020644 4:151200322-151200344 AGCTGGCTCCAGCACATCACTGG - Intronic
983966973 4:173824360-173824382 AGGTGCCCCCAGCCCGTACCTGG + Intergenic
984818512 4:183859508-183859530 ATCTGGCCCCTGCCCTTCCCAGG - Intronic
986050707 5:4087619-4087641 AGGTGTCTCCAGGGCTTCCCTGG + Intergenic
986456496 5:7926088-7926110 AGCTGGTCCCAGCCTTTCCCAGG + Intergenic
986559612 5:9047316-9047338 AGCTGGCCCCAGCCTTTCCCAGG - Intronic
988561356 5:32284491-32284513 AGATAGGCCCAGCACATCCCAGG + Intronic
989099636 5:37811914-37811936 AGCTGGCCTCAGCACCACCCTGG + Intergenic
990872423 5:60446941-60446963 TGGAGGCCTCAGCACTGCCCTGG + Intronic
991184803 5:63794660-63794682 TGGTGCCCCCAGCCCATCCCTGG + Intergenic
992487329 5:77210025-77210047 AGGTCTCTCCATCACTTCCCGGG + Intergenic
997104543 5:131004175-131004197 AGGTGGTGCAAGCACTTCCTTGG - Intergenic
997259914 5:132457722-132457744 AGGTGGGCCCAGCCCCCCCCAGG - Intronic
997521873 5:134528166-134528188 AGGCGGCCCTACCACCTCCCAGG - Intronic
998484194 5:142487323-142487345 AGATGGCTGCAGCAGTTCCCAGG - Intergenic
999429123 5:151510937-151510959 ATGTGGCTCCTGCACCTCCCAGG - Intronic
1000433460 5:161179641-161179663 AGGTGGCACAAGCACTCCCTTGG - Intergenic
1002024063 5:176384806-176384828 AGCTGGCCCCAGCTCCTCCCTGG - Intronic
1002611719 5:180423792-180423814 TGGTGGCCCCAGGCCTTCCCTGG + Intergenic
1003121777 6:3324050-3324072 AGGTGCACCCAGGACTTCTCGGG - Intronic
1004670401 6:17790737-17790759 AGGTTGCCCCAGCTTTCCCCTGG - Intronic
1006044943 6:31287479-31287501 AGCTAGCCCCAGCACTGCCTTGG + Intronic
1006091765 6:31632554-31632576 CAGTGGCCCCAGCACCTCGCCGG + Exonic
1006640203 6:35485776-35485798 AGGCAGGCCCAGCCCTTCCCAGG - Intronic
1006642298 6:35495718-35495740 AGGTGGCCCCAGCACTGGGGTGG + Intronic
1006986556 6:38179448-38179470 AGGTGGCAGCAGCAGGTCCCAGG + Intronic
1007694018 6:43720161-43720183 TGGTGCCCCCAGAACTTCCCTGG - Intergenic
1007718165 6:43869416-43869438 AGATGGTCCCAACACGTCCCTGG - Intergenic
1008792878 6:55260338-55260360 AAGTGATCTCAGCACTTCCCAGG - Intronic
1011866454 6:91834698-91834720 TGGTGGCCCCAGGCATTCCCTGG - Intergenic
1014430576 6:121365711-121365733 GGGTGGCGCAAGCACTTCCATGG - Intergenic
1014811709 6:125894022-125894044 AGGAGGAGCCAGCACCTCCCAGG - Intronic
1014955402 6:127608855-127608877 TTGTGGGCCCAGCCCTTCCCTGG + Intergenic
1016923278 6:149317253-149317275 AGGGGGTCCCAGCCCTCCCCGGG + Intronic
1017684185 6:156895453-156895475 AGGTGCTCCAATCACTTCCCAGG - Intronic
1018847596 6:167566329-167566351 TGGTGGCTCCAGCAATTCCAGGG - Intergenic
1018877569 6:167838394-167838416 ATGTTGCCCTAGCCCTTCCCTGG + Intronic
1019293452 7:261564-261586 AAGGGGCCACAGCACCTCCCTGG - Intergenic
1019355827 7:578314-578336 CTGCGGCCCCAGCACATCCCGGG + Intronic
1019594339 7:1851448-1851470 AGGCGTCCCCAGCAGTGCCCAGG + Intronic
1022301724 7:29108091-29108113 AGGTTGCCCCAGCACCTCACGGG + Intronic
1022529994 7:31061089-31061111 AGGTGGCAGCAGCACTACCCCGG - Intronic
1022834879 7:34103855-34103877 AGGTGGCCCTTGCACCTCCAGGG - Intronic
1023200105 7:37687792-37687814 AGATGACCCCTGCACTTCCCTGG + Intronic
1023382669 7:39623850-39623872 GGGTGGCCCCAGTCCCTCCCCGG - Intronic
1024326070 7:48110046-48110068 AGGTGGGCCCGCCACTTCCTAGG + Intergenic
1024629894 7:51238362-51238384 AGGAGACCCCTGCCCTTCCCTGG + Intronic
1026740196 7:72974345-72974367 AGGTGACCCCACCACACCCCAGG - Intergenic
1027103537 7:75390725-75390747 AGGTGACCCCACCACACCCCAGG + Intergenic
1027200687 7:76062215-76062237 ACGTGGCTCCAGGACCTCCCAGG + Intronic
1027604816 7:80287640-80287662 GGGTGGCCCAACCACTTCCTTGG - Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1029174857 7:98657554-98657576 TGGTGGCCCCAGGCCATCCCTGG - Intergenic
1029437704 7:100572334-100572356 TGGTAGCCCCAGCAGTTCTCAGG - Exonic
1031964117 7:128015141-128015163 AGATGGCCCCAGCCATACCCAGG + Intronic
1032274861 7:130445445-130445467 AGGTGGCTCCAGAACTGCCTAGG - Intergenic
1032629994 7:133639688-133639710 AGTCAGACCCAGCACTTCCCAGG - Intronic
1033237501 7:139649706-139649728 AGGTGGCCCCAGAAGTTTTCTGG - Intronic
1034256205 7:149725936-149725958 AGATGGCCCCAGCAGGCCCCTGG + Exonic
1034336976 7:150330119-150330141 AGGTGGCCCTGGCAGTGCCCAGG - Exonic
1034944567 7:155253626-155253648 TGGGGACCACAGCACTTCCCTGG + Intergenic
1036422476 8:8611401-8611423 AGTTGCCCCCTGCTCTTCCCTGG + Intergenic
1037878419 8:22560920-22560942 AGGAAGCCCCAGAAATTCCCAGG + Intronic
1038269818 8:26066068-26066090 TAGTGGGTCCAGCACTTCCCTGG + Intergenic
1040316003 8:46261245-46261267 AGGAGCCCCCAGGACTGCCCCGG + Intergenic
1042097636 8:65234954-65234976 AGGAGGGCCCAGCAGTCCCCTGG + Intergenic
1043172453 8:76982376-76982398 AGTTGCCCCCAGTAGTTCCCAGG + Exonic
1043385741 8:79746187-79746209 TGATGTCCCCAGCACTGCCCTGG - Intergenic
1043847493 8:85178663-85178685 AGGTGGTCCAGGCACTCCCCTGG - Intronic
1043989421 8:86734276-86734298 AGGTGCCCCCAGCCTTGCCCAGG - Intronic
1045489140 8:102655939-102655961 AGGTGGCCTCTGGAGTTCCCCGG - Intergenic
1047762583 8:127965076-127965098 AGTAGGCCCCAGCACTTCTGGGG + Intergenic
1048174386 8:132138727-132138749 AGGAGGTCACAGCCCTTCCCAGG + Intronic
1048465860 8:134664250-134664272 TGCTTGCCCCTGCACTTCCCTGG - Intronic
1049246610 8:141566071-141566093 AGGTGGGCCCAGGGCTTCCCAGG - Intergenic
1049408184 8:142460877-142460899 GGGTGACCCCAGCACTGCCAGGG + Intronic
1049449988 8:142655411-142655433 AGGTGCCACCAGGACTGCCCAGG + Intergenic
1049614659 8:143570852-143570874 AGGTGGCTCCAGCCATTACCAGG - Intronic
1049747271 8:144268334-144268356 CGCTGGCCCCAGCACCTGCCCGG + Exonic
1050978203 9:11969339-11969361 AGGAAGCCCCATAACTTCCCTGG - Intergenic
1051151332 9:14082406-14082428 AGGTGGGGGCAGCTCTTCCCAGG + Intronic
1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG + Intergenic
1056006816 9:82281309-82281331 AACTGGCCTCAGCATTTCCCAGG - Intergenic
1056812701 9:89776690-89776712 ATGTGGCACCAGCACTTGCAGGG + Intergenic
1060945454 9:127567539-127567561 AGATCTCCCCAGCACCTCCCTGG + Intronic
1061062966 9:128259960-128259982 AGGTGACCCCAGCACCCTCCAGG - Intronic
1061193581 9:129095652-129095674 TGACGCCCCCAGCACTTCCCAGG + Intronic
1061258856 9:129468057-129468079 AGGTGTCCCCAGCTCTTCCCAGG + Intergenic
1061440860 9:130602543-130602565 TGGTGGCCTCAGCACCTGCCTGG - Intronic
1061708200 9:132469124-132469146 GGGGGGACCCAGCACTTGCCAGG + Intronic
1062048347 9:134434686-134434708 AGGGAGCCCCAGCCCTTCCAGGG - Intronic
1185612614 X:1401720-1401742 AGGTTGGCCCAGCCATTCCCTGG + Intergenic
1186042534 X:5496808-5496830 AGGTGGACCAGGCAGTTCCCTGG + Intergenic
1189467471 X:41288300-41288322 AAGTCTCCCCAGCACCTCCCAGG - Intergenic
1190897825 X:54638920-54638942 AGTTTGCCCCAGCATTACCCTGG + Intergenic
1190909269 X:54757194-54757216 AGATGGTCCCAGAACTTGCCTGG + Exonic
1192315372 X:70047477-70047499 AGATGTCCCCAGCACTGCCTAGG - Intronic
1197142123 X:123129493-123129515 AGGTGTTCCTTGCACTTCCCGGG - Intergenic
1197758022 X:130009873-130009895 TGGTTGACCCAGCTCTTCCCGGG + Intronic
1199076285 X:143530200-143530222 GGGTGGCGCCAGCACTCCCTTGG + Intergenic
1200118928 X:153781395-153781417 ATGTGGGCCCAGGACTGCCCTGG - Intronic
1200132808 X:153860436-153860458 AGGTGAGCCCTCCACTTCCCGGG - Intergenic
1202373306 Y:24212566-24212588 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1202497476 Y:25457554-25457576 AGGTGACCCCAGCACCCTCCAGG + Intergenic