ID: 1156481448

View in Genome Browser
Species Human (GRCh38)
Location 18:37439061-37439083
Sequence CTGGAACTGCAGAGGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 348}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156481437_1156481448 16 Left 1156481437 18:37439022-37439044 CCTCCACCTGAGAGCCCAGCAGC 0: 1
1: 0
2: 0
3: 37
4: 381
Right 1156481448 18:37439061-37439083 CTGGAACTGCAGAGGGCCCCAGG 0: 1
1: 0
2: 1
3: 42
4: 348
1156481443_1156481448 -6 Left 1156481443 18:37439044-37439066 CCTCCTCAGTCCTGATGCTGGAA 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1156481448 18:37439061-37439083 CTGGAACTGCAGAGGGCCCCAGG 0: 1
1: 0
2: 1
3: 42
4: 348
1156481438_1156481448 13 Left 1156481438 18:37439025-37439047 CCACCTGAGAGCCCAGCAGCCTC 0: 1
1: 0
2: 1
3: 45
4: 429
Right 1156481448 18:37439061-37439083 CTGGAACTGCAGAGGGCCCCAGG 0: 1
1: 0
2: 1
3: 42
4: 348
1156481440_1156481448 2 Left 1156481440 18:37439036-37439058 CCCAGCAGCCTCCTCAGTCCTGA 0: 1
1: 0
2: 2
3: 47
4: 371
Right 1156481448 18:37439061-37439083 CTGGAACTGCAGAGGGCCCCAGG 0: 1
1: 0
2: 1
3: 42
4: 348
1156481439_1156481448 10 Left 1156481439 18:37439028-37439050 CCTGAGAGCCCAGCAGCCTCCTC 0: 1
1: 0
2: 5
3: 67
4: 490
Right 1156481448 18:37439061-37439083 CTGGAACTGCAGAGGGCCCCAGG 0: 1
1: 0
2: 1
3: 42
4: 348
1156481441_1156481448 1 Left 1156481441 18:37439037-37439059 CCAGCAGCCTCCTCAGTCCTGAT 0: 1
1: 0
2: 1
3: 53
4: 470
Right 1156481448 18:37439061-37439083 CTGGAACTGCAGAGGGCCCCAGG 0: 1
1: 0
2: 1
3: 42
4: 348
1156481444_1156481448 -9 Left 1156481444 18:37439047-37439069 CCTCAGTCCTGATGCTGGAACTG 0: 1
1: 0
2: 0
3: 24
4: 311
Right 1156481448 18:37439061-37439083 CTGGAACTGCAGAGGGCCCCAGG 0: 1
1: 0
2: 1
3: 42
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156481448 Original CRISPR CTGGAACTGCAGAGGGCCCC AGG Intronic
900541326 1:3204477-3204499 CTGGAAGAGCAGAGGCCACCAGG + Intronic
900571870 1:3362589-3362611 CTGGGACTGCCGAGGGCCTTCGG + Intronic
900683277 1:3930873-3930895 CGGGAGCTGGAGAGGGGCCCGGG + Intergenic
900889613 1:5440237-5440259 GTGGTACTGCAGAGTGCCCTGGG + Intergenic
901182735 1:7352690-7352712 CTGTGAGTGCAGAGGGCCTCTGG + Intronic
901272204 1:7961424-7961446 CTGGAACTGCCGAGGGACTGGGG - Intronic
901634380 1:10663807-10663829 CTGGAACTGCCAATGGCCTCAGG - Intronic
901804880 1:11732142-11732164 CTGGAACTGCGGTGGGACCCAGG - Intergenic
902512047 1:16971896-16971918 CTGGAGCTGCTGAGGCCACCTGG - Intronic
902733213 1:18383532-18383554 CTGGCTGTGCAGAGGCCCCCTGG + Intergenic
903072467 1:20733045-20733067 CTGGAACTCCAGGGGCCCTCAGG - Intergenic
904807230 1:33140648-33140670 CTGGAGCTGCAGGGAGTCCCAGG - Intergenic
904890675 1:33777172-33777194 CTAGCACTGCAGAGGGCTACAGG + Intronic
905250723 1:36646519-36646541 CTGGGCATGCAGAGGGCCACAGG + Intergenic
905869593 1:41395417-41395439 CTGGAGCTGGAGAGCTCCCCGGG + Intergenic
906223720 1:44103822-44103844 CTGGAACATCAGTGGGCTCCAGG - Intergenic
906769328 1:48470774-48470796 AAGGAAATGCAGAGGGCTCCTGG + Intronic
906775956 1:48529816-48529838 CTTGACATGCAGAGGGCCCCTGG - Intergenic
906952936 1:50349281-50349303 CTGGACCTCCTGAGGGCCTCTGG + Intergenic
907520812 1:55022243-55022265 CTAGACCAGCAGAGGGCGCCAGG - Intergenic
910573415 1:88731435-88731457 CGGGTATTTCAGAGGGCCCCTGG + Intronic
910657362 1:89632843-89632865 CTGGTCCTGGAGAAGGCCCCCGG + Intergenic
910821898 1:91359756-91359778 CAGGAAATGCAGAGAACCCCAGG + Intronic
913201476 1:116498107-116498129 CTGGAGCTGGATAGGGCCCAGGG + Intergenic
914985881 1:152456934-152456956 CTGGAAGTGGAGAGAGACCCAGG - Intergenic
915146716 1:153799942-153799964 CTGGATCTGGAGAGGGTCCAGGG + Intergenic
915214359 1:154329975-154329997 CTAGATCTGCAGTGGTCCCCAGG + Intronic
915247743 1:154568259-154568281 CCGGGACTGCAGAGAGCACCTGG + Intronic
915601027 1:156923566-156923588 CTGGAACTGCTCAGGGTCCCTGG - Intronic
918801626 1:188979904-188979926 TGGGAATTGCTGAGGGCCCCAGG - Intergenic
919044188 1:192430612-192430634 CTGAAGCTGCAGAGGGCAGCTGG - Intergenic
919130826 1:193448448-193448470 CAGAAAGTACAGAGGGCCCCTGG - Intergenic
920366936 1:205453100-205453122 CTGAAACTTCAGAGAGCCTCAGG + Intronic
920503697 1:206501500-206501522 CTGCCACTGCAGTGGGCCCAGGG + Intergenic
922317955 1:224458983-224459005 CTGGAGCTGAACAGGGCCTCTGG - Intronic
922779408 1:228239934-228239956 CTGGGTCTGCAGAGGGCCCGAGG + Intronic
923281404 1:232446178-232446200 CTGGCACAGCAGAGGCCTCCAGG + Intronic
923472358 1:234303373-234303395 CGGGAACCGCAGAAGGCTCCTGG - Intronic
924709694 1:246522118-246522140 CTGGACCTGCAGGGGAGCCCGGG + Intergenic
1063767498 10:9159601-9159623 CTGGATCTGGTGAGGGCCTCAGG - Intergenic
1067061849 10:43081735-43081757 CTGGAAGGGGAGAAGGCCCCAGG + Intronic
1068080670 10:52314312-52314334 CTGGGACCGCAGGGGGCTCCCGG + Exonic
1069937053 10:71924779-71924801 GTGCAACTGCACAGGGCCCTGGG + Intergenic
1071926271 10:90413473-90413495 CGGATACTTCAGAGGGCCCCTGG + Intergenic
1073676010 10:105647868-105647890 CTGAAACTGCAGAGGGCAAAAGG + Intergenic
1074412013 10:113236474-113236496 CAGGCACCGCAGAGGACCCCAGG - Intergenic
1075206954 10:120456825-120456847 CAGGAGCTGCAGAGGGGCCGCGG + Intergenic
1075210132 10:120483857-120483879 CTGCATCTGCTGAGGGCCTCAGG - Intronic
1075713360 10:124542484-124542506 CTGGGACTGGAGAGGGCGCTGGG + Intronic
1075870104 10:125766016-125766038 GAGGAAGTGCAGAGGGCCCTGGG + Intergenic
1076686159 10:132199378-132199400 CTGGCACTGCAGAGAGCCTCAGG + Intronic
1076857986 10:133126930-133126952 CTGCAACTGCAGGGAGCCCCTGG - Intronic
1076863488 10:133155088-133155110 CTGAAAATGCAGAGGACCGCGGG + Intergenic
1077111732 11:865063-865085 CTGGCACTGCAGGGCGCTCCAGG + Intronic
1077167262 11:1149314-1149336 CTGGACCTGAAGAGGCCCCCTGG + Intergenic
1077196288 11:1282175-1282197 CTGGCACTGCAGGAAGCCCCAGG - Intronic
1077237711 11:1489862-1489884 CTGGCACTGCAGGGTGCTCCAGG + Intronic
1077305362 11:1866539-1866561 CAGGATCTGCAGTGGGCCCCTGG + Exonic
1078392051 11:10943874-10943896 CTGGAACTGCAGACTGCGGCTGG + Intergenic
1080905219 11:36538307-36538329 TTGGGACTGCAGCTGGCCCCTGG - Intronic
1081123101 11:39290393-39290415 CTGGATCTGGTGAGGGCCTCAGG + Intergenic
1083160949 11:60853760-60853782 TTGGAAGTGCAGAGGCCACCGGG + Intronic
1083234553 11:61343330-61343352 CTGGTATTGCAGAGGGCCGCGGG + Exonic
1083290726 11:61688630-61688652 GTGGAAGTGCAGGGGGCCCGTGG + Intronic
1084547402 11:69821303-69821325 TGGGAACTGCTGGGGGCCCCAGG - Intergenic
1085054398 11:73395351-73395373 GTGGAAGTGCAGCGGGCCCTAGG + Intronic
1087479484 11:98681017-98681039 CTGGGATTACAGAGGGGCCCCGG + Intergenic
1088325660 11:108598399-108598421 CTGGAAATGCAGAGGCACCAAGG + Intergenic
1089003529 11:115071543-115071565 CTGGAGCTGAAGAGGGGCACAGG - Intergenic
1089679239 11:120110170-120110192 CTGGGACTGCAGAGTGTCCCTGG - Intergenic
1090531491 11:127595572-127595594 CAGGAACTGCAGAGATCCCCAGG + Intergenic
1090716523 11:129436673-129436695 CAGGACCTGCGGAGGGCCGCTGG - Intronic
1090754819 11:129780735-129780757 TTGGTGCTACAGAGGGCCCCTGG - Intergenic
1091357192 11:134946188-134946210 CTGCAAGCCCAGAGGGCCCCAGG + Intergenic
1091388260 12:108927-108949 CAGCAACTGCAAAGGGTCCCAGG + Intronic
1092563417 12:9639995-9640017 CAGATACTTCAGAGGGCCCCTGG - Intergenic
1094252612 12:28381895-28381917 TTGGAACTGCAGGGGACCTCTGG + Intronic
1096056881 12:48660498-48660520 CTGGAAATGCAGTGGGCAGCAGG + Exonic
1096203815 12:49705705-49705727 GGGGAAATGCAGAGGGCCACAGG + Intronic
1096737502 12:53667280-53667302 CTGGCACTGCAGCCAGCCCCTGG - Intronic
1097305733 12:58067100-58067122 CTGGAAGAGGAGATGGCCCCAGG + Intergenic
1102246855 12:111361677-111361699 CTGGAGCTGAAGAGGGGCTCTGG + Exonic
1103274579 12:119700954-119700976 CTGGCTCAGCAGAGGGCCTCTGG - Exonic
1104894037 12:132153231-132153253 AGGGAACTCCAGAGGGGCCCAGG - Intergenic
1104942924 12:132403304-132403326 CTGGAGCTGCCGTGGGGCCCAGG + Intergenic
1106709022 13:32311553-32311575 CTGGGACGGCAGAGACCCCCAGG - Exonic
1107410512 13:40153681-40153703 TTGGCACTGCAGAGGTCCTCTGG + Intergenic
1108710589 13:53028792-53028814 CTGGCTCTGCAGAGAGCCCAGGG - Exonic
1110712730 13:78667401-78667423 CGGGTGCTGCAGAGGGCCCCTGG - Intergenic
1113244166 13:108376556-108376578 CTGGAACTGCCCTGGGCCCGTGG - Intergenic
1114485082 14:23057403-23057425 CTGGCACTGCCGAGGGGCCCAGG + Exonic
1114526696 14:23371011-23371033 CTGCACCTGCTGAGGGCCACAGG - Intergenic
1117413066 14:55468174-55468196 CTGGCACTCCAGAGGGCACAAGG + Intergenic
1117656395 14:57960831-57960853 CAGGAGCTGCAGAGGGACCTGGG - Intronic
1119427511 14:74545457-74545479 CTGGAGATACAGAGGGCCCTGGG + Intronic
1119705596 14:76780960-76780982 CAGCAACTGCAAAGGGCCTCTGG - Exonic
1119782315 14:77284712-77284734 ATGGATCTGCAGATGGCCACTGG + Intronic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1120733716 14:88030380-88030402 CTGTTTCTGCAGAGGGGCCCAGG - Intergenic
1122809341 14:104280333-104280355 CCGGAACTGCGGGGGGCCGCTGG + Intergenic
1122887288 14:104715716-104715738 CTGGAACTGCAGTTAGCGCCAGG - Intronic
1124353798 15:28979635-28979657 CTGGCCTTGCAGAGTGCCCCCGG + Intronic
1124618975 15:31263366-31263388 CTGGAGCTCCAGAGAGCCCTGGG - Intergenic
1125280725 15:38040040-38040062 AAGGAACTGCAGGTGGCCCCTGG - Intergenic
1126664065 15:51059922-51059944 CTGGGACTGTGGAAGGCCCCTGG - Intronic
1128220231 15:65963889-65963911 CTGGAAATGAAGAGGGGCCCAGG + Intronic
1129323878 15:74789454-74789476 CTGGTTCTGCAGAGGACACCAGG - Intronic
1129455114 15:75672591-75672613 CTGGGACTGCAGGGGGCCCCAGG + Intergenic
1129661196 15:77554036-77554058 CTTGAAGGGCAGTGGGCCCCAGG - Intergenic
1130016723 15:80193182-80193204 ATGAATCTGCAGAGGGCCCTGGG - Intergenic
1131329113 15:91480040-91480062 TGGCAGCTGCAGAGGGCCCCTGG - Intergenic
1132552471 16:559247-559269 CTGAGCCTGCAGAGAGCCCCAGG + Intergenic
1132724472 16:1332999-1333021 CTGGAACCCCAGCGGGCCCGCGG - Intergenic
1133021021 16:2966995-2967017 CCGGAACTGCAGCTGGGCCCTGG + Exonic
1134083977 16:11343842-11343864 CTGGTACTGCAGGAGGCCCTGGG + Intronic
1135874331 16:26183855-26183877 TTGAAACTGAAGAGAGCCCCTGG + Intergenic
1136089229 16:27906555-27906577 CAGGAGGTGCAGAGGGCCCCGGG - Intronic
1136655519 16:31706874-31706896 CTGGGGCTGCAGAGGGACCAGGG - Intergenic
1138186399 16:54981089-54981111 CTGGAACTGCAGAAGACTCATGG + Intergenic
1138433820 16:56986092-56986114 CTGGGACTCCAGAAGGTCCCAGG + Intergenic
1138502713 16:57457980-57458002 CTGGGAATGCAGAGGGCCAGAGG - Intronic
1138533790 16:57649143-57649165 CTGGAACAGCAAAGGGACCACGG - Intronic
1141393143 16:83681239-83681261 CAGGAACCACAGAGAGCCCCTGG + Intronic
1141695525 16:85617313-85617335 CTGGTGCTGGAGAGGGCCTCTGG + Intronic
1141772135 16:86095963-86095985 CTGGACATGCAGAGGCCACCAGG - Intergenic
1142493323 17:292713-292735 CTGGAAGAGGAGAGGGCCCAGGG - Intronic
1142811735 17:2398798-2398820 CTGGCAGTGGAGAGTGCCCCTGG - Intronic
1143960205 17:10710880-10710902 CTGGAACTACAGAGATGCCCTGG + Exonic
1143979267 17:10854283-10854305 CTGCATCTGCGGAGGGCCTCAGG + Intergenic
1145065991 17:19761854-19761876 CTGCAGCTGCAGAGGCCCACGGG - Intergenic
1145980236 17:29006710-29006732 CTGGTCCTGCAGAGGGGCCAAGG - Intronic
1146279154 17:31533846-31533868 CTGGCACTGCAGCAGGTCCCGGG - Exonic
1147333351 17:39712064-39712086 CAGGAACTGCAGCTGGCCTCGGG - Intronic
1147555195 17:41474540-41474562 CTGGGAGTGCAGAGGGCTCAGGG - Intergenic
1147952762 17:44116155-44116177 CAGGGACTGCAGATGGCTCCTGG + Intronic
1148087224 17:45001466-45001488 CTAGGACTTCAGAGGGCACCTGG + Intergenic
1149642262 17:58210830-58210852 CTGGAAACGCAGAGGGTTCCTGG - Intronic
1149659449 17:58326732-58326754 CTGGAGCTGCTGAGGGCCCTGGG - Exonic
1151490427 17:74429817-74429839 CTGGACCAGCACAGGCCCCCGGG + Intronic
1151798073 17:76359950-76359972 CAGGAACTGCGGAAGGCCCTGGG + Intronic
1151972483 17:77465970-77465992 CTGGAAGTGCTGGGGCCCCCAGG + Intronic
1152126620 17:78451000-78451022 CTGGAACCTCAGAGAGGCCCTGG + Intronic
1152507757 17:80762400-80762422 GTGGAGCTGGCGAGGGCCCCAGG + Intronic
1152523352 17:80873192-80873214 TTGGAACCGCACAGAGCCCCGGG - Intronic
1153097779 18:1427798-1427820 CTGGCCCTGCACAGGGCCCCTGG - Intergenic
1153112374 18:1607480-1607502 CTGGAGCTGCAGAAAGTCCCTGG - Intergenic
1153820862 18:8830295-8830317 CTGGAACTTCATACGGCCACAGG - Intronic
1156481448 18:37439061-37439083 CTGGAACTGCAGAGGGCCCCAGG + Intronic
1156489359 18:37487161-37487183 CAGGAGCTGCAGAGGACACCGGG - Intronic
1157452789 18:47800881-47800903 CTGGACTTGCTGAGAGCCCCAGG + Intergenic
1157804287 18:50646538-50646560 GTGGAACTGCAGAGGGACGGGGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158843930 18:61420633-61420655 CTGGAACTGCAGTGGTACACAGG + Intronic
1160008918 18:75089038-75089060 CTGGAACTGGAGAGGCCGCCTGG + Intergenic
1160356416 18:78231003-78231025 CAGCAAGTGAAGAGGGCCCCAGG - Intergenic
1160899055 19:1417808-1417830 CTGGAAGTGCAGAGGGCTGGGGG + Intronic
1160943451 19:1630560-1630582 CTGGACCTGCTGCGGGGCCCAGG - Intronic
1161007826 19:1945193-1945215 CTGCACCTGCAGAGGGGCCCTGG - Intronic
1161073391 19:2273537-2273559 CTGGGACCACAGAGGGCCCTGGG + Intronic
1161295348 19:3516903-3516925 CTGCAGCTGCACACGGCCCCTGG - Intronic
1162320546 19:9968710-9968732 CTGGGAGGCCAGAGGGCCCCTGG + Exonic
1163649402 19:18508552-18508574 CTGGCACTGCACAGGGGCCTGGG + Intronic
1163746794 19:19053586-19053608 GTGGAACTGCAGAGGGCTACAGG + Intronic
1163782229 19:19256625-19256647 CTGGAACTGGAGTGGGCCTGGGG + Exonic
1164616333 19:29668901-29668923 GTGAACCTGCAGAGGGTCCCAGG - Intronic
1165377149 19:35450716-35450738 CTGGACCTTCAGAGGTCGCCTGG + Exonic
1165550964 19:36585319-36585341 CTTGACCAGCAGAGAGCCCCAGG + Intronic
1165873726 19:38991236-38991258 CTGGTCCTGCAGAGGACGCCTGG + Intronic
1165902384 19:39174835-39174857 GTGGAACTGCAGGGGGAGCCAGG + Intronic
1166297037 19:41894525-41894547 CTGGAACCGGGGAGAGCCCCAGG + Exonic
1167149845 19:47702257-47702279 CTGAACCTGCAGCAGGCCCCCGG + Exonic
1167607879 19:50491232-50491254 CTGCAGCTGCAGAGGCCCCGAGG - Intergenic
1167615311 19:50529902-50529924 CTGGGAATGAAGGGGGCCCCAGG - Intronic
1202647029 1_KI270706v1_random:152533-152555 CTGTGGCTGCAGATGGCCCCTGG - Intergenic
1202647109 1_KI270706v1_random:152824-152846 CGGTGGCTGCAGAGGGCCCCTGG - Intergenic
925582022 2:5420539-5420561 ATGGAAGTGCAGAGGTCGCCTGG + Intergenic
925923228 2:8652146-8652168 CTGCATATGCAGAGGGCCTCAGG + Intergenic
926115149 2:10208373-10208395 CTGGGACTGCAGTGAGACCCAGG + Intronic
927948092 2:27149367-27149389 CTGCACCTGCAGAGGGGTCCAGG + Intronic
928337256 2:30408434-30408456 CTGGAACTGAAGTGGGCCTTTGG + Intergenic
928650184 2:33395841-33395863 GTGGAACTGCAGGGGGCAGCAGG - Intronic
929108981 2:38390628-38390650 CTGGAACTGCAGTGGTCTCCTGG - Intergenic
930090075 2:47525556-47525578 CTTGAAGTACAGATGGCCCCTGG - Intronic
930160118 2:48146318-48146340 CTGGAATAGCTGGGGGCCCCAGG - Intergenic
930917483 2:56711307-56711329 CTGGAAAAGAACAGGGCCCCAGG + Intergenic
931816859 2:65912683-65912705 CTGGAAATACCAAGGGCCCCAGG - Intergenic
932019496 2:68068547-68068569 ATGGAACAGAATAGGGCCCCTGG + Intronic
932265728 2:70365610-70365632 CTGGAATTGCAGAGTAGCCCTGG + Intergenic
932428673 2:71660078-71660100 CTGGGGCTGCAGAGTGCCCAGGG - Intronic
932884927 2:75541082-75541104 CTGGAAGTGCAGAGAGGGCCAGG + Intronic
933463963 2:82626489-82626511 CTGCAACTGCTGAGGGCCTCAGG + Intergenic
933890872 2:86768595-86768617 CTGGAGCTGCTGTGGGCCCGTGG + Intronic
936233770 2:110725963-110725985 CTAGGACTACAGAGAGCCCCTGG + Intergenic
937036740 2:118788432-118788454 CTGGAACAGCAGGAGGCACCAGG - Intergenic
938767738 2:134471825-134471847 CTGCCACTGCAGAGTGACCCTGG - Intronic
939453203 2:142399597-142399619 CTGCTTCTGCTGAGGGCCCCAGG - Intergenic
940256906 2:151740680-151740702 CTGGAACTGCAAAATGCTCCAGG + Intergenic
940989861 2:160086153-160086175 CTGTCACTGCACAGGACCCCTGG - Intergenic
941432173 2:165426331-165426353 CTGTAAATTCAGAGGTCCCCAGG - Intergenic
942212028 2:173680909-173680931 CTGGAACTGCAACGGGCTACCGG - Intergenic
942227441 2:173829699-173829721 CTGGTACTGCAGATGGCTCAGGG + Intergenic
946347746 2:219124879-219124901 CTGGGACTGCAGAGAGCTCTGGG - Intronic
948360343 2:237415677-237415699 CTGGAGCTGCAGAGGGGAGCAGG - Intergenic
948668904 2:239553836-239553858 CTGGAGGTGCAGAGGGGCCCGGG - Intergenic
948678216 2:239611612-239611634 CTGGGTCTGCTCAGGGCCCCAGG - Intergenic
948913427 2:241017999-241018021 CTGGAACTGAGGGGGTCCCCGGG - Intronic
1168990810 20:2094731-2094753 CTGGATTTTCAGAGGGCTCCAGG - Intergenic
1169037317 20:2463852-2463874 CTGGAGCTGCCGGGGGCCCAGGG - Exonic
1170481467 20:16769261-16769283 CTGCATCTGCTGAGGGCCTCAGG + Intronic
1171196274 20:23201930-23201952 GTGGAACTTCAGAGAGCTCCCGG + Intergenic
1171425112 20:25044076-25044098 CTGGACCTGCACAGGGCCTCAGG + Intronic
1172175552 20:32970004-32970026 GTGGAATTGCAAAGGCCCCCTGG - Intergenic
1172441838 20:34971531-34971553 CTGCAGCTGCCCAGGGCCCCAGG + Intergenic
1172446038 20:34993922-34993944 CGGGAATTGCAGAGGCCACCAGG + Intronic
1172969140 20:38860913-38860935 TGGGACCTGCAGGGGGCCCCTGG - Intronic
1173631740 20:44521615-44521637 CTGGAGCTGGAGAGGGACCAAGG - Intronic
1173759365 20:45546153-45546175 CAGGCACTGCAAAGGTCCCCTGG + Intronic
1175318825 20:58071241-58071263 CAGGAAATGCACAGGGCACCAGG - Intergenic
1175516500 20:59573833-59573855 CTGGACAGGCACAGGGCCCCAGG - Intergenic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175758296 20:61544205-61544227 CTGGCATTGCCGAGGTCCCCTGG - Intronic
1175981143 20:62739309-62739331 CTGGAACAGCAGTGGGACCCAGG - Intronic
1176604761 21:8819950-8819972 CGGTGGCTGCAGAGGGCCCCTGG + Intergenic
1176939858 21:14911438-14911460 CAGGACCTGCCCAGGGCCCCAGG - Intergenic
1178497439 21:33099246-33099268 CTGAAACAGCAGAAGGGCCCAGG + Intergenic
1178729219 21:35083720-35083742 CTGCAACTGGTGAGGGCCTCAGG - Intronic
1178798437 21:35767689-35767711 CTGGAAGTACAGAGGGTCTCTGG - Intronic
1179461476 21:41538336-41538358 CTGGAGTTGCAGAGAGGCCCGGG + Intergenic
1180347051 22:11711555-11711577 CGGTGGCTGCAGAGGGCCCCTGG + Intergenic
1180354799 22:11829645-11829667 CTGTGGCTGCAGAGGGCCCCTGG + Intergenic
1180383452 22:12162686-12162708 CTGTGGCTGCAGAGGGCCCCTGG - Intergenic
1181327465 22:22060922-22060944 CTGGGACTGCACACGGGCCCAGG + Intergenic
1181368222 22:22396578-22396600 CTGGAAATGCAGAAAACCCCAGG - Intergenic
1181371882 22:22425359-22425381 GTGGAAATGCAGAGGACTCCAGG - Intergenic
1181602684 22:23961511-23961533 CTGGAACTGGGCAGGGTCCCTGG - Intergenic
1181605830 22:23979796-23979818 CTGGAACTGGGCAGGGTCCCTGG + Intronic
1181637938 22:24182912-24182934 CAGGAACTGCACAGGCCACCAGG - Intronic
1182796150 22:32993137-32993159 CTAGATCTGTAGAGGGGCCCAGG + Intronic
1183337129 22:37256272-37256294 CTGGAACTGAAGAGTGGCCCAGG - Intergenic
1184256589 22:43290521-43290543 GGGGAGGTGCAGAGGGCCCCAGG - Intronic
1184674023 22:46030550-46030572 CTGGAGCTGCAGGCTGCCCCAGG - Intergenic
1185153489 22:49179701-49179723 CTGGAACCACAGAGGCTCCCAGG - Intergenic
952054092 3:29423183-29423205 TTGAAAATGCTGAGGGCCCCAGG + Intronic
952530827 3:34260118-34260140 CTGGACCTCTAGAGGGTCCCAGG - Intergenic
952577173 3:34789477-34789499 CTGGAACAGCAGAGGGACAGTGG - Intergenic
953180641 3:40591223-40591245 CTGGAACTGCTGAGATCCACTGG - Intergenic
953686298 3:45080959-45080981 CTGCAACTGATGAGGGCCTCAGG - Intergenic
953899268 3:46830132-46830154 ATGGATCTCCAGAGGGCCCGTGG + Intronic
954294447 3:49666313-49666335 CTGGAAAAGCAGTGGGGCCCTGG + Intronic
954693757 3:52409841-52409863 CTGGAGCTGGAGAGCGACCCAGG - Exonic
954865945 3:53729714-53729736 CTGGAACTGCAATGAGCCTCGGG + Intronic
955551302 3:60088019-60088041 CTGCATCTGCTGAGGGCCCCTGG + Intronic
955701925 3:61690234-61690256 TTGGAAATGCAGAGGCCTCCTGG + Intronic
955860693 3:63326545-63326567 AAGGAACTCCAGAGGGCCACTGG + Intronic
956157741 3:66316624-66316646 CAGGAACTCCAGAGAACCCCAGG - Intronic
956990087 3:74752271-74752293 CTGCAGCTGCACAGGGGCCCAGG + Intergenic
959838642 3:110949371-110949393 CTGTAACAGCAGGGGGGCCCTGG + Intergenic
960149137 3:114232755-114232777 CAGGAGCTGGAGAGGGGCCCTGG - Intergenic
961431800 3:126889069-126889091 GGGGAACTGCAGAAAGCCCCAGG + Intronic
961530923 3:127539957-127539979 ATGGCCCTTCAGAGGGCCCCGGG + Intergenic
961611653 3:128144508-128144530 GTGGAACTGTAGGGGGCCCACGG + Intronic
962403332 3:135079944-135079966 CTGGAACTTAGGAGTGCCCCTGG + Intronic
962984300 3:140520669-140520691 CAGGAACTGCAGAGAACCCCAGG - Intronic
964310292 3:155385144-155385166 CTGAAACTCCAGAGGGGACCTGG - Intronic
965034642 3:163423001-163423023 CTGGACCTGCAGTGGGCCAAAGG + Intergenic
965157475 3:165082660-165082682 CTGGAAATGCAGAGAGAGCCAGG + Intergenic
966008191 3:175043040-175043062 CTGCAACTGATGAGGGCCTCAGG - Intronic
966401010 3:179546871-179546893 CTGGACCTGCCCAGGGCCCAGGG + Intergenic
968353472 3:198081237-198081259 CGGTGGCTGCAGAGGGCCCCTGG - Intergenic
968641151 4:1715710-1715732 CTGCTCCTGCAGAGGGCCCTGGG + Intergenic
969220038 4:5753342-5753364 CAGGAACTGCAGAGGGACAGAGG + Intronic
969453721 4:7289214-7289236 CTCCATCTGCAGAGGGCCACAGG - Intronic
971308061 4:25501061-25501083 CTGGAACTGCTGAGAGCAGCTGG + Intergenic
973327367 4:48877417-48877439 CTGGACCTGCCTAGGGCCTCAGG - Intergenic
973373363 4:49270987-49271009 CGGTGGCTGCAGAGGGCCCCTGG - Intergenic
973387647 4:49524221-49524243 CGGTGGCTGCAGAGGGCCCCTGG + Intergenic
973568637 4:52214480-52214502 ATGGAACAGAAGAGAGCCCCCGG - Intergenic
973673802 4:53243115-53243137 CAGAAACTGCAGAGAACCCCAGG + Intronic
975254433 4:72216632-72216654 CTGGGAGTGCAGAGGTCCCTGGG + Intergenic
977221608 4:94344424-94344446 CAGGAGCTGCAGAGAGCTCCTGG - Intergenic
978552290 4:109940160-109940182 CTAGAACAGGAGAGGACCCCAGG + Intronic
979958706 4:126989516-126989538 CTGGAACTGAGAAGAGCCCCTGG + Intergenic
980502028 4:133668580-133668602 CTGGAACTGCAGACAGCACCTGG - Intergenic
983416441 4:167461323-167461345 CAGGCACTGCAGAGAGCCCTTGG + Intergenic
983523568 4:168736636-168736658 CTGGACTTGCAGAAGGCCCTAGG + Intronic
983537850 4:168877719-168877741 CTGGAGCTTCAGAGGGTCCCTGG - Intronic
985777436 5:1852177-1852199 CAGGAAATGCAGAGCTCCCCGGG - Intergenic
985780803 5:1869789-1869811 CTGCACCTACAGAGGGCCCCGGG - Intergenic
985781151 5:1872459-1872481 GTGGCACTGCAGATGGCCCCAGG - Intergenic
985782974 5:1880669-1880691 CTGACAGTGCAGAGGGCCCGTGG + Intronic
986920213 5:12671255-12671277 CTGGAAATACAGAGGGCCGTCGG - Intergenic
987260581 5:16198035-16198057 CAGGAAATGCAGAGAACCCCAGG + Intergenic
990953290 5:61319720-61319742 CTGGAGCTGCAGAGGGGCATGGG + Intergenic
992734262 5:79703106-79703128 CTGGACCAGCAGGGGGCCCCGGG + Intronic
995294374 5:110502263-110502285 CTGGAACTGCAGAAATTCCCTGG - Intronic
996839930 5:127836764-127836786 ATAGAGCAGCAGAGGGCCCCTGG + Intergenic
997579542 5:135008651-135008673 CTGGGAATGCAGAGCACCCCTGG - Intronic
997603588 5:135156939-135156961 CTGGACCTGCAGGACGCCCCAGG + Intronic
997801224 5:136864681-136864703 CTGCAACTGCCCAGGGCTCCTGG - Intergenic
998171359 5:139873697-139873719 CCGCAACTGCAGAGGACACCAGG - Intronic
998782440 5:145672956-145672978 CCTGAACTACAGAGGGCCCTAGG - Intronic
1001271196 5:170312915-170312937 CTGGAAATGCAGAAATCCCCAGG - Intergenic
1001535877 5:172497546-172497568 CTGGGAATACAGAGGGCCCCAGG - Intergenic
1001588432 5:172849302-172849324 CCGGATCCGCACAGGGCCCCAGG - Intronic
1002070082 5:176673990-176674012 CTGGAGCTCCAGGGGTCCCCTGG - Intergenic
1002660795 5:180790154-180790176 CTGGGCCAGCAGAGGGCACCGGG + Intergenic
1004208461 6:13614645-13614667 CTGGAACAGCAGCTGGCCCGTGG - Intronic
1005812472 6:29528139-29528161 CTGGAAAGGCAGAGGTCACCTGG - Intergenic
1005812494 6:29528253-29528275 CTGGGAAAGCAGAGGTCCCCTGG - Intergenic
1005812517 6:29528384-29528406 CTGGAAAGGCAGAAGTCCCCTGG - Intergenic
1006428932 6:33983324-33983346 CTGGCACTGCTGTGGGCACCAGG - Intergenic
1007588574 6:43007832-43007854 GGGGAAATGCAGAGGTCCCCTGG - Intronic
1010926320 6:81750933-81750955 TTGTAACTGCAGGGTGCCCCTGG - Intronic
1011791830 6:90907143-90907165 CTGGACCTGCACTGGGCCACAGG - Intergenic
1013466208 6:110419129-110419151 CTTGGGCTGCAGAGGTCCCCAGG + Intergenic
1015858860 6:137654640-137654662 CAGATACTTCAGAGGGCCCCTGG + Intergenic
1015885336 6:137911870-137911892 CTCGCACTGCAGATGGCACCTGG - Intergenic
1018595829 6:165479406-165479428 CAGGAACTGCAGAGGCCCTGAGG - Intronic
1019551923 7:1607381-1607403 CTGGAACTGGAATGGGCTCCCGG + Intergenic
1022467216 7:30660163-30660185 CTGGACCTGGAGAGGGTCACTGG + Intronic
1023400750 7:39792038-39792060 CTGGGCCTGCAGAGGCCGCCGGG - Intergenic
1023400765 7:39792101-39792123 TTGGGCCTGCAGAGGGCGCCGGG - Intergenic
1023560655 7:41470234-41470256 CAGGTACTGCAGGGGCCCCCTGG + Intergenic
1024074215 7:45810553-45810575 CTGGGCCTGCAGAGGCCGCCGGG - Intergenic
1024074230 7:45810616-45810638 TTGGGCCTGCAGAGGGCACCGGG - Intergenic
1025053183 7:55744912-55744934 TTGGGCCTGCAGAGGGCGCCGGG + Intergenic
1025182110 7:56828517-56828539 CTGGGCCTGCAGAGGCCGCCGGG + Intergenic
1025689819 7:63748478-63748500 CTGGGCCTGCAGAGGCCGCCGGG - Intergenic
1025691548 7:63755601-63755623 CTGGAACTGGAGACGCCCCTGGG - Intergenic
1025919109 7:65893846-65893868 GTGGAAATGCACAGGGCCCAGGG - Intronic
1026481441 7:70783095-70783117 CTGGAACTGCAAGGCACCCCTGG + Intronic
1026739440 7:72969591-72969613 CTGGAACTACAGAGGTCGCACGG - Intergenic
1026790458 7:73328206-73328228 CTGGAACTACAGAGGCCACGCGG - Intronic
1027104291 7:75395482-75395504 CTGGAACTACAGAGGTCGCACGG + Intronic
1029438277 7:100574307-100574329 CTGGAAGAGGAGGGGGCCCCGGG - Intronic
1029597817 7:101547011-101547033 CAGTATCTGCAGCGGGCCCCAGG + Intronic
1031288298 7:119900433-119900455 CTGGAACTGCCTAGGGCCTGGGG - Intergenic
1033791452 7:144796509-144796531 CAGGAACTGCACAGGGCACAGGG + Intronic
1035302431 7:157906287-157906309 CTGGGAGTGCAGAGGCCTCCTGG + Intronic
1036454300 8:8893702-8893724 CGGGAGCTGCGGAGGGCGCCGGG + Intergenic
1036470228 8:9046393-9046415 CAGGAACTGCAGAGGTCTCAGGG - Intronic
1036621198 8:10425361-10425383 CTGGTACTGCCGAGGCCCACCGG + Intronic
1036649716 8:10634601-10634623 CTGGAACTGCAGAAGGCTCTAGG + Intronic
1036924504 8:12891597-12891619 CTGGACCTGCAGTTGTCCCCTGG - Intergenic
1037728119 8:21500878-21500900 CTGGGACTGCAGAGAACCCAGGG - Intergenic
1039885044 8:41649843-41649865 CTGGAACTGCCGGGGGCCCTAGG + Intronic
1041708854 8:60875114-60875136 CTGGAAGTGTACAAGGCCCCAGG - Intergenic
1041714791 8:60923252-60923274 CTGTGTCTGCAGAGGGGCCCGGG - Intergenic
1042794471 8:72645617-72645639 CTGGAGCTTCAGAGGGGCACAGG + Intronic
1044997850 8:97854287-97854309 CTAGAAATGGAGAGGGCACCAGG + Intergenic
1045211931 8:100107772-100107794 CAGGAAATGCAGAGAACCCCAGG + Intronic
1048350679 8:133613515-133613537 GTGGAAGTGCAGAGGCCACCTGG + Intergenic
1049114475 8:140674157-140674179 GTGGAACTGCAGTGAGACCCAGG - Intronic
1049179772 8:141216242-141216264 CTGGCAGGGCAGGGGGCCCCTGG - Intronic
1049229948 8:141476802-141476824 CTGGAATGCCTGAGGGCCCCGGG - Intergenic
1049265476 8:141665679-141665701 AAGGAGCTGCAGAGGGTCCCCGG - Intergenic
1049364949 8:142232619-142232641 CTGGAGCTGCAGAGTGTCCCTGG - Intronic
1049600243 8:143504213-143504235 GAGGAACTGCAGAGGGGTCCTGG + Intronic
1050160764 9:2717030-2717052 CTGGACCTGAACAGTGCCCCAGG + Intergenic
1052872662 9:33523721-33523743 CGGTGGCTGCAGAGGGCCCCTGG + Intergenic
1054351604 9:64021346-64021368 CGGTGGCTGCAGAGGGCCCCTGG + Intergenic
1054957453 9:70928907-70928929 CTGGAACTACAAAAGGCCCTTGG + Intronic
1056713585 9:89010602-89010624 CTGGTCCTGCAGAGTGCACCTGG - Intergenic
1056788580 9:89610728-89610750 AGGGAACTGGAGAGAGCCCCAGG - Intergenic
1058778498 9:108309714-108309736 CTGAAACTGCAGCTGCCCCCAGG + Intergenic
1058813810 9:108665800-108665822 CTGGAGATGCAGAAAGCCCCAGG + Intergenic
1059216342 9:112567422-112567444 CTGGAACTACAGAGGCCTCCTGG - Intronic
1059393895 9:114018316-114018338 CTGGATCTCCAGAGGGGCACAGG - Intronic
1059647811 9:116284871-116284893 CAGGAGCTGAAGAGGGCCTCAGG - Intronic
1060239147 9:121888059-121888081 CAGGAACTGGAGAGGGGACCTGG - Intronic
1060785521 9:126449172-126449194 CTGGACTGGCAGAGAGCCCCGGG + Intronic
1060945543 9:127568036-127568058 CCGGAGCTGCAGAGGGGGCCTGG - Intronic
1061119722 9:128635415-128635437 CTGGGACTGGAGAGGGCCCTGGG - Intronic
1061146743 9:128804111-128804133 CTGAAACTGGTGAGGACCCCAGG + Exonic
1061900682 9:133670620-133670642 CTGGAGCAGCAGCGGGCCGCAGG - Exonic
1062004707 9:134233391-134233413 CTGGAAGCGGGGAGGGCCCCAGG + Intergenic
1062373688 9:136252673-136252695 CTGGAACTACAGAGGTGCACAGG - Intergenic
1062627150 9:137448476-137448498 CTGGCACCACAGTGGGCCCCTGG - Exonic
1062724609 9:138064767-138064789 CTGGAGCTGCAGAGGCTCCATGG - Intronic
1202800944 9_KI270719v1_random:174916-174938 CAGTGGCTGCAGAGGGCCCCTGG + Intergenic
1203552138 Un_KI270743v1:172039-172061 CGGTGGCTGCAGAGGGCCCCTGG + Intergenic
1189953582 X:46256669-46256691 CTGAAACTGCAGTGGGATCCAGG + Intergenic
1190596801 X:52059933-52059955 CGGGGTCTGCAGAAGGCCCCAGG + Intergenic
1190612023 X:52194140-52194162 CGGGGTCTGCAGAAGGCCCCAGG - Intergenic
1194402924 X:93460623-93460645 CTGATATTCCAGAGGGCCCCTGG - Intergenic
1198276107 X:135097583-135097605 CAGGAGCTGCAGAGAGACCCAGG + Intergenic
1198310406 X:135423152-135423174 CAGGAGCTGCAGAGAGACCCAGG - Intergenic
1198314531 X:135452495-135452517 CTGACACTGCAGTGGGCCCCAGG + Intergenic
1199736179 X:150688853-150688875 CAGGAACTGCAGAGTGCAGCTGG + Intergenic
1200117162 X:153774445-153774467 CTCGTACTGCACAGGGCCCAGGG - Exonic
1200120338 X:153787213-153787235 CGGGGCGTGCAGAGGGCCCCAGG + Intronic
1201153419 Y:11107612-11107634 CGGTGGCTGCAGAGGGCCCCTGG + Intergenic