ID: 1156486796

View in Genome Browser
Species Human (GRCh38)
Location 18:37471544-37471566
Sequence CAGGATCTAGGTGGATGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156486796_1156486802 -8 Left 1156486796 18:37471544-37471566 CCCCTCCATCCACCTAGATCCTG 0: 1
1: 0
2: 1
3: 18
4: 265
Right 1156486802 18:37471559-37471581 AGATCCTGCCGATCTTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 113
1156486796_1156486807 24 Left 1156486796 18:37471544-37471566 CCCCTCCATCCACCTAGATCCTG 0: 1
1: 0
2: 1
3: 18
4: 265
Right 1156486807 18:37471591-37471613 ACTCAGTGAGCAGTCCTGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156486796 Original CRISPR CAGGATCTAGGTGGATGGAG GGG (reversed) Intronic
900743407 1:4343995-4344017 CGGATTCTAGTTGGATGGAGTGG - Intergenic
900844060 1:5082143-5082165 CAGGATGGAGGAGGATGGATGGG - Intergenic
901675356 1:10880278-10880300 GAGCATCTAGGAGGAGGGAGAGG - Intergenic
902404216 1:16174234-16174256 GAGGCTCTGGGTGGATGGAGAGG - Intergenic
902783228 1:18717440-18717462 AAGGTTCTAGGTGGAGGGAAGGG - Intronic
904322133 1:29704593-29704615 CAGAAGCTAGGTGGGTGGAGGGG + Intergenic
905123236 1:35698742-35698764 AAAGATGTAGGTGGATGGAAAGG - Intergenic
907584136 1:55601186-55601208 CAGGATTTAGGCAAATGGAGTGG - Intergenic
908214293 1:61934890-61934912 CCGAAACTAGGTGGATGGTGCGG - Intronic
911778169 1:101841672-101841694 CAGGGTCTAGATGGAGGGACAGG + Intronic
912368119 1:109151465-109151487 CAGGCTTTGGGTGGATGGACTGG - Intronic
914839950 1:151240146-151240168 TGGGATGTAGGTGGAAGGAGAGG - Intronic
915846835 1:159275481-159275503 CAGGAACTACGAGGATGGAAAGG - Intergenic
915899046 1:159833388-159833410 CAGGAGGTAGGTGGAGGAAGTGG + Intronic
916682579 1:167117715-167117737 CCGAATGCAGGTGGATGGAGGGG - Intronic
916833324 1:168515168-168515190 CAGACTCTAGGTGGAGTGAGGGG - Intergenic
918114503 1:181484784-181484806 CAGGATCCAGGTGGATCGGCTGG + Intronic
920300004 1:204982802-204982824 GATCATGTAGGTGGATGGAGTGG + Intronic
920412359 1:205772284-205772306 CAGTCTCTATGTGGATGGAGGGG - Intronic
920741843 1:208588204-208588226 CAGGATCAAGGAGGTTGGAAGGG - Intergenic
921395995 1:214670256-214670278 CAGGGTCTAGCAGGAGGGAGTGG - Intergenic
921562019 1:216670548-216670570 CAGGATCAAGGTGTACGCAGGGG - Intronic
922886640 1:229025462-229025484 CATGAGCTAGGTGGCTGGGGAGG - Intergenic
1063047007 10:2402084-2402106 CAGGAGCAAGGGGGATGGAGTGG - Intergenic
1064288567 10:14013431-14013453 CAGGCTGTAGGAGGAGGGAGAGG + Intronic
1064937583 10:20695515-20695537 TGGGATCTGGGTGGAAGGAGAGG + Intergenic
1065937466 10:30533412-30533434 CAAGGTCTATGTGGAGGGAGAGG + Intergenic
1067655574 10:48188922-48188944 CAGGGGCTAGGTGGGTGGAATGG + Intronic
1070325769 10:75387961-75387983 CTGGATCTATGTGGGAGGAGGGG + Intergenic
1070756563 10:78997088-78997110 TAGGAAGTAGCTGGATGGAGTGG - Intergenic
1073598118 10:104819827-104819849 CAGGTTTTAGGAGGGTGGAGAGG + Intronic
1074476354 10:113778231-113778253 CAGGATGGAGGTGAAAGGAGAGG + Intronic
1076316616 10:129546404-129546426 CAGGATGTAGGGGCATGGAGGGG + Intronic
1076852801 10:133101290-133101312 CAGGCTCTGGATGGCTGGAGAGG + Intronic
1078203134 11:9202720-9202742 CAGAAGCTGGGTGGATGGAATGG - Intronic
1078464959 11:11543482-11543504 CAGGCTCTTGGTGGGTGGTGGGG - Intronic
1080736653 11:35022371-35022393 CGGGAGCTTGGTGGAGGGAGAGG + Intergenic
1081757926 11:45557788-45557810 CAGGATCTTGGGGGGTGGGGTGG - Intergenic
1083804266 11:65064642-65064664 CAGGAAGTAGGTGGTTGGGGAGG + Intergenic
1084010575 11:66346353-66346375 CAGGAGGTGGGTGGATGGTGTGG - Intronic
1085002937 11:73057502-73057524 AAGGATATAGGTGAATGGAAAGG + Intronic
1088239238 11:107756906-107756928 CAGGCTCCAGTGGGATGGAGGGG - Intergenic
1089010981 11:115131512-115131534 CAGTACCTGGCTGGATGGAGTGG - Intergenic
1089079042 11:115760899-115760921 CAGGAGGCAGGTGGATGGGGAGG + Intergenic
1089633441 11:119797394-119797416 CAGGCTCTAAGTAGGTGGAGGGG + Intergenic
1090674743 11:128980693-128980715 CAGCAGTTTGGTGGATGGAGAGG + Exonic
1091075973 11:132617492-132617514 GTGGATCTAAGTGCATGGAGGGG - Intronic
1091355198 11:134932398-134932420 CAGGATCTGGGAGGAGGGATGGG + Intergenic
1092887796 12:12940625-12940647 GAGGGTCCTGGTGGATGGAGGGG + Intergenic
1096380689 12:51155372-51155394 TAGGATATAGATGGATGGATGGG - Intronic
1096473596 12:51894978-51895000 CAGGTTGGAGGTGGAGGGAGAGG - Intergenic
1101029138 12:100642965-100642987 CAGGATTAAAGTGGATAGAGGGG - Intergenic
1102439251 12:112948893-112948915 TAGGGTCTAGCTGGATGGGGTGG - Exonic
1103054533 12:117808347-117808369 CAGGATCTAGGAGGCGGGGGTGG - Intronic
1103435878 12:120925032-120925054 CAGGTCATAGGTGGATGGTGGGG + Intergenic
1105673252 13:22643215-22643237 CTGGATCCAGGTGGCTTGAGAGG + Intergenic
1106354774 13:28970730-28970752 CACGATGGAGGGGGATGGAGGGG - Intronic
1106650391 13:31683991-31684013 GAGGGTCTAGGAGGAGGGAGAGG + Intergenic
1106797054 13:33217400-33217422 CAGGAGCAGGTTGGATGGAGAGG - Intronic
1106881118 13:34131524-34131546 CAGGACCTAGGAGGACTGAGAGG - Intergenic
1107034377 13:35885025-35885047 CAGGCTCTTGGTAGAAGGAGGGG + Intronic
1107070457 13:36262614-36262636 AAGGATAAAGGTGGCTGGAGGGG + Intronic
1107829590 13:44362517-44362539 CAGGATGGAGGGGGATGGTGAGG + Intergenic
1107864658 13:44692089-44692111 AAGGATCTAGTTGGCTTGAGGGG - Intergenic
1112774238 13:102826786-102826808 CAGTATCTAGATGGAGTGAGAGG + Intronic
1115546151 14:34466446-34466468 CAGGAGACAGGTGGATGAAGGGG + Intergenic
1117512737 14:56470188-56470210 CAGGATCCGTGAGGATGGAGTGG + Intergenic
1121157633 14:91701485-91701507 AAGGATTTGGGTGGATAGAGCGG + Intronic
1121797926 14:96751025-96751047 AAGGTCCTAGCTGGATGGAGAGG + Intergenic
1122263087 14:100534284-100534306 CAGGATCTCAGTGCAGGGAGAGG + Intergenic
1122265245 14:100543695-100543717 CAGGGTACAGGTGGATGGACAGG - Intronic
1122570428 14:102695063-102695085 CAGTATCTAGGGGGAGGGAAGGG + Intronic
1122821730 14:104350054-104350076 CAGAATCTAGGTGGGTGGAAGGG - Intergenic
1125274813 15:37978922-37978944 CAGGACCAAGGTGGGTCGAGGGG + Intergenic
1126862723 15:52902694-52902716 CTGGAGCTTGGTGGAGGGAGGGG + Intergenic
1127323053 15:57866212-57866234 CAGGACATAGGTTAATGGAGTGG - Intergenic
1128222907 15:65981575-65981597 CAGGATCTAGGCTGTTGGAGAGG + Intronic
1129138178 15:73572997-73573019 CAGGTCCTAGGTGGCTGGAGAGG - Intronic
1130092566 15:80833300-80833322 CAATATCTCGGTGGGTGGAGGGG - Intronic
1131066520 15:89438321-89438343 CAGGATCTAGGTGTATGATGTGG - Intergenic
1131116809 15:89801056-89801078 CAGGAGCTAGGAGTATGGGGTGG + Intronic
1131147673 15:90024693-90024715 AAGGATGGAGGTGGAGGGAGAGG - Intronic
1132152246 15:99470745-99470767 CTGTATGTAGGTGGGTGGAGGGG - Intergenic
1134052497 16:11146550-11146572 AAGGATGGAGGTGGAGGGAGAGG + Intronic
1135957189 16:26965729-26965751 AGGGCTCTAGGTTGATGGAGAGG - Intergenic
1136375631 16:29863562-29863584 CAGGCTCTAGGCGGCTAGAGAGG + Exonic
1139178735 16:64720869-64720891 TAGGATCTAGGTTTTTGGAGAGG + Intergenic
1139292483 16:65871179-65871201 CAGGACCAAGGTGGCTGCAGAGG + Intergenic
1140514280 16:75530895-75530917 CAGGATCTGGGGGGATTGGGGGG + Exonic
1142267799 16:89072554-89072576 CAGGAGGTTGGTGGGTGGAGGGG - Intergenic
1143188371 17:5023929-5023951 CAGGAACTCCCTGGATGGAGGGG + Exonic
1144138028 17:12317958-12317980 CAGGGTCCAGCTGGATGCAGAGG + Intergenic
1145979269 17:29002255-29002277 CTGGAACTGGATGGATGGAGGGG + Intronic
1146138603 17:30345066-30345088 CAGCATCTAGGAGGAAGTAGTGG + Intergenic
1146517685 17:33502098-33502120 CAAGATCTAGGGGGAAGGGGTGG + Intronic
1147421585 17:40324522-40324544 CAGGTTCTAGGAGGAGGAAGTGG - Intronic
1147981158 17:44275049-44275071 GAGGAACCAAGTGGATGGAGAGG - Intergenic
1148917414 17:50993711-50993733 CAGCAGGTAGGTGGATGGAGGGG + Intronic
1152109263 17:78348265-78348287 CAGGGTCTGGGTGGACGGAATGG + Intergenic
1152110958 17:78357641-78357663 CTGTACCTGGGTGGATGGAGCGG - Exonic
1152218742 17:79049349-79049371 CAGGAGCTGGGTGGCAGGAGAGG + Exonic
1152533560 17:80937144-80937166 CAGGAGCTAAGCGGGTGGAGAGG + Intronic
1154069551 18:11141062-11141084 CAAGATGTAGGTGATTGGAGCGG - Intronic
1154101541 18:11479273-11479295 CTGGAGCTTGGTGGAGGGAGGGG - Intergenic
1155227095 18:23738218-23738240 GAGGATCTGGATGGAAGGAGAGG + Intronic
1155229527 18:23758956-23758978 TAGGATTGAGGAGGATGGAGAGG + Intronic
1156486796 18:37471544-37471566 CAGGATCTAGGTGGATGGAGGGG - Intronic
1157096241 18:44687861-44687883 CAGGTGCTATGGGGATGGAGAGG - Intronic
1158644641 18:59234850-59234872 CATGATATGGGTGGATTGAGAGG + Intergenic
1158853384 18:61517918-61517940 CTGGAGCTTGGTGGAGGGAGGGG + Intronic
1161507236 19:4650499-4650521 CAGGAAGGAGGTGGGTGGAGGGG + Intronic
1161576728 19:5058518-5058540 CATGTTCCAGGAGGATGGAGTGG + Intronic
1162179434 19:8857561-8857583 GAGGATCTTGCTGGATGCAGTGG - Intronic
1162649110 19:12072171-12072193 CAGGATTCAGCTGGATGCAGTGG - Intronic
1164491146 19:28715219-28715241 CAGGCTCCAGGTGGATCCAGAGG - Intergenic
1164700369 19:30280410-30280432 GAGGACCTAGGTGGATGGGAGGG - Intronic
1165472124 19:36009779-36009801 CAGGATCTAGGTGGCAGATGGGG + Intronic
1165803515 19:38566901-38566923 CTGTCCCTAGGTGGATGGAGTGG + Exonic
1166067131 19:40366505-40366527 CAGGAGGTAGGTGGATTGGGGGG + Exonic
1166129558 19:40737808-40737830 CGGGGTCCAGGTGCATGGAGGGG + Intronic
926611543 2:14952973-14952995 GAGGATGAAGGTAGATGGAGAGG + Intergenic
927277139 2:21271870-21271892 CAGGAACTTGGAGGATGGTGAGG - Intergenic
927961195 2:27241569-27241591 CAGGATTTAGCTGGCTGGGGAGG + Intronic
928328322 2:30337484-30337506 CAGGCTCAAGGTGGCTGCAGAGG + Intergenic
929604490 2:43225918-43225940 CAAGATCTTGCTGGACGGAGCGG + Intronic
931792003 2:65672007-65672029 AAGGTTCGAGGTTGATGGAGGGG + Intergenic
932547755 2:72732516-72732538 CACTATTTAGGTAGATGGAGGGG + Intronic
933081143 2:77988293-77988315 CTGGATGTAGGTGGTGGGAGAGG + Intergenic
935565701 2:104604959-104604981 GTGGATCTGGGTGGATGTAGTGG + Intergenic
937795521 2:126014095-126014117 CAGTATCCAGGAGGAAGGAGTGG - Intergenic
938255995 2:129860455-129860477 CAGGATCTAGTTGTATTGTGGGG + Intergenic
938658312 2:133458732-133458754 GAGGATCTGGGTGGCAGGAGGGG + Intronic
939965944 2:148610438-148610460 CAGGTTCAAGGGGGGTGGAGGGG + Intergenic
941115007 2:161462242-161462264 CTTGAGCTAGGTGGAGGGAGAGG - Intronic
941361590 2:164558132-164558154 GAGGATAAAGGTGAATGGAGGGG - Intronic
945680423 2:212906877-212906899 CAGGATCTGGGTGGCTGGTGGGG - Intergenic
946023723 2:216659396-216659418 CAAGATCTGGGTGGGTGCAGAGG - Intronic
948268210 2:236654142-236654164 CAGGATCAAGATGGATCCAGAGG - Intergenic
948573147 2:238930062-238930084 CAGGACCTGTGAGGATGGAGAGG + Intergenic
948584157 2:239008296-239008318 CCGGATGAAGGAGGATGGAGAGG - Intergenic
1171137279 20:22708129-22708151 TTGGCTCTAGGTGGATGCAGTGG + Intergenic
1171443650 20:25187387-25187409 CAGGAGATAGGTGGGAGGAGGGG + Intergenic
1172390300 20:34560974-34560996 CAGGATCTGGGGGGAGAGAGAGG + Exonic
1173021309 20:39269902-39269924 GAGGGGCTAGATGGATGGAGGGG - Intergenic
1173855562 20:46248294-46248316 CAGGATGTGGGTGGCTGGCGAGG + Intronic
1175328012 20:58142980-58143002 CTGGATCCATGTGGCTGGAGTGG + Intergenic
1175421428 20:58836782-58836804 CAGGCTCTGGGAGGAAGGAGTGG - Intergenic
1175653821 20:60751465-60751487 CAGGCTCTAGGTAGAGGAAGTGG + Intergenic
1175852162 20:62099415-62099437 GAGAATCTAGGAGGAAGGAGTGG - Intergenic
1176289230 21:5035445-5035467 CAGCAGTTAGGTGCATGGAGAGG + Intronic
1178294112 21:31394564-31394586 CAGGATGTTGGTGGTGGGAGAGG + Intronic
1178600885 21:33993383-33993405 AAAGATCTAGGTGGTAGGAGAGG + Intergenic
1179868005 21:44228159-44228181 CAGCAGTTAGGTGCATGGAGAGG - Intronic
1181982512 22:26775478-26775500 CAGGAGCAAGGGGGATGGTGGGG + Intergenic
1184975467 22:48058517-48058539 AAGGATCAAGGGGGAAGGAGTGG + Intergenic
1185221199 22:49630026-49630048 CAGAATCTAAGGGGTTGGAGAGG - Intronic
949846097 3:8372203-8372225 CAGGAGCTTGGTGGGGGGAGGGG + Intergenic
949985327 3:9536379-9536401 CAGCATCTAGGTTGTTGGATGGG - Intronic
950428578 3:12938037-12938059 CAGGAGCAAGGTGCAGGGAGTGG - Intronic
950969757 3:17174558-17174580 CAGGTTCTAGGGGAATGGTGAGG - Intronic
952391911 3:32887793-32887815 CAGGATACATGTGTATGGAGAGG - Intronic
953454882 3:43033250-43033272 CACGATCTACGTGGAAGGACAGG - Exonic
953522861 3:43659486-43659508 CAGGAGCTTGGTGGGGGGAGGGG + Intronic
953703425 3:45213727-45213749 CAGACTCTAGGTGGTGGGAGAGG + Intergenic
953925759 3:46981680-46981702 CAGGCTCTAGGTGCATGGGCAGG + Intronic
954009579 3:47623908-47623930 CAGGAACTTGGTGGGGGGAGCGG + Intronic
954701896 3:52454945-52454967 GAAGGTGTAGGTGGATGGAGGGG - Intergenic
955621073 3:60864548-60864570 CAGGAAGAAGGTGGATGGTGTGG + Intronic
957011228 3:75008410-75008432 CTGGAGCTTGGTGGAGGGAGGGG - Intergenic
958434517 3:94080745-94080767 CTGGAGCTTGGTGGAGGGAGGGG - Intronic
961572914 3:127813295-127813317 CAGGAGATAGGTGGGAGGAGGGG - Intronic
962409592 3:135129454-135129476 CTTGCTGTAGGTGGATGGAGGGG - Intronic
963057680 3:141200750-141200772 AAGGGTATAGGTGGATGGATTGG + Intergenic
963516081 3:146309872-146309894 CAGGGTCTGGGTGCAGGGAGAGG - Intergenic
963723236 3:148888410-148888432 CAAGATCTATGTGGATGCTGGGG - Intronic
963727358 3:148937385-148937407 AGGGATCTGGGTGGGTGGAGTGG - Intergenic
964003765 3:151807047-151807069 CAGAAGCTGGGTGGTTGGAGAGG - Intergenic
964680394 3:159331606-159331628 GAGGAAGTAGGGGGATGGAGAGG - Intronic
965017409 3:163175016-163175038 CTGGAGCTTGGTGGAGGGAGGGG + Intergenic
965861342 3:173154536-173154558 CAGAATCTTTGTGGATGGGGTGG + Intergenic
969560098 4:7941355-7941377 GAGCAGCTAGGTGGATGGAGGGG - Intergenic
970705258 4:18793965-18793987 TGGGTTCTAGGTGGATGGTGAGG + Intergenic
972942525 4:44214269-44214291 AAGGAGCTAGGAGGATAGAGGGG + Intronic
976359489 4:84160881-84160903 CAGGTTCAAGGTGTAAGGAGGGG - Intergenic
977665758 4:99645597-99645619 CAGCATCTAAGTGGATGGGCAGG + Intronic
978984731 4:114997833-114997855 CAGGATTTTGATGGTTGGAGTGG - Intronic
980979161 4:139639282-139639304 CAGGAGCTAGGAGGATAGTGGGG - Intergenic
980994319 4:139765872-139765894 CAGGTACTAGGTGGCTGAAGTGG + Intronic
982238705 4:153277155-153277177 CAGGTTCTAGGAGGCTGGTGAGG - Intronic
983539207 4:168890372-168890394 CAGGATATAAGGGGATGGAAGGG + Intronic
985524983 5:397151-397173 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525006 5:397247-397269 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525050 5:397420-397442 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525091 5:397591-397613 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525158 5:397877-397899 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525176 5:397954-397976 CAGGAGCTATGTGGATGGTCAGG - Intronic
985525189 5:398011-398033 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525197 5:398050-398072 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525205 5:398088-398110 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525208 5:398107-398129 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525221 5:398165-398187 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525224 5:398184-398206 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525227 5:398203-398225 CAGGAGCTACGTGGATGGTCAGG - Intronic
985525235 5:398242-398264 CAGGAGCTACGTGGATGGTCAGG - Intronic
985986446 5:3520629-3520651 CAGGAGCTAGGAAGGTGGAGAGG - Intergenic
986447274 5:7832339-7832361 CAGGATCTGGGTGGTGGGAAGGG - Intronic
988691497 5:33576943-33576965 CTGGATGTAGGTGGAGGGACGGG + Exonic
989825344 5:45848100-45848122 CTGGAGCTAGGTGGGGGGAGGGG + Intergenic
992069606 5:73136704-73136726 CAGAACCCAGCTGGATGGAGAGG + Intergenic
996750414 5:126883000-126883022 CAGGAAGTAGCTGGATGGAAGGG + Intronic
997962535 5:138333354-138333376 CAGGATCTTGGTGGTGGTAGTGG + Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998495085 5:142581678-142581700 CAGGATATGGGGGGTTGGAGAGG - Intergenic
998770359 5:145536853-145536875 AAGGGTGTAGGTGCATGGAGGGG + Intronic
1001288263 5:170439028-170439050 TAGGATCTAAGTTGATAGAGAGG - Intronic
1001584572 5:172824896-172824918 CATAATCTAGGTGGTTAGAGGGG + Intergenic
1001705069 5:173735602-173735624 CAGGACATGGATGGATGGAGAGG + Intergenic
1003184881 6:3822000-3822022 CAGCATCCAGGAGGATGGGGAGG + Intergenic
1004750963 6:18561347-18561369 CAGAATCTAGCTGGGTGGTGTGG + Intergenic
1005228789 6:23674619-23674641 GAGGATCCAGTTGGATGGAGAGG - Intergenic
1006780869 6:36631524-36631546 CTGGAGCCAGGTGGACGGAGGGG + Intergenic
1007114026 6:39330589-39330611 CAGGAGCTGAGTGAATGGAGAGG + Exonic
1008523102 6:52381230-52381252 CAGGAACTAGGTGGGGGAAGAGG + Intronic
1010167445 6:72933620-72933642 CAAGATTTAGGTTTATGGAGTGG - Intronic
1010829043 6:80508581-80508603 TAGGATTTAGGTAGGTGGAGAGG - Intergenic
1013431943 6:110063451-110063473 CAGGCTCCAGGGGGATGGGGTGG + Intergenic
1015466701 6:133556304-133556326 CAGAGGCTAGGTGGATGGGGAGG - Intergenic
1019131520 6:169880572-169880594 CAGGAGCCAGGTGGATGCACTGG + Intergenic
1020002574 7:4764239-4764261 CTCTATCTAGGTGGAAGGAGGGG - Exonic
1023315910 7:38936190-38936212 CAGGATCTAGCTGGGTGCAGTGG - Intergenic
1024633876 7:51271000-51271022 GAGGATTTAGGTTGATGCAGAGG - Intronic
1028590479 7:92488160-92488182 CAGGATGTATGTGGATAAAGGGG + Intronic
1029848697 7:103440714-103440736 CCAGCTCTAGGTGGCTGGAGAGG + Intronic
1030132984 7:106218905-106218927 CAGTAACTTTGTGGATGGAGAGG + Intergenic
1030153421 7:106427895-106427917 CAGGCATTAGTTGGATGGAGTGG - Intergenic
1032163627 7:129528837-129528859 CAGGAGCTGGGTGGAAGAAGAGG + Intergenic
1034033009 7:147788751-147788773 CATCATCTTGGTGGATGCAGCGG + Intronic
1034659440 7:152756777-152756799 CATGATTTTGGTGCATGGAGGGG + Intergenic
1035352364 7:158255736-158255758 CAGGAGCTTGGTGCATGGGGTGG - Intronic
1036229535 8:6988051-6988073 CAGGGTCTAGTGGGATGGATGGG - Intergenic
1036231986 8:7007154-7007176 CAGGGTCTAGTGGGATGGATGGG - Intronic
1036643817 8:10600051-10600073 CAGGATGTGGGTGGATGCTGTGG - Intergenic
1037849007 8:22310695-22310717 CAGGAACTGGGAGAATGGAGGGG - Intronic
1038228704 8:25680874-25680896 CAGGAGCAATGAGGATGGAGAGG + Intergenic
1039373548 8:37011037-37011059 GAGGAACTAGGTGGGCGGAGAGG + Intergenic
1039911004 8:41826878-41826900 AAAGATTTAGATGGATGGAGGGG - Intronic
1040889809 8:52305625-52305647 CAGCATCTGGATGGATGGATTGG - Intronic
1041940833 8:63385822-63385844 CTGGACCTAGGCTGATGGAGTGG + Intergenic
1042091161 8:65161325-65161347 CAGGATCTGGGTTGTTGGAGAGG + Intergenic
1042323646 8:67504889-67504911 CAGGAGGGAGGAGGATGGAGAGG + Intronic
1044308865 8:90669347-90669369 CTGGAACTAGGTGGATGTTGAGG - Intronic
1045987298 8:108263473-108263495 GAGGATGAAGGAGGATGGAGAGG - Intronic
1046323905 8:112615177-112615199 CATGATCTAAGTGGAAGGAGAGG - Intronic
1047367224 8:124222656-124222678 CAGAATCTCAGTGGAAGGAGAGG - Intergenic
1049042470 8:140123158-140123180 CAGCAACAAGGTGGATGGTGTGG - Intronic
1049733788 8:144192619-144192641 CAGGATGGAGGTGGCAGGAGTGG + Intronic
1049803742 8:144529849-144529871 CAGGCTCTCGGTGGGTGGGGTGG - Exonic
1052569056 9:30198233-30198255 CACCTTGTAGGTGGATGGAGGGG + Intergenic
1055705915 9:79003730-79003752 CAGGAACTAGATGGATGAAGAGG - Intergenic
1056075226 9:83031542-83031564 CTGGAGCCAGGTGGATTGAGTGG - Intronic
1056841590 9:90002361-90002383 CAGGATCAAGGGGGCTGGAGAGG - Intergenic
1058017243 9:100048165-100048187 CAGGAGTTGGGTGGGTGGAGGGG + Intronic
1058915981 9:109566118-109566140 CAGGTTCTAGGAGGAGAGAGGGG + Intergenic
1059009949 9:110446273-110446295 CAGGAAGTAGTTGGAAGGAGAGG + Intronic
1059284531 9:113161406-113161428 CAGGATAGAGGTGGATGGAGTGG + Intronic
1062468324 9:136691279-136691301 GAGGACAGAGGTGGATGGAGAGG + Intergenic
1186436053 X:9544013-9544035 CAGGATCTAAGTGGGGGCAGGGG - Intronic
1186912624 X:14185197-14185219 CAGGAGCTGGGAGGAGGGAGAGG + Intergenic
1189010567 X:37042724-37042746 CAGGATCTGCGGGGGTGGAGGGG - Intergenic
1189012797 X:37063330-37063352 CAGGATCTACTGGGGTGGAGGGG - Intergenic
1189030239 X:37442353-37442375 CAGGATCTGTGGGGGTGGAGGGG + Intronic
1189037322 X:37506143-37506165 CAGGATCTGCGGGGGTGGAGGGG + Intronic
1190337833 X:49273323-49273345 CAGGGCCAAGGTGGGTGGAGAGG + Intronic
1190911728 X:54777349-54777371 CAGGCCCTAGGTGGATCCAGAGG - Intronic
1192174047 X:68874825-68874847 CAGCATCTTGGTGGGAGGAGAGG + Intergenic
1193217451 X:78880875-78880897 CAGGATCAAGGTGCAGGGGGAGG + Intergenic
1193334653 X:80274028-80274050 CTGGAGCTTGGTGGAGGGAGGGG + Intergenic
1195273703 X:103257626-103257648 CAGGATCTAGGAGGAAGAGGAGG - Intergenic
1195906362 X:109848526-109848548 CAGGTGGTTGGTGGATGGAGGGG - Intergenic
1196103890 X:111875693-111875715 CAGGAACTAGGAGAATGGGGAGG - Intronic
1196496462 X:116329500-116329522 CAGGCTCAAGATGGAGGGAGGGG - Intergenic
1196545717 X:116962418-116962440 CTGGAGCTTGGTGGAGGGAGGGG - Intergenic
1196656073 X:118218531-118218553 CAGAGTCTTGGTGGAAGGAGGGG - Intergenic
1201135336 Y:10986063-10986085 CAGGATGTAGTTTAATGGAGTGG - Intergenic
1201682702 Y:16666441-16666463 CAGGGTCTAGGAGGATGATGTGG - Intergenic