ID: 1156488542

View in Genome Browser
Species Human (GRCh38)
Location 18:37482379-37482401
Sequence GAGTCACTCTGCCTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156488542 Original CRISPR GAGTCACTCTGCCTGGATTC TGG Intronic
900617116 1:3570485-3570507 GAGGAGCTCTGCCTGGTTTCTGG - Intronic
901382025 1:8880767-8880789 GATTCACTCTCCCTTGATCCCGG - Intergenic
901944937 1:12694081-12694103 GAGCCACTGCGCCTGGCTTCAGG + Intergenic
903122987 1:21228347-21228369 GAGCCACTGTGCCTGGGTGCAGG + Intronic
903536158 1:24067744-24067766 GGGGCACTGTGCCTGGCTTCAGG + Intronic
903770773 1:25762981-25763003 GAGTCACTGTGCCTGGCCTAGGG - Intronic
904279415 1:29408447-29408469 GAGTCACTCTGACTGGAGACTGG + Intergenic
905214121 1:36394758-36394780 GAGTCACTCTGCCGCGATCTTGG - Intronic
905225175 1:36474011-36474033 GAGCCACTCTGCCTGGAGACAGG - Intronic
906728593 1:48062219-48062241 GAGTCAGAAGGCCTGGATTCTGG - Intergenic
908051519 1:60237340-60237362 TATTCAATCTGCCTGGATTATGG - Intergenic
908242206 1:62196874-62196896 GAGTCACTGCGCCTGGACTGGGG + Intronic
908262238 1:62348160-62348182 GAGCCACTGTGCCTGGCCTCAGG - Intergenic
910766634 1:90789030-90789052 GAGCCACTGTGCCTGGCCTCAGG - Intergenic
911082490 1:93947111-93947133 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
912380507 1:109245552-109245574 GAGCCACTGTGCCTGGTGTCTGG - Intergenic
913332562 1:117679564-117679586 GAGTCCCAATGCCTGGATTCTGG + Intergenic
915038208 1:152946404-152946426 GAGTCACAGTGACTGGATTCTGG - Intergenic
919241139 1:194917926-194917948 TAGTCACTGTGCCTTCATTCTGG - Intergenic
919899593 1:202034308-202034330 GAGTCAGCCTGCCTGGGTTAAGG + Intergenic
924250188 1:242125068-242125090 GAGTCAGACTGCCTGGATTGAGG + Intronic
924727649 1:246685025-246685047 GACTCAGTCTGCCTGCATCCAGG + Intergenic
1063412099 10:5844328-5844350 GAGCCACTGTGCCTGGTTTCAGG - Intergenic
1063535353 10:6877479-6877501 GAGACAAACTGCCTGCATTCTGG - Intergenic
1063597591 10:7450993-7451015 GAGTCACCATGCCTGGCCTCAGG + Intergenic
1064938402 10:20706006-20706028 GAGCCACTGCGCCTGGACTCAGG - Intergenic
1065353686 10:24818387-24818409 GAGCCACCCTGCCCAGATTCAGG + Intergenic
1066350422 10:34631995-34632017 GAGCCACTCTGCCTGGCCTCAGG - Intronic
1066417125 10:35231878-35231900 GAGCCACTGTGCCTGGCCTCTGG - Intergenic
1066610807 10:37246934-37246956 GAGCCACTGTGCCTGGGCTCTGG - Intronic
1066663537 10:37760037-37760059 GAGTCCCAATCCCTGGATTCTGG + Intergenic
1068591769 10:58860240-58860262 TTATCAGTCTGCCTGGATTCTGG - Intergenic
1069569328 10:69484917-69484939 GAGTCACTCTTCCTGCCCTCCGG + Intronic
1069808930 10:71144279-71144301 GAGTCCCTCTGCCTGTGTTTGGG - Intergenic
1070379078 10:75863485-75863507 GAGCCACACTACCTGGACTCAGG + Intronic
1070597127 10:77840416-77840438 GAGCCACTGTGCCTGGCCTCTGG - Intronic
1077326714 11:1967126-1967148 CAGGCACCCTGCCTGGCTTCAGG + Intronic
1077468441 11:2745282-2745304 GAGTCTCTCTGCATTGAGTCAGG + Intronic
1077606949 11:3618652-3618674 GAGTCACTGTGCCTGGCCTAAGG - Intergenic
1080550443 11:33369767-33369789 GAGCCACTGTGCCTGGCTTTAGG + Intergenic
1080620297 11:33981675-33981697 GAGCCACTGTGCCTGGCCTCAGG - Intergenic
1081440093 11:43071310-43071332 GACTCAGTCTGCCTGCACTCAGG - Intergenic
1081883340 11:46473069-46473091 AAGTCAGTCTGCCTGCCTTCAGG + Intronic
1083147278 11:60768844-60768866 AAGTCACTGTGCCTCGGTTCTGG - Intronic
1083364330 11:62132405-62132427 GAGTCACACTGCCTGGGGACGGG + Intronic
1083603867 11:63965383-63965405 GAAGGACTGTGCCTGGATTCTGG + Intergenic
1083761599 11:64821740-64821762 GAGTCAGGCAGCCTGGATTCTGG - Intergenic
1084594257 11:70107709-70107731 GAGTCTGTCTGCCTGGAACCTGG - Intronic
1084636049 11:70393439-70393461 GAGTCACTGTGCCTGGCCTTTGG + Intergenic
1084764231 11:71297519-71297541 GAGCCACTGCGCCTGGCTTCAGG + Intergenic
1085238195 11:75031400-75031422 GAGTCACTCTGACTGGAGTATGG - Intergenic
1088847950 11:113683346-113683368 GACTCAGTCTCCCTGGATTTTGG - Intergenic
1089686063 11:120147521-120147543 GGGTCACTCAGCCTGGACTGGGG - Intronic
1202809695 11_KI270721v1_random:22306-22328 CAGGCACCCTGCCTGGCTTCAGG + Intergenic
1092996304 12:13954030-13954052 GAGTCAGGCTGCCTGAGTTCTGG + Intronic
1093105978 12:15087636-15087658 GAGTCTCTCTGCCTCTACTCTGG - Intergenic
1095223314 12:39645884-39645906 GAGCCACTATGCCTGGCTTGAGG + Intronic
1095589101 12:43883850-43883872 GAGCCACTATGCCTGGCTACAGG - Intronic
1096556273 12:52406041-52406063 GAGGTACCCTGCCTGGCTTCGGG - Exonic
1098309894 12:69138190-69138212 GAGTCACCGTGCCTGGTCTCAGG + Intergenic
1099403970 12:82237083-82237105 GAGTCACCCTGCTTGGCTTTAGG - Intronic
1099802259 12:87472123-87472145 GAGTCACTCTGCACCTATTCTGG + Intergenic
1101137732 12:101762934-101762956 GAGCCACTGTGCCTGGCCTCTGG - Intronic
1101975462 12:109354316-109354338 GAGCCACTGTGCCTGGCTTCAGG - Intronic
1103063362 12:117876377-117876399 GGGTCCCTCTGCCTGGCCTCAGG - Intronic
1104015902 12:124962056-124962078 GTGGCACTGTGCCTGGCTTCAGG - Intronic
1104390544 12:128387890-128387912 GAGTCGCCCTGCCTGGCTCCAGG + Intronic
1104994290 12:132644435-132644457 GAGCCACTATGCCTGGCCTCTGG + Intronic
1105501533 13:20977109-20977131 GAGCCACTGTGCCTGGCCTCGGG - Intronic
1105760141 13:23506672-23506694 GAGGCGCTGTGCCTGGCTTCAGG + Intergenic
1106811646 13:33364179-33364201 GAGTCACTGTGCCTGGCTGAGGG - Intergenic
1106852702 13:33812324-33812346 AAATCTCTCTGCCTGGACTCAGG - Intergenic
1107610296 13:42106290-42106312 GAGCCACTGTGCCTGGCCTCAGG + Intronic
1108159381 13:47622102-47622124 GAGTGAGTCAGCCTGGTTTCAGG - Intergenic
1108529914 13:51319195-51319217 CAGTGACTATCCCTGGATTCTGG - Intergenic
1111353575 13:87065710-87065732 GAGTCACAATGCCCGGATTTAGG + Intergenic
1113992348 14:16037601-16037623 GAGCCACTGCGCCTGGACTCCGG + Intergenic
1114738594 14:25069754-25069776 GAGCCACTATGCCTGGCTTATGG + Intergenic
1115019699 14:28661276-28661298 TAGACACTGTCCCTGGATTCTGG - Intergenic
1115247386 14:31310072-31310094 GAGTCATTCTTACTGGCTTCAGG - Intronic
1117233928 14:53751941-53751963 GAGCCACACTGCCTGGGTTTGGG - Intergenic
1117481993 14:56155866-56155888 GAGCCACTGTGCCTGGCTTCAGG + Intronic
1118214023 14:63791247-63791269 GAATCACTCTGGCTGGACACTGG - Intergenic
1118570824 14:67194076-67194098 GAGTCACTGTGCCTGGCCTTAGG - Intronic
1119394889 14:74318997-74319019 GAGCCACTGTGCCTGGTCTCGGG + Intronic
1120357889 14:83457832-83457854 CATTCTCTCTGCCTGGAATCAGG - Intergenic
1122028103 14:98892343-98892365 GAGTCCCCCTGCCAGGCTTCAGG + Intergenic
1123094517 14:105760579-105760601 GTGTGACTCTGCCTGGGGTCAGG + Intergenic
1124011941 15:25845791-25845813 GAGACATTCTGCATGGATTCCGG - Intronic
1124841866 15:33249618-33249640 GAATCATTCTGCCAGGATTGGGG - Intergenic
1127671612 15:61200194-61200216 GAGTCATTCTGCTTCGTTTCTGG + Intronic
1128236335 15:66070108-66070130 AAGTCACTCTGTCTGGGCTCTGG + Intronic
1128551149 15:68598828-68598850 GAGTCACTCTTCCAGGCCTCAGG - Intronic
1130549039 15:84878021-84878043 GAGCCACTGTGCCTGGCCTCTGG - Intergenic
1130576907 15:85101181-85101203 GTGTCAGTCCTCCTGGATTCAGG - Intronic
1132435336 15:101796419-101796441 GAGCCACTGTGCCCGGATTGGGG + Intergenic
1132767279 16:1540893-1540915 CAGACACTCAGCCTGGAGTCAGG - Intronic
1134422173 16:14103931-14103953 GAGAAACTCTGCCTGGTTTCTGG + Intronic
1134694061 16:16210013-16210035 GAGCCACTGTGCCTGGCCTCAGG + Intronic
1134977777 16:18584629-18584651 GAGCCACTGTGCCTGGCCTCAGG - Intergenic
1135689471 16:24524485-24524507 GAGCCACTGTGCCTGGTCTCTGG + Intergenic
1137421708 16:48340673-48340695 GAGCCACTGTGCCTGGTTTCAGG - Intronic
1137578277 16:49618140-49618162 GAGTCACACTGGCTGAGTTCAGG + Intronic
1138107440 16:54296229-54296251 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
1139325918 16:66152473-66152495 CAGTCCTTCTGCCTGGGTTCTGG - Intergenic
1139369529 16:66458240-66458262 CAGTCATTCTGTCTGGGTTCAGG - Intronic
1139556465 16:67714193-67714215 GAGTGACCCTGCCTGGCCTCTGG - Intronic
1139832812 16:69813753-69813775 GAGCCACTGTGCCTGGCCTCTGG + Intronic
1141030984 16:80588555-80588577 CTTTCTCTCTGCCTGGATTCTGG - Intergenic
1141424497 16:83936206-83936228 GGGTCAGCCTGCCTGGGTTCGGG - Intronic
1143047407 17:4093064-4093086 GAGTCATTCAGGCTGGAATCAGG + Intronic
1146475095 17:33156406-33156428 GAGTCACCATGCCTGGCTTAGGG + Intronic
1146795888 17:35780548-35780570 GAGCCACTGTGCCTGGTTTAGGG - Intronic
1147263042 17:39219855-39219877 AAGTCCCTCTGCCTGGAGCCAGG - Intronic
1148824731 17:50384188-50384210 GAGTCATTTGGCCTGCATTCAGG - Intronic
1150424188 17:65064332-65064354 GAGTCACTGTGCCTGGCCTAAGG + Intergenic
1151700065 17:75738014-75738036 GAGTCCAGCTGTCTGGATTCTGG + Intronic
1152428633 17:80234287-80234309 GAGCCACTTTGCCTGGCCTCAGG + Intronic
1153913657 18:9726098-9726120 CAGTCACACTGCCTGGCTTAGGG - Intronic
1153961556 18:10144311-10144333 GGGTCATTATGTCTGGATTCAGG + Intergenic
1155265146 18:24084947-24084969 GAGCCACTGTGCCTGGCCTCAGG + Intronic
1156488542 18:37482379-37482401 GAGTCACTCTGCCTGGATTCTGG + Intronic
1156623680 18:38883310-38883332 GAGTCACTTTGCCAGAAGTCTGG + Intergenic
1158881607 18:61784275-61784297 GAGTTAGTCTGACTGGGTTCAGG - Intergenic
1159722083 18:71903679-71903701 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
1159779206 18:72642043-72642065 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
1160257964 18:77263662-77263684 TACTCTCTCTGCCTGGATCCTGG + Intronic
1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG + Intronic
1161670889 19:5608641-5608663 GGCCCACTCTGCCTGGAATCAGG + Intronic
1162364575 19:10240592-10240614 GAACCACTCTGCCTGGCCTCCGG + Intergenic
1162999651 19:14358709-14358731 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
1164256335 19:23531519-23531541 GAGTCACATTACCTGGATGCTGG + Intronic
1164497124 19:28776715-28776737 GAGCCACTGTGCCTGGCTACTGG - Intergenic
1164553540 19:29232532-29232554 TACTCACTCTACCTGGATTGGGG - Intergenic
1165271302 19:34710118-34710140 GAGTCACTGTGCCTGGCCTCTGG - Intergenic
1165432271 19:35779711-35779733 GAGCCACTGTGCCTGGCCTCTGG + Intronic
1166655525 19:44608731-44608753 GAGCCACTGTGCCTGGCCTCCGG - Intergenic
1166700854 19:44880748-44880770 GAGTCACTGTGCCTGGCCCCTGG + Intronic
1167288068 19:48610036-48610058 GAGGCCCACTGCATGGATTCAGG + Intronic
1167618747 19:50549888-50549910 CAGGGACTCTGCCTGGGTTCTGG + Intronic
1167629882 19:50619301-50619323 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
1168570687 19:57466499-57466521 GAGCCACACTGCCTGGAGTTGGG + Intronic
925504402 2:4544644-4544666 CAGTGACTCTGCCTTGATGCTGG - Intergenic
925686173 2:6476189-6476211 TAGTCTCTCTTCCTGGATGCAGG + Intergenic
927774117 2:25888762-25888784 GAGCAGCTCTTCCTGGATTCTGG - Intergenic
929263687 2:39894933-39894955 GAGACAGATTGCCTGGATTCAGG + Intergenic
929576594 2:43056300-43056322 AAGTCATTCGGCCTGGACTCTGG - Intergenic
930810163 2:55531823-55531845 GAGTCACTCTCCTGGGATTGGGG + Intronic
932599746 2:73115257-73115279 GAGCCACTCCGCCTGGCTTGAGG - Intronic
933542614 2:83666731-83666753 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
934749939 2:96787571-96787593 GAGTCACCATGCCTGGCTTATGG - Intronic
935874839 2:107495028-107495050 GCTTCACTCTGCCTTGACTCTGG - Intergenic
936249632 2:110858008-110858030 GAGCCACTGTGCCTGGATGCTGG + Intronic
936443489 2:112576843-112576865 GAGCCACTGTGCCTGGCCTCCGG + Exonic
936444634 2:112586050-112586072 CAGTCCCGCTGCCAGGATTCCGG - Exonic
937097152 2:119242826-119242848 GAGCCAGTCCGCCTGGATTCTGG - Intronic
937413851 2:121698919-121698941 GAGTCACTGTGCCTGGACCCAGG - Intergenic
937496805 2:122429166-122429188 GAGCCACCCTGGCTGAATTCAGG + Intergenic
938405770 2:131032348-131032370 GAGTCACTCTGACTCGCTCCAGG + Intronic
938969159 2:136416421-136416443 GAGCCACCGTGCCTGGCTTCAGG + Intergenic
940445659 2:153773187-153773209 CAGTGACTCTGCCTAGTTTCAGG - Intergenic
941754865 2:169174089-169174111 GTGTCACACTGCCAGGATTCTGG + Exonic
943945682 2:194060338-194060360 GAGTCACTCTGCCTGACTCCCGG - Intergenic
944086610 2:195855004-195855026 GAATCAGGCTGCCTGGGTTCAGG + Intronic
944749069 2:202689631-202689653 GAGTCACTGTGCCTGGCCTCAGG - Intronic
945081896 2:206094291-206094313 GAGCCACTGTGCCTGGCTTGTGG - Intergenic
945358168 2:208862978-208863000 AACTCACTCTGTGTGGATTCAGG - Intergenic
945518388 2:210792053-210792075 GAGTCACTCTGCATAGTTTGAGG - Intergenic
946103829 2:217351970-217351992 GTCTCCCTCTGCCAGGATTCAGG + Intronic
946313291 2:218894696-218894718 GAGACTCACTGTCTGGATTCTGG + Intronic
946931944 2:224679557-224679579 GAGTCACTGTGCCTGGCCCCAGG - Intergenic
947598561 2:231430048-231430070 GAGTCAGTCTGCCTGCACCCAGG - Intergenic
948057664 2:235020895-235020917 GGGACACTCTGCCTAGAGTCTGG - Intronic
1169149245 20:3276324-3276346 GAGTGACACTGCCTTGCTTCTGG - Intronic
1169436419 20:5596120-5596142 AAGCCACTATGCCTGGGTTCTGG - Intronic
1171868299 20:30506497-30506519 GAGCCACTACGCCTGGACTCCGG - Intergenic
1174262664 20:49307954-49307976 GAGACACTGTGCCTGGATGGTGG + Intergenic
1176249347 20:64112867-64112889 GTGTCACTGTGCCTGGCCTCAGG + Intergenic
1176551755 21:8226014-8226036 GAGCCACTGCGCCTGGACTCCGG + Intergenic
1176570664 21:8409013-8409035 GAGCCACTGCGCCTGGACTCCGG + Intergenic
1176578573 21:8453180-8453202 GAGCCACTGCGCCTGGACTCCGG + Intergenic
1177166309 21:17608767-17608789 GAGTCCCACTGCCTGGACACAGG - Intronic
1178310765 21:31528228-31528250 GAGCCACTGTGCCTGGCTTTGGG - Intronic
1178673446 21:34612382-34612404 TAGTCCCTCTGCCGGGATGCCGG + Intronic
1180314923 22:11269916-11269938 GAGCCACTGCGCCTGGACTCCGG - Intergenic
1180688358 22:17688239-17688261 GAGTCACTGTGCTCGGCTTCTGG + Intronic
1181109891 22:20595935-20595957 GAGCCACTGTGCCTGGTTTATGG + Intergenic
1181543515 22:23587468-23587490 GGGTCCCTCTGCCTGGATGATGG - Intergenic
1181887545 22:26033298-26033320 GAGTCACCCTGCCTTTCTTCAGG + Intergenic
1182248612 22:28981472-28981494 GTGTCACTATGCCTGGTTTAGGG + Intronic
1182693173 22:32177532-32177554 TAGTAACTCAGCCTGGATTCAGG - Intergenic
1183310449 22:37106836-37106858 GAGTCCCCCTGCCTGGACTGTGG + Intronic
1183413399 22:37668631-37668653 GAGTCACTTTTCCTGGCTTTGGG + Intergenic
1183522728 22:38304837-38304859 GAGCCACTGTGCCTGGCCTCGGG - Intronic
1183808700 22:40236006-40236028 GAATCTCTCTGCCTTGCTTCTGG - Intronic
1183853502 22:40612661-40612683 GAGTCACTGTGCCTGGCTTATGG - Intronic
1184176099 22:42789994-42790016 GAGCCACTGTGCCTGTAATCAGG - Intergenic
1184831478 22:46991582-46991604 TAGTCACTTTGCCTGGATTACGG + Intronic
1185148131 22:49150214-49150236 CAGCCACTCTGGCTGGAGTCTGG + Intergenic
1203256774 22_KI270733v1_random:142934-142956 GAGCCACTGCGCCTGGACTCCGG + Intergenic
949688656 3:6608561-6608583 GAGTCACTGTGCGTGGCCTCTGG + Intergenic
949887647 3:8709191-8709213 GAGTCATCCTGCCTGGATTTTGG - Intronic
950700504 3:14742437-14742459 CAGTGGCTCTGACTGGATTCTGG - Intronic
955810235 3:62780155-62780177 GAGCCACTGTGCCTGGCCTCAGG + Intronic
956100568 3:65763784-65763806 GAGCCACTGTGCCTGGCCTCAGG - Intronic
956790014 3:72673162-72673184 GAGCCAAACTGCCTGGGTTCAGG - Intergenic
957394592 3:79621353-79621375 GACTCAGTCTGCCTGCATCCAGG + Intronic
958036001 3:88171246-88171268 GAGTCAACTTGACTGGATTCAGG + Intergenic
960140045 3:114142903-114142925 GTGTCACTCTGCCTGCAATGGGG - Intronic
960501429 3:118443590-118443612 GGGTCACTGAGCCTGGCTTCTGG + Intergenic
960953773 3:123016864-123016886 GAGCCACTGTGCCTGGCCTCAGG + Intronic
961107527 3:124254880-124254902 GAGTCAAACAGCCTGGATGCTGG - Intronic
961461308 3:127052090-127052112 GTGCCACTCTGTCTGGAATCAGG + Intergenic
967201434 3:187075766-187075788 AAGCCACACTGCCTGGCTTCCGG + Exonic
967260380 3:187635786-187635808 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
967988434 3:195113542-195113564 GGTTCACACTGCCTGGGTTCAGG - Intronic
969219524 4:5750843-5750865 GATTCACTATGCCTGCATACCGG + Intronic
970781715 4:19745545-19745567 GAGCCACTGTGCCTGGCCTCTGG + Intergenic
973934583 4:55830250-55830272 GAGTGACTCTCCCTTGGTTCTGG - Intergenic
974412247 4:61556547-61556569 GAGTCACTCTCCCTGCACTATGG + Intronic
974936924 4:68420014-68420036 AAGTCACTCTGCCTTCATTATGG + Intergenic
975226558 4:71879232-71879254 GAGTCACAGTGCCTGCAGTCAGG + Intergenic
976494817 4:85715583-85715605 GAGTCAAACTGCCTAGGTTCAGG - Intronic
977579367 4:98707196-98707218 GTGTCAATTTGACTGGATTCAGG - Intergenic
977706488 4:100076623-100076645 GAGCCACTGTGCCTGGACCCAGG + Intergenic
977916194 4:102596658-102596680 TAGTCACCCTGTCTAGATTCTGG + Intronic
979464226 4:121017800-121017822 GAGTCACTGAGCCTGGCCTCTGG + Intergenic
981578803 4:146231862-146231884 GACTCTCTCCTCCTGGATTCTGG + Intergenic
981698575 4:147583473-147583495 GAGTCACTGTGCCTGGCCTTGGG - Intergenic
983978695 4:173968287-173968309 GTGTCAGTCTGCCTCTATTCGGG + Intergenic
984103703 4:175517862-175517884 GTGTCAACCTGACTGGATTCAGG + Intergenic
988580431 5:32463981-32464003 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
988682033 5:33493021-33493043 GAGCCACTGTGCCTGGCTTGGGG - Intergenic
991321753 5:65381668-65381690 GAGCCACTATGCCTGGCCTCTGG + Intronic
992687000 5:79208891-79208913 GAGTCACTGTGCCTGGTCTCAGG - Intronic
994325527 5:98441248-98441270 GACTCAGTCTGCCTGCACTCAGG + Intergenic
996169386 5:120269855-120269877 GTGTCACTTTGGCTGGATTAAGG - Intergenic
996466642 5:123810321-123810343 GTGTCACTCTGCTTGGATGAGGG + Intergenic
996771642 5:127092803-127092825 GAGTCATACTGCCTGGAGTCAGG - Intergenic
997717035 5:136050046-136050068 GAGTCACTGTGCCTGGCCTATGG - Intronic
997740167 5:136246114-136246136 GTGTTACTCTGCCTGCTTTCTGG + Intronic
998268313 5:140683545-140683567 GAGCCACTGTGCCTGGCCTCAGG - Intronic
998285478 5:140856472-140856494 GAGTCAAGCAGTCTGGATTCAGG - Exonic
998527122 5:142852842-142852864 GTGTCGCTCTGCCTGCAGTCAGG + Intronic
998761783 5:145440204-145440226 GGGTCACTGTGGCTGGAATCTGG - Intergenic
999881190 5:155866303-155866325 GGGTGCCACTGCCTGGATTCAGG + Intergenic
1000218714 5:159190399-159190421 GAGTCACTGTGCCTGGCCCCAGG - Intronic
1003572885 6:7267576-7267598 GAGTCAGTCGGCCTGGAATTGGG - Intergenic
1004362444 6:14983276-14983298 GAGCCACTGTGCCTGGACTTTGG - Intergenic
1004702876 6:18095387-18095409 GAGCCACTGTGCCTGGACTATGG - Intergenic
1005026897 6:21471354-21471376 GAGCCACGGTGCCTGGATTGTGG + Intergenic
1005087033 6:22017526-22017548 GAATCAGGCTGCTTGGATTCTGG + Intergenic
1005477754 6:26225074-26225096 GAATCACTCTGATTGGATTGTGG - Intergenic
1005753864 6:28908330-28908352 GAGTCAGGCTGCCTGGGTTCTGG - Intronic
1006347326 6:33493388-33493410 GAGCCACTGCGCCTGGCTTCAGG - Intergenic
1006398814 6:33803983-33804005 GAGTCTCTCTGCTTGTCTTCTGG + Exonic
1006563842 6:34937168-34937190 GAGTCAGAATGCTTGGATTCTGG + Intronic
1008621122 6:53272419-53272441 GAGCCACTGTGCCTGGCTTGGGG + Intronic
1008649816 6:53550827-53550849 GAGTCACTGCGCCTGGCCTCAGG - Intronic
1009901592 6:69813562-69813584 GAGTCAATCAGTCAGGATTCTGG + Intergenic
1010013160 6:71073407-71073429 GAGCCAGGCTGCCTGGATTTAGG + Intergenic
1011291220 6:85779357-85779379 GAGTCACACTGCCTGGGGTTTGG + Intergenic
1012421338 6:99068933-99068955 GAGTCAGACTGCCTGGCTTCAGG - Intergenic
1013343673 6:109239020-109239042 GAGTCAGAATGCCTGGGTTCAGG - Intergenic
1015817148 6:137222103-137222125 GAGCCACTGTGTCTGGATTTAGG + Intergenic
1017007148 6:150036276-150036298 GAGTCATTCTGCCAGGCTTGGGG + Intergenic
1017725315 6:157272990-157273012 GTTTCACTGTGCATGGATTCAGG - Intergenic
1018686163 6:166306856-166306878 GAGACCCTCTGCCTGGAGGCGGG - Exonic
1018748025 6:166777475-166777497 GAGTGGCGCTGCCTGGGTTCTGG - Intronic
1019210448 6:170400620-170400642 GATCCCCTCTGCCTGGATGCTGG - Intronic
1019348238 7:540992-541014 GAGACAGCCTGCCTGGATCCAGG - Intergenic
1021612023 7:22466829-22466851 GAGCCAAACTGCCTGGGTTCAGG + Intronic
1021711397 7:23419565-23419587 GAGCCACTGTGCCTGGCCTCAGG - Intronic
1022077891 7:26991615-26991637 GAGCCACCATGCCTGGCTTCAGG - Intronic
1022369972 7:29761335-29761357 GAATCCCTCTGTCAGGATTCAGG - Intergenic
1023242036 7:38159226-38159248 GAGCCACTGTGCCTGGCCTCAGG - Intergenic
1023357792 7:39385098-39385120 TTGTCACTCTGCATGGATTTTGG - Intronic
1023952972 7:44862111-44862133 GAGTCACTGTGCCTGGCCTCTGG + Intergenic
1023953843 7:44870103-44870125 GAGTCAGAATGCTTGGATTCTGG + Intergenic
1025925172 7:65953079-65953101 GAGCCACTGTGCGTGGCTTCAGG + Intronic
1029611513 7:101629014-101629036 GAGCCACTGTGCCTGGCCTCTGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1032276788 7:130464162-130464184 TATTCACTCTGTCTGTATTCTGG + Intergenic
1032296898 7:130647319-130647341 GAGGCACTGTGCCTGGCCTCAGG + Intronic
1033099032 7:138455053-138455075 GAGCCACCGTGCCTGGCTTCAGG - Intergenic
1034931432 7:155166842-155166864 GAGTCACGCTGCCTGCGTCCTGG + Intergenic
1036177924 8:6556871-6556893 GAGGCACTGTGCCTGGCTTTAGG + Intronic
1037640893 8:20742172-20742194 GAGCCACACTGCCTGGACTTTGG - Intergenic
1037734732 8:21556825-21556847 GATCCACTCTGCCTGGCTTTGGG - Intergenic
1038794523 8:30697974-30697996 AAGCCACTGTGCCTGGCTTCTGG + Intronic
1039015152 8:33139503-33139525 GAGTCACTCTGAACTGATTCTGG + Intergenic
1039106818 8:33999052-33999074 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
1039192951 8:34997911-34997933 GAGCCACTGTGCCTGGCTTTGGG - Intergenic
1040358960 8:46646639-46646661 AAGTCACTCTACCTGGGTGCTGG - Intergenic
1042371665 8:67998483-67998505 GAGTCAACATACCTGGATTCAGG - Intronic
1042374409 8:68032658-68032680 GAGTCACACAGGCTGAATTCAGG + Intronic
1044717951 8:95118174-95118196 GAGTCTCACTGCATGGGTTCTGG + Intergenic
1047222133 8:122927208-122927230 GAGTCACTGTGCCTGGCCTGGGG - Intronic
1047739678 8:127796506-127796528 CAGGCACTCTGGCTGGATTCTGG + Intergenic
1048079345 8:131108229-131108251 GAGCCACTGTGCCTGGCCTCAGG + Intergenic
1048321918 8:133406662-133406684 GACACACCCTGCCTGGAGTCAGG + Intergenic
1048608209 8:135992087-135992109 GAGTCACTTATTCTGGATTCTGG - Intergenic
1048859678 8:138714796-138714818 GATACAGTCTGCCTGGACTCAGG + Intronic
1049229640 8:141475300-141475322 CAGTCACCGTGCCTGGCTTCGGG - Intergenic
1050403168 9:5278750-5278772 GAGTCACTCTGAATGTATTCTGG + Intergenic
1051642945 9:19240381-19240403 GAGCCACTGTGCCTGGTTCCCGG - Intronic
1052978426 9:34429387-34429409 GGGTAAGTCTGCCTGGATTGAGG - Intronic
1053217081 9:36280583-36280605 GACTCATTCTGCAGGGATTCTGG + Intronic
1053300405 9:36944984-36945006 GGCTCACTCTGCGTGGCTTCAGG - Intronic
1053512821 9:38703441-38703463 GAGTCATTCTGTCAGGATTTGGG - Intergenic
1054852052 9:69857308-69857330 GAGGCACTGTGCCAGGATGCAGG - Intronic
1056389481 9:86127398-86127420 TTGTCACTCTGCCTGGGTCCGGG - Intergenic
1056458425 9:86785864-86785886 GAGTGATTCTGCATGGTTTCAGG + Intergenic
1056507455 9:87270728-87270750 TAGTCACTCTGCGTGTAATCAGG - Intergenic
1057093384 9:92281416-92281438 GAGTCACCATGCCTGGCCTCTGG + Intronic
1059045395 9:110861286-110861308 GAGCCACCCTGCCCGAATTCTGG + Intergenic
1061121145 9:128643240-128643262 GAGCCACTGCGCCTGGCTTCTGG - Intronic
1061582074 9:131544386-131544408 GTGTGACCCAGCCTGGATTCTGG - Intergenic
1061785690 9:133026742-133026764 CACTTTCTCTGCCTGGATTCAGG - Intergenic
1203472934 Un_GL000220v1:124638-124660 GAGCCACTGCGCCTGGACTCCGG + Intergenic
1203363209 Un_KI270442v1:235801-235823 GAGCCACTGTGCCTGGACTCCGG - Intergenic
1188418684 X:29970499-29970521 GATTCTCTCTGCCTGGAATATGG + Intergenic
1189082632 X:37991170-37991192 CAGTCATTCTTCCTGGATTTGGG - Exonic
1189508460 X:41637236-41637258 AAGCCACTCTGCCTGGCCTCAGG + Intronic
1190254793 X:48754333-48754355 GAGTCACTCAGACTGGACTGTGG - Intergenic
1191611853 X:63124600-63124622 GAGCCACTTTGCCGGGGTTCTGG - Intergenic
1191667569 X:63719135-63719157 GAGTCTTTCTCCCTGGATTATGG - Intronic
1191799166 X:65058470-65058492 GTGTCAGTCTGCCTGTACTCGGG + Intergenic
1191886844 X:65897686-65897708 GTGTCACCTTGCCTGGATTAAGG + Intergenic
1192560655 X:72125896-72125918 GTCTCAACCTGCCTGGATTCTGG - Intergenic
1192700771 X:73469038-73469060 GAGTTACACTGCCTGGATTTGGG + Intergenic
1195011204 X:100733792-100733814 GAGCCACTGTGCCTGGCCTCTGG - Intergenic
1195722579 X:107880404-107880426 GAGTCACTGTGCCTAGCTTAGGG + Intronic
1197533093 X:127655051-127655073 GAGTCACTGTGCCTGGCCTATGG - Intergenic
1199583596 X:149386957-149386979 GAGCCACCATGCCTGGATTAGGG - Intergenic
1200259376 X:154604202-154604224 GAGTCATTCCACCTGGAATCTGG + Intergenic
1200862815 Y:8010891-8010913 GAGTCACACTACCTGGATACTGG + Intergenic
1200863079 Y:8013747-8013769 GAGTCACACTTACTGCATTCTGG + Intergenic
1200865770 Y:8041681-8041703 GAGTCACATTTCCTGGATGCTGG - Intergenic
1201694017 Y:16804466-16804488 GAGTCACTCTGAATCTATTCTGG + Intergenic