ID: 1156489047

View in Genome Browser
Species Human (GRCh38)
Location 18:37485649-37485671
Sequence AGGGCGCGTCGGCGGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156489047_1156489062 18 Left 1156489047 18:37485649-37485671 CCCCGGGCCCGCCGACGCGCCCT 0: 1
1: 0
2: 2
3: 8
4: 175
Right 1156489062 18:37485690-37485712 TCCCGCCCCTCCCTGCCGCTCGG 0: 1
1: 0
2: 4
3: 42
4: 336
1156489047_1156489053 -6 Left 1156489047 18:37485649-37485671 CCCCGGGCCCGCCGACGCGCCCT 0: 1
1: 0
2: 2
3: 8
4: 175
Right 1156489053 18:37485666-37485688 CGCCCTGCCGCCCGCCCTCCAGG 0: 1
1: 1
2: 6
3: 59
4: 538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156489047 Original CRISPR AGGGCGCGTCGGCGGGCCCG GGG (reversed) Intronic
900255068 1:1693567-1693589 CGGGCGCGCCTGCGGCCCCGAGG + Intronic
900263811 1:1746833-1746855 CGGGCGCGCCTGCGGCCCCGAGG + Intergenic
901506214 1:9687579-9687601 AGGGCGTGGGGGCGGGGCCGGGG + Intronic
903649527 1:24914362-24914384 AGGGTGGGGCGCCGGGCCCGAGG + Intronic
905847196 1:41242460-41242482 AGGGCGCGAGGGCGGGGACGAGG + Intergenic
906027091 1:42682799-42682821 TGGGCGAGCCGGCGGGCGCGCGG + Intronic
907010653 1:50959939-50959961 CGGGCGGGTCGGCGGGCCAGCGG + Exonic
915165614 1:153946347-153946369 AGGGCGAGCTGGCGGGCCGGCGG + Exonic
915552245 1:156642032-156642054 AGGGGGCGGGGGCGGCCCCGGGG + Exonic
1064443068 10:15370930-15370952 AGTGGGCGGCGGCGGGGCCGGGG - Intronic
1067071874 10:43138449-43138471 CAGGCGCGGCGGCGCGCCCGGGG + Intergenic
1067214731 10:44292938-44292960 AGGGGGCGTCGGGAGGGCCGCGG + Intronic
1067688269 10:48480967-48480989 AGGGCACCACAGCGGGCCCGTGG + Intronic
1067769903 10:49115554-49115576 CGGGCGCGAGCGCGGGCCCGGGG - Intergenic
1069698350 10:70404342-70404364 AGGCGGCGGCGGCGGGGCCGGGG - Intergenic
1071527419 10:86366525-86366547 AGGGCGCAGGGGCGGGCGCGCGG - Intergenic
1076297041 10:129394044-129394066 AGGGCGGGTCATCGGGGCCGTGG - Intergenic
1076306171 10:129467097-129467119 AGCGCGCGGGGGCGGGGCCGGGG - Intergenic
1076306202 10:129467189-129467211 GGGGCGCGGGGGCGGGGCCGAGG - Exonic
1076922260 10:133460102-133460124 AGTGCCCGTCGGCGGGCTGGGGG + Intergenic
1076986021 11:236454-236476 GGGGCGCGGAGGCGGGACCGGGG - Intronic
1077321967 11:1946773-1946795 AGGGCGGGTCCCCGGGCCTGGGG - Intergenic
1080551506 11:33376708-33376730 GGGGCGCGGGGGCCGGCCCGTGG + Intergenic
1083258114 11:61508875-61508897 AGGCCGGGGCGGGGGGCCCGGGG + Exonic
1083267868 11:61555287-61555309 GGGGGGCGACGGTGGGCCCGGGG - Intronic
1084086176 11:66856411-66856433 AGGGCGGGGCGGCGGGGGCGGGG + Intronic
1084410972 11:69005730-69005752 AGGCCGCGCCGGGGGCCCCGCGG + Exonic
1085295804 11:75431016-75431038 AGGGCGCCTTGGCCGCCCCGGGG + Intergenic
1089560297 11:119340217-119340239 CGGCCGCGACGGCGCGCCCGGGG - Exonic
1202804983 11_KI270721v1_random:2086-2108 AGGGCGGGTCCCCGGGCCTGGGG - Intergenic
1092108890 12:5945234-5945256 AGCGCGCGGCCGCGGGCCGGCGG - Exonic
1092172717 12:6383921-6383943 AGGGAAGGGCGGCGGGCCCGGGG - Intronic
1092256259 12:6928117-6928139 AGGGGGAGGCGGCGAGCCCGGGG + Intronic
1100869397 12:98894870-98894892 GGGGCGCGCGCGCGGGCCCGGGG - Intronic
1102453280 12:113056840-113056862 CGGGCGCGGAGGCGGGACCGCGG + Intronic
1102467019 12:113135832-113135854 AGGGCGCGCGAGGGGGCCCGGGG - Intronic
1109062318 13:57633746-57633768 CGGGGGCCTGGGCGGGCCCGGGG + Exonic
1113888668 13:113725166-113725188 GGGGCGCGTGGGAGGGCGCGAGG - Intronic
1118992664 14:70809808-70809830 AGGGAGCTGCGGCGGGCCAGTGG - Intergenic
1122108858 14:99481128-99481150 TGGGCGCGTAGGCGGGGCCCGGG - Intergenic
1122162301 14:99793310-99793332 CGGCGGCGGCGGCGGGCCCGGGG + Intronic
1122635378 14:103127269-103127291 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1124142288 15:27088250-27088272 CGGGCGCGGGGGCGGGCGCGGGG + Intronic
1124696686 15:31870092-31870114 CGCGCGCGTCGGGGGTCCCGCGG - Intronic
1128028745 15:64461030-64461052 AGGGGGCGTCGAGGGGCGCGGGG + Intronic
1128344142 15:66842852-66842874 AGGGCGCGGCTCCGGGCGCGGGG + Intergenic
1129387190 15:75202484-75202506 AGGGCGCGTCCAGGGCCCCGCGG - Intronic
1132552776 16:560249-560271 AGGGGGCGGCGGGGGGCGCGCGG + Intergenic
1132828892 16:1918131-1918153 AGGGCGCGGGGGCCGGCGCGGGG + Exonic
1134143578 16:11742646-11742668 AGGGGGCGGCGGCGGCCCCGCGG - Exonic
1135745829 16:25015369-25015391 AGGGCGGGGCCGCCGGCCCGGGG - Intronic
1139761451 16:69187444-69187466 AGGCGGCGCCGGCGGGCTCGGGG - Exonic
1142213093 16:88817661-88817683 AGGGCGCGTGAGAGGGTCCGGGG - Intronic
1142513153 17:410518-410540 AGGGCGGCGCCGCGGGCCCGCGG + Exonic
1143111423 17:4555060-4555082 AGGAAGCGGCGGCGGGCCCAGGG - Intronic
1144625693 17:16843426-16843448 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1144656882 17:17042590-17042612 AGGCCGCGTCCATGGGCCCGCGG + Intronic
1144764232 17:17724223-17724245 TGCGCGCGGCGGCGGGCCGGGGG - Intronic
1144880738 17:18429294-18429316 AGGGAGCCTCTGCGGGCCCCTGG - Intergenic
1145151497 17:20515093-20515115 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1145964158 17:28905054-28905076 TGGGTGCGTCTGCTGGCCCGGGG - Intergenic
1146162847 17:30569343-30569365 AGGGAGCCTCTGCGGGCCCCTGG + Intergenic
1146283404 17:31559383-31559405 AGGGGGCGGCGGCGGCCCCCAGG + Intergenic
1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG + Intronic
1153900869 18:9615286-9615308 CGGGAGCGTTGGCAGGCCCGGGG + Intergenic
1155654611 18:28178124-28178146 GGGGCGCTTCGGCGGGGCGGGGG - Intergenic
1156036607 18:32772102-32772124 CGGGCGGGCCGGCGGGCCGGCGG - Exonic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1158954153 18:62523573-62523595 AGGGCCCCGCGACGGGCCCGCGG - Exonic
1160404811 18:78638129-78638151 AGGGCGCCCCGGCCGGCCTGGGG + Intergenic
1160991770 19:1863137-1863159 AGGGCGCGGCGCCGGGGGCGCGG + Exonic
1161450703 19:4343856-4343878 AGGCGGCGGCGGCGGGGCCGGGG + Exonic
1161450715 19:4343880-4343902 GGGGGGCTGCGGCGGGCCCGGGG + Exonic
1167101610 19:47407315-47407337 AGGGCCCGCGGGCCGGCCCGGGG - Intronic
1167115014 19:47484043-47484065 AGGCGGCGCCGGCGGGCGCGGGG - Exonic
1167268251 19:48493883-48493905 CGGGCGCGGCGGCGGGGCCGCGG - Exonic
1167946732 19:52994104-52994126 AGGGGGCGTGGGAGGGCGCGGGG + Intergenic
1168247014 19:55117508-55117530 ATGGCCCGGCGGCTGGCCCGGGG - Exonic
1168276959 19:55284075-55284097 AGGGCGCGTGGGGGGGCGGGGGG + Intronic
1168293008 19:55366127-55366149 CGGGGGCGCCGGCGGGTCCGGGG + Exonic
924962626 2:47170-47192 AGCGGGCGTGGCCGGGCCCGAGG + Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
934079041 2:88452262-88452284 AGGGCCCGGCCGCGGCCCCGGGG + Exonic
936561416 2:113542245-113542267 AGGGCGCGGCGGCGGCGCGGCGG - Intergenic
938381037 2:130836844-130836866 AGGGCGCGGGGGCGGACCCTAGG + Intergenic
941934683 2:170973667-170973689 AGGGCCCCTGGGCGGGGCCGGGG + Intergenic
942460561 2:176165413-176165435 GCGGCGGGCCGGCGGGCCCGGGG + Intronic
946340224 2:219061390-219061412 AGGGCGCGTCGCCCGGGCCAGGG - Intergenic
947611981 2:231530309-231530331 AGGGCGCGGCAGCTGGGCCGGGG - Intronic
947774553 2:232697439-232697461 GGGACGCGGCGGCGGGGCCGGGG - Intronic
948467387 2:238158889-238158911 AGGGGGCGCGGGCGGGCGCGCGG + Intergenic
948646208 2:239406692-239406714 AGGGCGCATCTGCGGGGCCCAGG + Intergenic
949014594 2:241702222-241702244 CGGGCGCGACGGGGGGCGCGCGG + Intronic
1171035410 20:21709325-21709347 AGGCGGCCACGGCGGGCCCGGGG - Exonic
1171768250 20:29301654-29301676 TGAGCGCCTCTGCGGGCCCGAGG - Intergenic
1172409037 20:34709066-34709088 AGGGCGAGACGCCTGGCCCGTGG + Intronic
1175992536 20:62796814-62796836 AGGGCGCGTGGGAGGGGGCGGGG - Intronic
1176547255 21:8207333-8207355 TCGGCGCCTCTGCGGGCCCGAGG + Intergenic
1176549533 21:8215079-8215101 GGGTCGCGCCGTCGGGCCCGGGG + Intergenic
1176555160 21:8251542-8251564 TCGGCGCCTCTGCGGGCCCGAGG + Intergenic
1176557424 21:8259308-8259330 GGGTCGCGCCGTCGGGCCCGGGG + Intergenic
1176566206 21:8390380-8390402 TCGGCGCCTCTGCGGGCCCGAGG + Intergenic
1176568458 21:8398113-8398135 GGGTCGCGCCGTCGGGCCCGGGG + Intergenic
1176574080 21:8434566-8434588 TCGGCGCCTCTGCGGGCCCGAGG + Intergenic
1176576370 21:8442343-8442365 GGGTCGCGCCGTCGGGCCCGGGG + Intergenic
1178555708 21:33588496-33588518 AGGGCGGCTCGGCGGGCCGCCGG + Exonic
1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG + Exonic
1179629343 21:42666966-42666988 AGGGCGAGTCGGCGGTCACCAGG - Intronic
1180960687 22:19761049-19761071 CGGCGGCGGCGGCGGGCCCGGGG - Exonic
1181006666 22:20016785-20016807 AGGGCGGGAGGGCTGGCCCGGGG - Exonic
1181278169 22:21699911-21699933 AGGGCACCTCTGCGGGCCCCGGG + Exonic
1181313982 22:21960278-21960300 AGGGAGCCTCGGTGGGCCCTGGG + Intronic
1181381587 22:22508755-22508777 CGTGCGCGTCGGCGGCGCCGGGG - Exonic
1183535292 22:38397868-38397890 AGGGCGCGTCTAAGGGACCGCGG - Intronic
1184164858 22:42720990-42721012 AGGGCGCGCGGGCGGGGTCGCGG - Intronic
1185194048 22:49457266-49457288 AGGGGTCGTCGGCTGGCCGGGGG + Intronic
1185391299 22:50562810-50562832 AGGGCGCGTTGGGAGGGCCGGGG + Intronic
1203252128 22_KI270733v1_random:123618-123640 TCGGCGCCTCTGCGGGCCCGAGG + Intergenic
1203254420 22_KI270733v1_random:131401-131423 GGGTCGCGCCGTCGGGCCCGGGG + Intergenic
1203260182 22_KI270733v1_random:168701-168723 TCGGCGCCTCTGCGGGCCCGAGG + Intergenic
1203262476 22_KI270733v1_random:176480-176502 GGGTCGCGCCGTCGGGCCCGGGG + Intergenic
949866797 3:8553586-8553608 AGGGCCCGTCTGCTGGCCTGGGG - Intronic
949993782 3:9600849-9600871 GTGGCGCCACGGCGGGCCCGGGG + Intergenic
952744465 3:36764262-36764284 ATGGCGCGGCGGCGGGCTCGGGG + Intergenic
953705156 3:45225538-45225560 TGGGGGCGGCGGCGGGCCGGAGG + Exonic
954686584 3:52373319-52373341 GGGGCGCGACGGCGGGGCGGGGG + Intronic
960556267 3:119034473-119034495 AGGCCGGGTCGGCGGGCCCGGGG - Intronic
964478695 3:157120605-157120627 AGAGCGCGGCGGCGGGGCCCGGG - Intergenic
966794080 3:183697784-183697806 TGGGCGCGTCGGGGCGCGCGCGG - Intergenic
968514714 4:1011350-1011372 AGGGCGCGCGGGCGGGGCCGGGG + Intronic
968514848 4:1011714-1011736 GGGGCGAGTCCGCGGGGCCGGGG - Intronic
977941956 4:102868949-102868971 CGGGCGGGGCGGCGGGCCCTGGG - Intergenic
981315547 4:143336710-143336732 AGGGCGGGTGGGCGGGCGAGCGG + Intergenic
985628906 5:1004903-1004925 AGCGGGCGGCGGCGGGCGCGGGG - Intergenic
985642180 5:1068867-1068889 AGGGCGCGTCTGTGCGCACGAGG - Intronic
988609514 5:32711732-32711754 AGGGCGAGTCGGCGGCGGCGAGG + Exonic
994802754 5:104399765-104399787 AGGGCCTGTCGGGGGGCTCGGGG + Intergenic
1000071498 5:157744256-157744278 AGGGGGCGTCTGCGGGGCGGCGG + Intronic
1001824742 5:174735728-174735750 TGAGCGCGGCGGCCGGCCCGGGG - Intergenic
1002046226 5:176543174-176543196 AGGGGGCGGCCGCGGGCCGGCGG - Intronic
1004614958 6:17281079-17281101 GGGGCGCGGCGGCGGGGCCAGGG - Intergenic
1006806702 6:36793725-36793747 AGGGGCCTCCGGCGGGCCCGGGG - Intronic
1010032870 6:71288736-71288758 CGCGCGCGGCGGCGGTCCCGGGG + Intergenic
1010703303 6:79077772-79077794 AGGCGGCGGCGGCGGGGCCGCGG - Intronic
1016936363 6:149451501-149451523 AGGGCGCGACGTGAGGCCCGGGG + Intronic
1017103316 6:150866460-150866482 TCGGCGCGCCGGCTGGCCCGGGG + Intronic
1019287991 7:233182-233204 AGGACGCGTCGCCTGGCCCGGGG + Intronic
1019437120 7:1028085-1028107 AGCGCGGCTCGGCCGGCCCGGGG + Intronic
1020105714 7:5421389-5421411 TGCGCTCGGCGGCGGGCCCGCGG + Exonic
1022286346 7:28958311-28958333 GGTGCGCGTCGGCGGGCGGGAGG + Intergenic
1022989543 7:35694655-35694677 AGGGCACAACGGCCGGCCCGGGG + Exonic
1026009885 7:66628683-66628705 AGGGCGCGCCCGCTGGCCAGAGG + Intergenic
1026017586 7:66682812-66682834 AGGGCGAGGCTGCGGGGCCGGGG + Intronic
1026025632 7:66741366-66741388 AGGGCGAGGCTGCGGGGCCGGGG + Intronic
1031899231 7:127392069-127392091 AGGGCGGGCCGGCGGGCGGGCGG + Intronic
1034218012 7:149422565-149422587 AGGGCGCGCCGGCGGCCCACGGG - Intergenic
1034412158 7:150947373-150947395 AGCCCGGGTCGGCGGCCCCGGGG - Exonic
1036390299 8:8318870-8318892 CGGGGGCGGGGGCGGGCCCGGGG + Exonic
1037903760 8:22703450-22703472 AGGGTGGGTCGGGGTGCCCGGGG + Intergenic
1043388275 8:79768387-79768409 AGGGCGCGCCGGCGGGGGCTGGG + Intergenic
1045459207 8:102412141-102412163 CTGGCGGGTCGGCGGGCGCGGGG - Intronic
1048553904 8:135457367-135457389 AGGGCGGGGCGGCGGGCGCGGGG + Intergenic
1049762617 8:144337952-144337974 AGGTCGCGGGGGCGGCCCCGGGG + Intergenic
1049891270 9:73095-73117 AGGGCGCGGCGGCGGCGCGGCGG + Intergenic
1052362229 9:27573491-27573513 CGGGCCCGGGGGCGGGCCCGGGG - Intronic
1057208077 9:93184980-93185002 CGGGCGCGGCGCGGGGCCCGCGG + Exonic
1057488632 9:95506092-95506114 CGGCAGCGGCGGCGGGCCCGGGG + Intronic
1057619108 9:96619427-96619449 CGGGAGCCTCGGCGGGCGCGCGG - Exonic
1057801342 9:98192904-98192926 ACGGCGCGACGTGGGGCCCGCGG - Intergenic
1059305348 9:113349590-113349612 AGGGCGCGGAGCCGGGGCCGGGG + Exonic
1060087272 9:120714185-120714207 TGGACGCGTCGCCGGGCCCCGGG - Exonic
1060549347 9:124477759-124477781 GGGGCGCCTGGGCGGGCCTGTGG - Intronic
1061610039 9:131740024-131740046 GGGGAGCGGCGGCGGGCGCGCGG - Intronic
1061666018 9:132161527-132161549 GGGGCGTCCCGGCGGGCCCGTGG - Intergenic
1062084683 9:134642478-134642500 AGGGGGCGGCGGCGCGCCCGCGG - Intronic
1062240273 9:135533924-135533946 AGGGTGTGTCTGCGGCCCCGGGG - Intergenic
1062435748 9:136545942-136545964 CGGGCGCGGAGCCGGGCCCGGGG - Intergenic
1203792691 EBV:160165-160187 AGGGCGCGGTCCCGGGCCCGGGG - Intergenic
1203468531 Un_GL000220v1:106768-106790 TCGGCGCCTCTGCGGGCCCGAGG + Intergenic
1203470821 Un_GL000220v1:114545-114567 GGGTCGCGCCGTCGGGCCCGGGG + Intergenic
1203476352 Un_GL000220v1:150740-150762 TCGGCGCCTCTGCGGGCCCGAGG + Intergenic
1203478642 Un_GL000220v1:158517-158539 GGGTCGCGCCGTCGGGCCCGGGG + Intergenic
1185778875 X:2829027-2829049 TGGGCGCGGCGGGGGGCCGGGGG + Intronic
1187464483 X:19515258-19515280 AGGGCGCGCAGGCGGGCACATGG - Exonic
1187826147 X:23334640-23334662 AGGGCGCGGCCGCGGGCAGGAGG + Exonic
1195308376 X:103607918-103607940 AGGGCGGGCGGGCGGGCGCGGGG - Intronic