ID: 1156489838

View in Genome Browser
Species Human (GRCh38)
Location 18:37489549-37489571
Sequence TCCTCAACCCCTGTGAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 185}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156489838_1156489850 16 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489850 18:37489588-37489610 GAGGGTGTCCAGCTGAAAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 183
1156489838_1156489848 14 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489848 18:37489586-37489608 GTGAGGGTGTCCAGCTGAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 143
1156489838_1156489849 15 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489849 18:37489587-37489609 TGAGGGTGTCCAGCTGAAAGGGG 0: 1
1: 0
2: 1
3: 11
4: 154
1156489838_1156489847 13 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489847 18:37489585-37489607 TGTGAGGGTGTCCAGCTGAAAGG 0: 1
1: 0
2: 2
3: 11
4: 157
1156489838_1156489852 21 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489852 18:37489593-37489615 TGTCCAGCTGAAAGGGGGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 232
1156489838_1156489846 -2 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489846 18:37489570-37489592 GAGGGGGCTGTGGGCTGTGAGGG 0: 1
1: 1
2: 4
3: 106
4: 1424
1156489838_1156489855 25 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489855 18:37489597-37489619 CAGCTGAAAGGGGGGAAGGTGGG 0: 1
1: 0
2: 3
3: 32
4: 398
1156489838_1156489854 24 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489854 18:37489596-37489618 CCAGCTGAAAGGGGGGAAGGTGG 0: 1
1: 0
2: 1
3: 29
4: 436
1156489838_1156489845 -3 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489845 18:37489569-37489591 GGAGGGGGCTGTGGGCTGTGAGG 0: 1
1: 1
2: 22
3: 133
4: 1071
1156489838_1156489851 17 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489851 18:37489589-37489611 AGGGTGTCCAGCTGAAAGGGGGG 0: 1
1: 0
2: 2
3: 13
4: 202
1156489838_1156489856 26 Left 1156489838 18:37489549-37489571 CCACATCTCACAGGGGTTGAGGA 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1156489856 18:37489598-37489620 AGCTGAAAGGGGGGAAGGTGGGG 0: 1
1: 0
2: 3
3: 69
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156489838 Original CRISPR TCCTCAACCCCTGTGAGATG TGG (reversed) Intronic
900908129 1:5575267-5575289 TCCTCTCCCCCTGTGGAATGTGG + Intergenic
901117877 1:6863328-6863350 TCCCCAACCCCTGTGAGTTCAGG + Intronic
901231510 1:7644151-7644173 ACCTCACCTGCTGTGAGATGGGG + Intronic
905401461 1:37706699-37706721 ACCTCAGCCCCTGTGAGGGGAGG + Intronic
905912635 1:41664388-41664410 TCCTCCTCCCCTTTGAGAGGTGG + Intronic
906531056 1:46524287-46524309 TTCTCAACCACTGCCAGATGGGG + Intergenic
907690173 1:56656711-56656733 TCATGTACCCCTGTGTGATGAGG + Intronic
908772598 1:67610194-67610216 TCCTCAAACCCAGCTAGATGGGG - Intergenic
910653675 1:89598518-89598540 TCCTGAACCACTTAGAGATGGGG - Intergenic
912763861 1:112391258-112391280 TCATCAACCCCGGGGAGAAGGGG + Intergenic
914947258 1:152078739-152078761 TCCTCAACATCTGGGAAATGAGG - Intergenic
919729776 1:200905991-200906013 TACTCAACTCCTCTGAGACGTGG + Intronic
919976501 1:202616250-202616272 TCCTGACCCCTTGTGAGTTGAGG + Intronic
1062996302 10:1870223-1870245 TCCTGCATCCATGTGAGATGTGG + Intergenic
1068671956 10:59732615-59732637 TTCTCAACCACTGTGTGTTGGGG + Intronic
1070169964 10:73925541-73925563 GTCTCAACCCCAGTGAGATAAGG + Intergenic
1070307131 10:75246297-75246319 TCCTTAACCCATCTGAGGTGGGG - Intergenic
1070917874 10:80166628-80166650 GCCACAACCTCAGTGAGATGTGG + Intronic
1072715710 10:97751160-97751182 CCTTCAACCACTGTGCGATGTGG + Intronic
1072720630 10:97778733-97778755 TCCTCAAGCCATGTGAGATCAGG - Intergenic
1074358576 10:112806965-112806987 TCCTGAAGCCATGTGAGATAAGG - Intronic
1075411015 10:122228027-122228049 ACCTCATCCCCTGTGATCTGGGG - Intronic
1075659011 10:124180494-124180516 CTCTCAACCCTTGTGTGATGAGG - Intergenic
1076211175 10:128646133-128646155 TCCACAACCTGTGTTAGATGTGG + Intergenic
1076436091 10:130442891-130442913 TCTTCAACCCCTGTGAGACTTGG + Intergenic
1077292953 11:1807981-1808003 TCCTCATCCCCCGTGAGACTTGG + Intergenic
1083082348 11:60107477-60107499 TTCTCAACCACTGTGTGTTGAGG + Intergenic
1083344438 11:61979494-61979516 TTCACAACGCTTGTGAGATGGGG - Intergenic
1084949719 11:72657949-72657971 TCCTCAGCTCCTGTGACATCAGG - Intronic
1089336233 11:117725723-117725745 CCCCCAACCCCTGGAAGATGGGG - Intronic
1089603251 11:119627609-119627631 TCCCCAGCCCCTGTGAAAGGAGG - Intronic
1090332882 11:125945013-125945035 TCCTGAACCCCAGTGAGAAGGGG - Intergenic
1091842093 12:3628531-3628553 TCCTCAACCCCAGAGAGAGGGGG + Intronic
1095972534 12:47912520-47912542 TCTGCAAACCCTCTGAGATGTGG + Intronic
1096470958 12:51875375-51875397 GCCTCAAGCCCTGTGGGGTGGGG + Intergenic
1099313189 12:81053176-81053198 TCCTCAACCCCTGTCTTATTAGG - Intronic
1101966570 12:109286291-109286313 TTCTCCACCCCTGACAGATGAGG + Intronic
1102999526 12:117374893-117374915 TCCTCATCCCCTGGAAAATGGGG - Intronic
1106574164 13:30958640-30958662 CCATCAATCCCTGTGAGCTGTGG + Intronic
1108517882 13:51220292-51220314 TCCTCCACCCCTTTAAGATGGGG - Intergenic
1109831920 13:67802157-67802179 TCCTCCACACCTGTGAAATAGGG + Intergenic
1111528757 13:89509219-89509241 TCCTCAGACCCTGGAAGATGTGG - Intergenic
1113467423 13:110522125-110522147 TCCTCAGCTCCCCTGAGATGTGG - Intergenic
1114603316 14:23973531-23973553 TCCTCCATCCCTTTGAGAGGTGG - Intronic
1114608296 14:24016013-24016035 TCCTCCATCCCTTTGAGAGGTGG - Intergenic
1115621535 14:35145374-35145396 TCATCAACACCTGTGAAAAGGGG + Intronic
1117624051 14:57617605-57617627 TCTTTAAACCCTGTGAGGTGAGG - Intronic
1119439596 14:74619425-74619447 TCCTCACACCCTGAGGGATGAGG + Intergenic
1120319788 14:82944824-82944846 TCCCTAACCCCTGTGACATTAGG - Intergenic
1120950750 14:90039725-90039747 TCCTTATCCTCTGTGAGTTGAGG + Intronic
1122769792 14:104092863-104092885 TCCTAAAGCCCTGTAAGCTGAGG - Intronic
1123808312 15:23897614-23897636 GCCTCCACTCCTGTGGGATGAGG - Intergenic
1127322210 15:57857839-57857861 ACCGCAAGCCCTATGAGATGGGG + Intergenic
1129113968 15:73354671-73354693 TCCTAGACTCCTGTGAGGTGGGG - Intronic
1129279247 15:74470946-74470968 TCCTCAACCCCAGGGGGTTGGGG - Intergenic
1130902655 15:88218800-88218822 GCATTAACCCCTGTGAGAGGTGG + Intronic
1132072581 15:98791963-98791985 TCCTCAAACCCTGCCAGGTGAGG - Intronic
1133050100 16:3112671-3112693 GCCTCCACCCCGGTGAGAAGGGG + Exonic
1133991136 16:10708484-10708506 TCGTTCACCCCTCTGAGATGTGG - Intergenic
1134322268 16:13174671-13174693 ACCTCACCCCATGTGAGAGGAGG - Intronic
1134907770 16:17995903-17995925 GCCTCAAACCCTGTGTCATGGGG - Intergenic
1135192290 16:20364455-20364477 TCATTAACCTCTCTGAGATGGGG + Intronic
1136053270 16:27668656-27668678 TCCTCCAGGCCTGTAAGATGAGG + Intronic
1136515378 16:30765044-30765066 TCCTCACCTCCAATGAGATGCGG - Exonic
1137321067 16:47383028-47383050 TCCTCTACCCCTGTGAGGTCAGG + Intronic
1139432503 16:66918675-66918697 TCGACAACCCCTCTAAGATGAGG + Intronic
1140701744 16:77587762-77587784 ACATCAGCCCCTGTGAGATGGGG + Intergenic
1141413914 16:83855392-83855414 CCTTCAACCCCTGTGTGGTGGGG - Intergenic
1141575601 16:84961584-84961606 ACCTCAACCTCTGTGAGCTGTGG + Intergenic
1141684429 16:85562239-85562261 TCCGATACCCCTGAGAGATGGGG + Intergenic
1141909167 16:87046831-87046853 TCCTCATCCCCTGTTCTATGGGG + Intergenic
1141954116 16:87358797-87358819 TCCTGAGCCCCAGTGAGCTGTGG - Intronic
1142901205 17:3013000-3013022 TGCTCCACCTCTGTGCGATGAGG - Intronic
1144510946 17:15875942-15875964 TCCCTGACCCCTGTGATATGTGG - Intergenic
1144814446 17:18024182-18024204 TCCTCAAACCCTGAGAGGTAGGG + Intronic
1145849235 17:28075385-28075407 TTCTCTACCCCTGTGATTTGAGG + Intronic
1145993553 17:29093175-29093197 TCGTCATCCCTTGTGGGATGGGG - Intronic
1146495124 17:33314944-33314966 TCCTTAATCCCTTTGAAATGAGG - Intronic
1148907258 17:50919396-50919418 TCCTCCTCCCCAGTGAGAGGAGG + Intergenic
1149983658 17:61331175-61331197 TCCCCTACCCCTGTGTGCTGAGG - Intronic
1151458710 17:74242068-74242090 TCCTCTGGCCCTGTGAGATGAGG + Intronic
1151608045 17:75153019-75153041 TCTCTAACCCCTGTGAGATATGG + Intronic
1156489838 18:37489549-37489571 TCCTCAACCCCTGTGAGATGTGG - Intronic
1158423958 18:57322503-57322525 TCCTCACCACCAGTGAGGTGGGG - Intergenic
1160011656 18:75110884-75110906 TCCTCAACACCTTAGAGAAGAGG - Intergenic
1161606667 19:5218897-5218919 TCCTTAACCTCTGTGAGCTTTGG + Intronic
1163251616 19:16129257-16129279 CCCCTAAGCCCTGTGAGATGGGG - Intronic
1163761991 19:19142290-19142312 CCCTCATCCCCAGTGAGGTGGGG - Intergenic
1164446941 19:28325776-28325798 TCCTCAGCCCCTCTGATAGGCGG + Intergenic
1165467575 19:35984089-35984111 ACCTCAACCACAGTGAGGTGAGG + Intergenic
1166224358 19:41385954-41385976 CCCACCAACCCTGTGAGATGGGG - Intronic
1166236725 19:41462182-41462204 TTCACAACCCCTGTGATATTGGG + Intergenic
927498633 2:23566965-23566987 TCCCCATCCCCTGTCTGATGTGG + Intronic
929531954 2:42758317-42758339 TCCTTATCCCCTGAGAGCTGCGG + Intergenic
929896641 2:45966728-45966750 TCCTAAAGCCTTGTGGGATGGGG + Intronic
930026025 2:47029612-47029634 TCCTCAGCCCCCATGAGGTGGGG + Intronic
937260829 2:120586018-120586040 TCCTCAAGCCCTGTGGGCTGTGG - Intergenic
938238342 2:129724010-129724032 TCCTCAAGCCCTGTGGTCTGTGG + Intergenic
938321690 2:130370497-130370519 ACCACAACCCCTTTTAGATGGGG - Intronic
938419832 2:131136231-131136253 CCCTGACCCCCTGAGAGATGAGG + Intronic
938784163 2:134610123-134610145 TCCTCAACCCTTGTCAGAAGAGG - Intronic
940396896 2:153199968-153199990 TCCTGAGACCCTATGAGATGTGG - Intergenic
941279459 2:163532180-163532202 TCCTCAAACCCTGTGTGAAGAGG - Intergenic
942611409 2:177745827-177745849 TCCTCCACTCCTGAGAGGTGGGG + Intronic
944737906 2:202584901-202584923 TGTACACCCCCTGTGAGATGAGG - Intergenic
947825714 2:233104946-233104968 TCCACAGCTCCTGTGAGATCAGG - Intronic
948915127 2:241030560-241030582 TCCTCATCCCCTGTGAGTCCAGG + Exonic
1170285733 20:14706425-14706447 TCTTCACACTCTGTGAGATGAGG + Intronic
1170789973 20:19499658-19499680 TCCTAATCCCCAGTGCGATGGGG - Intronic
1172944936 20:38679984-38680006 TCCTCAACACCTATGAGGTAAGG + Intergenic
1173387169 20:42599476-42599498 TCCTCAAGCCCAGAGAGATGGGG + Intronic
1173666557 20:44767287-44767309 AGCTCAAGCCCTCTGAGATGGGG - Intronic
1175175601 20:57109926-57109948 TCCTAATCTCCTGTGAAATGGGG - Intergenic
1175473627 20:59252847-59252869 TGCACACACCCTGTGAGATGAGG + Intronic
1176607214 21:8843276-8843298 TGTACAACCCCTGTGATATGGGG + Intergenic
1179407107 21:41135529-41135551 TCCTCAACCCCTTTCAGAAGGGG + Intergenic
1180984661 22:19897272-19897294 TCCTCAGGCTCTGTGAGCTGAGG + Intronic
1181035113 22:20166186-20166208 TCCTCACCCCGTGTGTGTTGGGG - Intergenic
1181265224 22:21627200-21627222 GCCTCTACCCCTGTAAAATGGGG + Intergenic
1181508693 22:23379160-23379182 TCCTCACCCCGTGTGTGTTGTGG + Intergenic
1181570291 22:23764626-23764648 TCCTCTCCCTCTGTGACATGTGG - Exonic
1183298648 22:37047092-37047114 ACCTCACCCTCTGTAAGATGGGG + Intergenic
1183550901 22:38484226-38484248 GCCTCAACTTCTGTAAGATGGGG + Exonic
1183592277 22:38786750-38786772 TCCTCACCCCCTCTGATGTGAGG + Intronic
950181450 3:10916364-10916386 TGGTCAACCCCTGTGTGCTGGGG - Intronic
951020281 3:17775554-17775576 TCCCAAAGCCCTGTCAGATGGGG + Intronic
953374949 3:42420768-42420790 TTCTCATCCCCTTTGTGATGTGG - Intergenic
953720604 3:45351538-45351560 TCCTCAACCCATGTGGGGAGTGG + Intergenic
954556419 3:51520846-51520868 GCCTTAACTCCTGTGAGAAGGGG - Intergenic
956898861 3:73692946-73692968 ACCCCAACCCCTTTGAGATGAGG + Intergenic
958459327 3:94374562-94374584 TCCTCAGTCCCTGTGAGATCTGG - Intergenic
962839498 3:139221119-139221141 TCCTCAGTCTCTCTGAGATGTGG + Intronic
964311821 3:155402031-155402053 TCCTCAAACCCTGTCATTTGGGG + Intronic
966883043 3:184360653-184360675 TCTTCCACCCCAGTGACATGAGG + Intronic
967097987 3:186193435-186193457 TCCCCAACCTCTGTGCCATGAGG + Intronic
968917185 4:3501707-3501729 CCCTCAACCCCTGTGGCAGGAGG + Intergenic
968983020 4:3860920-3860942 TTCTCAACCACTGTGCGTTGAGG + Intergenic
969189663 4:5506882-5506904 TCCCCTTCCCCTGTGTGATGTGG + Intergenic
971099251 4:23444904-23444926 TCCTCAACTCATGTGGGCTGAGG + Intergenic
972473774 4:39431768-39431790 TCCATAAACCCTGTTAGATGGGG - Intronic
973087273 4:46081212-46081234 TGCTAAACCTCTGTGAGATGGGG - Intronic
973228958 4:47820007-47820029 TTCCCAAACCCTGGGAGATGGGG - Intronic
978795596 4:112705332-112705354 ACCTCAACCCCTGTCGGATGTGG - Intergenic
984417277 4:179477554-179477576 CTCTCAACCCCTGTGGGAAGGGG - Intergenic
984424078 4:179561068-179561090 TCCTCAACCCAAATGAGTTGGGG + Intergenic
984887220 4:184460785-184460807 TTCTCAAGCCCTGTGAGGAGAGG + Intronic
985123185 4:186664188-186664210 TCCTTAGCCACTGTGAGAAGGGG - Intronic
988942900 5:36163905-36163927 TCCTCTTCCACTGTGAAATGAGG - Intronic
989647084 5:43646367-43646389 TCCTCAACCCCAGGAAGTTGAGG - Intronic
994393280 5:99208979-99209001 TGCACATCCCCTGTGATATGTGG + Intergenic
995290688 5:110448684-110448706 TCCTCATTCCATGTGAGAGGGGG - Intronic
995817710 5:116191101-116191123 TCCTCTACCCCTCTGAAATCTGG - Intronic
996339354 5:122418979-122419001 TCCTCAATCCCTCTGAAATCTGG - Intronic
1001608578 5:172981999-172982021 TCCTCAACCTCTCTGAGAACTGG + Intergenic
1003365641 6:5472208-5472230 TGCTAAACCCCAGTGACATGCGG - Intronic
1005306322 6:24517626-24517648 TCCTGGAGCCCTGTTAGATGAGG - Intronic
1006805003 6:36782375-36782397 CCCTCAGGCCCTGTGAGATCAGG + Intronic
1008630324 6:53358478-53358500 TCCTCATCCTCTTTGACATGTGG - Intergenic
1010138880 6:72589107-72589129 TCCTCAACCTGTGTGTGGTGTGG - Intergenic
1012718214 6:102703339-102703361 TATTCTACCACTGTGAGATGTGG + Intergenic
1012834833 6:104251991-104252013 GTCTCAACCCCTGTGACAAGTGG - Intergenic
1015605876 6:134954295-134954317 TCCTCAGCCCCTTTGCAATGAGG + Intergenic
1016461356 6:144283158-144283180 TCCTCAACGCCTGTAAGAGATGG - Intergenic
1016507879 6:144804800-144804822 TCCTCTGTCCCTTTGAGATGTGG - Intronic
1016799286 6:148152667-148152689 TCCTTAACAGCTGTGGGATGTGG - Intergenic
1018551054 6:164999401-164999423 TGCTCTACCCCTGGGTGATGGGG - Intergenic
1018892593 6:167993236-167993258 TCATCACCGCCTGTGAAATGGGG - Intergenic
1019426946 7:982449-982471 TCCTAAACCGCTGTGAGGGGTGG - Intergenic
1021394520 7:20130947-20130969 TCCTCAATGCCTGAGAAATGAGG - Intergenic
1023618062 7:42040982-42041004 TCCTCAACCTCGGTGACATTTGG - Intronic
1024991441 7:55237579-55237601 TCCTGTCCTCCTGTGAGATGAGG - Intronic
1026529479 7:71184880-71184902 TGCACAAGCCCTGTGAGCTGGGG + Intronic
1026760524 7:73122719-73122741 TCCCCAGCCCCTGTGGGAAGGGG - Intergenic
1027036866 7:74931540-74931562 TCCCCAGCCCCTGTGGGAAGGGG - Intergenic
1027086697 7:75269919-75269941 TCCCCAGCCCCTGTGGGAAGGGG + Intergenic
1029485946 7:100840508-100840530 TTCTCAACCGCTGTGTGTTGGGG - Intronic
1032743432 7:134762640-134762662 TCCTCCAGCCATGTAAGATGGGG - Intronic
1033403027 7:141045383-141045405 TCATCAACCCCTTTGAGATGGGG + Intergenic
1036228299 8:6978741-6978763 TCCTCAATCTCAGTGAGAGGAGG + Intronic
1036230752 8:6997858-6997880 TCCTCAATCTCAGTGAGAGGAGG + Intronic
1036233198 8:7016957-7016979 TCCTCAATCTCAGTGAGAGGAGG + Intronic
1036778210 8:11628200-11628222 ACCTCAATCCCAGTAAGATGTGG - Intergenic
1038992102 8:32878996-32879018 TCCTAAATCCCTTAGAGATGAGG + Intergenic
1040048751 8:42990718-42990740 TAGTCATCCCTTGTGAGATGGGG + Intronic
1044711089 8:95058794-95058816 TCCTAAAAACCTGTGAAATGAGG + Intronic
1045460048 8:102417474-102417496 CCCTTAACTACTGTGAGATGGGG - Intergenic
1046877626 8:119273975-119273997 TCCTCATCCCCTATGACATCTGG - Intergenic
1048640291 8:136350376-136350398 TTCTCAACCCTTGTGAGAAAAGG + Intergenic
1048759907 8:137782551-137782573 TTCTCTACCCATGAGAGATGTGG - Intergenic
1049248881 8:141577668-141577690 TCCCCAGCCCCTGAGAGGTGGGG + Intergenic
1051071654 9:13175699-13175721 TCCTCAACCCCCTTGACAAGGGG - Intronic
1051191622 9:14518880-14518902 TGCTCAGCCACTGGGAGATGGGG + Intergenic
1053426927 9:38016278-38016300 TTCGTTACCCCTGTGAGATGTGG - Intronic
1056916954 9:90754601-90754623 TCAACAACCCCTGTGATATTTGG - Intergenic
1059067383 9:111099665-111099687 TACTTAACACCTGTGAGCTGGGG - Intergenic
1061394615 9:130337202-130337224 TCCTCGATCCCTGTGGGATGGGG + Intronic
1062435447 9:136544881-136544903 TTCTCAGCCCCGGTAAGATGGGG - Intronic
1189279695 X:39812507-39812529 ACCTCACCTCATGTGAGATGGGG - Intergenic
1190059560 X:47202085-47202107 TCCACAACCCCTGCAAGATAAGG - Intronic
1191795697 X:65019056-65019078 TCCTCTGTCCCAGTGAGATGGGG - Intronic
1191936838 X:66436117-66436139 TCCACAGCCCTTGTGTGATGGGG + Intergenic
1194081941 X:89479169-89479191 TCCTCAACCCTTTTGACTTGTGG - Intergenic
1195746623 X:108124938-108124960 TCCTCAGCCCCTGTGAGGAAGGG - Intronic
1195917663 X:109951833-109951855 GCCTTAACCCATGGGAGATGAGG - Intergenic
1196374835 X:115021731-115021753 GCCTCAACCACTGTGATAAGAGG + Intergenic
1198665704 X:139020065-139020087 TACTCAACCCCCTTGAGATCTGG + Intronic
1200434613 Y:3135358-3135380 TCCTCAACCCTTTTGACTTGTGG - Intergenic