ID: 1156490214

View in Genome Browser
Species Human (GRCh38)
Location 18:37491647-37491669
Sequence AGGGAGAAGGAGTGTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 788}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156490214 Original CRISPR AGGGAGAAGGAGTGTGTGGC AGG Intronic
900115291 1:1025566-1025588 AGGGGGCAGGAGAGGGTGGCAGG - Intronic
900637592 1:3673626-3673648 AGGGAACTGGAGTGTGTGCCCGG + Intronic
900814907 1:4836343-4836365 AGGGAGAGGGAGTGTGGAGAGGG - Intergenic
901365734 1:8746756-8746778 AGCAAGAAGGCCTGTGTGGCTGG + Intronic
901540609 1:9912824-9912846 GGGGAGTAGGAGTGGCTGGCCGG - Intergenic
901676937 1:10890835-10890857 GGTGAGCAGGAGTGTGTGCCTGG - Intergenic
901776421 1:11563377-11563399 AGGGACAAGGAAGGTGGGGCAGG + Intergenic
902558468 1:17260963-17260985 AGGGAGCAGGGGTATATGGCGGG - Intronic
902833122 1:19030250-19030272 AGGGAGAAAAAGTGGGAGGCTGG + Intergenic
903184225 1:21620289-21620311 AGGGAGCAGGACTGAGTGGGTGG - Intronic
903194296 1:21673345-21673367 AGGGAGTAGGTGGGTGTGGGAGG + Intergenic
903232648 1:21931356-21931378 CGGGAGCAGGAGGGGGTGGCAGG + Intronic
904095303 1:27972324-27972346 AGGGAGATGTAGTGTGAGGTAGG - Exonic
904600235 1:31668903-31668925 AGGGGGAAGGAGTCAGGGGCTGG - Intronic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904919295 1:33994295-33994317 AGGGAGAATGAGTGACAGGCAGG + Intronic
904942834 1:34177133-34177155 AGGGATGAGGCGTGTGTGGATGG - Intronic
904946457 1:34202310-34202332 ACAGAGAAGGAGTGGCTGGCAGG + Intronic
905343768 1:37297445-37297467 AGGGAGAAGGTGTATCTGGGAGG - Intergenic
905640257 1:39584492-39584514 AAGGTGAGGGAGTGTGTGGTGGG - Intergenic
905641873 1:39595541-39595563 ACGGAGAAGGAGGCTGTTGCAGG - Intergenic
905772487 1:40647274-40647296 AGGGTGATGGAGTGTTAGGCTGG + Intronic
906194256 1:43920227-43920249 GGGGAAATGGAGTGTGTGACAGG - Intronic
906637258 1:47417496-47417518 AGGGAGAAGAAATGAGAGGCTGG - Exonic
906672419 1:47666043-47666065 AGGAAGAGGGAGTGTCTGGAGGG - Intergenic
906692492 1:47801723-47801745 ACAGAGAAGGTGTGTGGGGCTGG + Intronic
907733373 1:57088678-57088700 AGGGAGAATGAGAGAGTGGGAGG - Intronic
907825492 1:58012875-58012897 AGAGAGAGAGACTGTGTGGCAGG + Intronic
908476481 1:64493753-64493775 GGAGAAAAGGTGTGTGTGGCAGG - Intronic
908517335 1:64906404-64906426 AGGGAGGAGGTGTGTGTTGATGG - Intronic
908642304 1:66238718-66238740 AGGGAGAATGAGTGAGTAGGTGG + Intronic
908848167 1:68346195-68346217 AGGGAAAAGGAGAGTGAGGCAGG - Intergenic
909252924 1:73381311-73381333 AGGGAGCAGGAGAGTGAGGTGGG - Intergenic
909593542 1:77379148-77379170 AGGAAGGAGCACTGTGTGGCAGG + Intronic
911370661 1:96991189-96991211 TTAGTGAAGGAGTGTGTGGCTGG + Intergenic
912503636 1:110140208-110140230 AGGGAGAATTAGTGGGTGTCAGG - Intergenic
912508329 1:110171859-110171881 GGGGAGAAGGAGGGTCTGGGTGG + Intronic
913133455 1:115863960-115863982 AGGGAGTGGGAGTCTGTGGCTGG + Intergenic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
913564204 1:120055631-120055653 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
913633920 1:120737934-120737956 AGGGAGCAGAAGGGAGTGGCAGG - Intergenic
914284792 1:146214979-146215001 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
914545823 1:148665718-148665740 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
914620740 1:149404948-149404970 AGGGAGCAGAAGGGAGTGGCAGG - Intergenic
914755237 1:150558545-150558567 AGCGAGCAGGAGTGTGCGTCAGG + Exonic
914827518 1:151146369-151146391 AGGGAGCAGGAGGGCGCGGCCGG - Intronic
915060547 1:153179654-153179676 AGGAAGAAGTAGTATGTGGGAGG - Intergenic
915590935 1:156869886-156869908 AGGGACCAGGAATGTGTGCCTGG + Intronic
915898554 1:159829814-159829836 AAGGATGAGGAGTGTGGGGCAGG + Intronic
915935497 1:160088010-160088032 AGGGAAATGGAGGGTGGGGCCGG + Exonic
916195396 1:162217640-162217662 AGGCAGAGTGAGAGTGTGGCTGG + Intronic
916511323 1:165474577-165474599 AGGGAGGAGGCCAGTGTGGCTGG + Intergenic
916628895 1:166590850-166590872 AGGGAGATGGAGAGTGTAACCGG - Intergenic
916889608 1:169103516-169103538 CGGCAGGTGGAGTGTGTGGCTGG - Intergenic
917002595 1:170375935-170375957 AGAGAGAATGTGTGTGTGGGGGG + Intergenic
917196021 1:172466497-172466519 ACGCAGAATGAGTGTGTGGCTGG - Intronic
917232909 1:172857151-172857173 AGGGAGAAGGAGGGAGAGGGAGG + Intergenic
917964737 1:180171341-180171363 AGGGGGATGGTGTGGGTGGCAGG + Intronic
918093357 1:181315915-181315937 GGGGAGAAGGCCTGGGTGGCTGG + Intergenic
918645462 1:186899277-186899299 AGCAAGTAGGAGAGTGTGGCTGG + Intronic
919755711 1:201064944-201064966 ACGGAGGCGGAGTGTGGGGCTGG + Intronic
920308282 1:205032756-205032778 AGGCAGAAGGAACGTGAGGCTGG - Intergenic
920326181 1:205166200-205166222 ATGGAGAAGAACTGGGTGGCTGG + Intronic
922531867 1:226350860-226350882 AGGGATAATGAGAGTGTGACAGG + Intergenic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
923857572 1:237861517-237861539 AGGGATTAGGGGTGTGTGGGAGG + Intergenic
924688844 1:246325085-246325107 AGGGAGAAGGAGTCGGGGGGCGG + Intronic
924688900 1:246325228-246325250 AGGGAGAAGGAGTCGGGGGGCGG + Intronic
1063186612 10:3657674-3657696 AGGGAGGAGGATTGTGTAGGTGG + Intergenic
1063647496 10:7899509-7899531 ATGGAGAAGGGGTGAATGGCTGG - Intronic
1063996618 10:11626043-11626065 AGGGAGAAGGAGAGTAGTGCAGG + Intergenic
1064461502 10:15539169-15539191 AGTGAGAAGGAGTTCGTGACTGG + Intronic
1064974525 10:21099718-21099740 AGGGAGAAAGACTGTGAGCCAGG + Intronic
1065175253 10:23069200-23069222 AGGGAGACAGAATCTGTGGCTGG - Intergenic
1065184260 10:23156894-23156916 AGGGAGAAGGAGCGGGAGGCAGG + Intergenic
1065326437 10:24554090-24554112 AAGGAGATGGTGTCTGTGGCAGG - Intergenic
1065918049 10:30368548-30368570 AAGGAGCAGGAGAGTCTGGCAGG - Intronic
1065975036 10:30834699-30834721 AGGGATAAGGAGAGTGTGTTGGG - Intronic
1067182325 10:43997708-43997730 AGGGAGGAGGACAGTGTTGCTGG - Intergenic
1067481149 10:46598324-46598346 AGGGAGAGGTAGTGTTTGGAAGG - Intergenic
1067613603 10:47743498-47743520 AGGGAGAGGTAGTGTTTGGAAGG + Intergenic
1068271762 10:54736812-54736834 AGGGAAAAGGAGAGTGAGGCAGG + Intronic
1068833949 10:61531364-61531386 AGGGAGTAGGAGAGTGGGGATGG + Intergenic
1069282788 10:66676585-66676607 AGGGAGAAAGAGAGAGAGGCAGG - Intronic
1069705941 10:70459057-70459079 AGGGTGAAGCAGTGGGTGGGCGG - Intergenic
1069739514 10:70678637-70678659 TGGAAGAAGGGGTGTGGGGCAGG + Intronic
1070144181 10:73761699-73761721 AGTGAGAAGGAGAGTCTGGTTGG + Intronic
1070279580 10:75038703-75038725 AGGGAGATGGAGGGGGTGGGAGG + Intronic
1070652204 10:78245574-78245596 AGGGAAGAGGAGTGGGAGGCTGG + Intergenic
1070749909 10:78957871-78957893 AGGGAGGATGAGTGGGTGGGTGG + Intergenic
1070761326 10:79026317-79026339 AGGGAGTATGAGTGTGTGTGTGG - Intergenic
1071131480 10:82398540-82398562 AGAGAGTATGAGTGTGTGCCTGG + Intronic
1071538177 10:86454376-86454398 AGGGAGAGGGAGATTGTGGAGGG - Intronic
1071600019 10:86954471-86954493 AGGGAGAGGGAGCCTGTGGGAGG + Intronic
1071629013 10:87203470-87203492 AGGGAGAGGTAGTGTTTGGAAGG + Intergenic
1071936879 10:90541881-90541903 TGGAAGATGGAGTCTGTGGCTGG - Intergenic
1072009083 10:91287870-91287892 AGGGAAAAGGAGAGGCTGGCTGG - Intergenic
1072035116 10:91556088-91556110 GGGGAGTAGGAGGGAGTGGCAGG - Intergenic
1072248744 10:93565575-93565597 GGGGTGAAGGTGTGGGTGGCAGG + Intergenic
1072519865 10:96221847-96221869 AGTAAGAAGGAGTGTGTGCAGGG + Intronic
1072533624 10:96342854-96342876 AGGCAGAAGGAGTGCTTTGCAGG + Intergenic
1072624843 10:97104667-97104689 AGGGAGAGGGAGGCTGTAGCTGG - Intronic
1072654123 10:97318946-97318968 GGAGAGAAGGGGTGTGTGGGTGG + Intergenic
1072957135 10:99897249-99897271 ATGAAGAAGGAGTGGGTGGGTGG + Intronic
1073003593 10:100304224-100304246 AGGGAGAAAGAGTGTTTGTATGG - Intronic
1073112840 10:101072932-101072954 GTGGCGAAGGAGTGTGTGTCAGG - Intergenic
1073159008 10:101373534-101373556 AGGGAAAATGAGTGTTTGGTGGG + Intronic
1073290863 10:102412623-102412645 AGGCAGAAGGAGGGTCTGGATGG - Intronic
1073511702 10:104046615-104046637 AGTGAAAGGGAGTGTGTGCCAGG + Intronic
1073653267 10:105384106-105384128 AGGGAGAAGGAGAGTGGAGGAGG - Intergenic
1073672573 10:105608587-105608609 GGGGGGTAGCAGTGTGTGGCAGG - Intergenic
1075541608 10:123318582-123318604 AGGGAGCAGGTGTGGGTGGGAGG + Intergenic
1075900821 10:126041595-126041617 ATGGAGATGGAATGGGTGGCAGG + Intronic
1075923152 10:126229700-126229722 AAGGAGAAAGAGTGAGTGGAAGG - Intronic
1076434047 10:130427482-130427504 AGGGAACAGGACTGTGTGTCAGG - Intergenic
1076624004 10:131810603-131810625 AGGAAGTAGGAGTGAGGGGCAGG + Intergenic
1076746584 10:132517660-132517682 AGGAAGAAGGGGCGTGTGGGTGG - Intergenic
1076757291 10:132579194-132579216 CGGGGGAAGGAGAGTGTGGGGGG + Intronic
1076846447 10:133071731-133071753 CTGGGGAAGGAGTGTGTGGCTGG - Intronic
1076899864 10:133333272-133333294 AGGGAGAAGGATTGAGGGGGTGG + Intronic
1077233848 11:1470578-1470600 AGGGTCAAGGTGTGGGTGGCAGG - Intronic
1077306732 11:1871919-1871941 TGGGAGGGGGGGTGTGTGGCGGG + Intronic
1077306778 11:1872107-1872129 TGGGAGGGGGTGTGTGTGGCGGG + Intronic
1077306900 11:1872576-1872598 TGGGAGGGGGTGTGTGTGGCAGG + Intronic
1077306926 11:1872670-1872692 TGGGAGGGGGTGTGTGTGGCGGG + Intronic
1077471137 11:2761147-2761169 AGGGAGATGGAGTGGGAGGGTGG + Intronic
1077500311 11:2907066-2907088 AGGAAGAAGGAGTCTGGGGTTGG + Intronic
1078135020 11:8644618-8644640 AGAGAGGAGGGGTGTGTGGTGGG - Intronic
1078406650 11:11075654-11075676 TGGGAGAGGGAGGGTGTGGGTGG + Intergenic
1079218908 11:18541437-18541459 AGGAAGAAGGATTGAGTGTCTGG + Intronic
1079313051 11:19383176-19383198 AGGAAGCAGGGGTGTGTGGTGGG - Intronic
1079967185 11:26994166-26994188 CGGGAGATGGAGTGTGTAGCTGG - Exonic
1080414010 11:32052847-32052869 AGGCAAAAGGAGCCTGTGGCCGG + Intronic
1080700262 11:34638590-34638612 AGGGACATGGTGTGTGTGGAGGG + Intronic
1081457938 11:43243767-43243789 ATGGAGAAGGAGTGAGTGTGGGG + Intergenic
1081686106 11:45044223-45044245 AGGGACTAGGAGCGTGTGCCAGG + Intergenic
1082089661 11:48078995-48079017 AGGGTGAATGAGTGTATGACTGG + Intronic
1083235907 11:61350567-61350589 AGGGAGACGGGGTGTGTACCAGG - Intronic
1083900708 11:65641979-65642001 AGGGAGAATGAGGGCGTGGTGGG + Intronic
1084450013 11:69231075-69231097 AGAGAGACGGGGTGTGGGGCAGG + Intergenic
1084469160 11:69345353-69345375 AGGGAAAAGAAATGTGTGACGGG - Intronic
1084536091 11:69758026-69758048 AGAAAGAAGGCGTGTGAGGCTGG + Intergenic
1084748585 11:71189119-71189141 AGGGAGAGGGAATGAGTGGTCGG - Intronic
1084938169 11:72598350-72598372 AGGGGGCAGGTGTGAGTGGCAGG + Intronic
1085729481 11:78984007-78984029 AGTGAGGAGGAGTGGGAGGCAGG + Intronic
1086129605 11:83387094-83387116 AGGGTGAAGGAGAGGGTGGAAGG - Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086971233 11:93083285-93083307 ATGGAGGAGGAGTGCGTGGAAGG - Intergenic
1087146249 11:94814515-94814537 AGGGAGAAGGAGTGTCAGAAGGG + Intronic
1087636254 11:100704790-100704812 AGAGACAAGGAGTGGGCGGCGGG - Intronic
1088182322 11:107126828-107126850 AGGGGGAAGGAGAGTGAAGCTGG - Intergenic
1088815961 11:113421109-113421131 AGGGAGAGGGAGTAGCTGGCTGG - Intronic
1088987525 11:114922944-114922966 AGACAGGAAGAGTGTGTGGCTGG + Intergenic
1089377049 11:118001877-118001899 AGCGATAAGGAGTGTGCAGCGGG + Intergenic
1089748507 11:120633800-120633822 AGGCAGAAGGGAAGTGTGGCTGG + Intronic
1089775025 11:120830049-120830071 AGGGAGCTGGAGGCTGTGGCAGG - Intronic
1089850104 11:121488285-121488307 AGAGAGAAGGAGGGAGAGGCAGG - Intronic
1089933448 11:122338454-122338476 AGAGAGCAGGTGTGTGTGGGGGG - Intergenic
1090060790 11:123462553-123462575 TTGGAGAAGGGGTGGGTGGCAGG - Intergenic
1090198680 11:124839092-124839114 AGGGAGAAGGAATAGGGGGCAGG - Intergenic
1091109039 11:132948278-132948300 AGGCAGAAGGAGTGAGAGGAAGG + Intronic
1091277548 11:134362697-134362719 CGGGAGTGGGCGTGTGTGGCAGG - Intronic
1091279266 11:134372847-134372869 AGGGTAAAGGAGTGTGGGCCTGG - Intronic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091844014 12:3641417-3641439 AGAGGGAGGGAGTGTGTAGCTGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092143541 12:6200129-6200151 TTGAAGAAGGAGTGGGTGGCGGG + Intronic
1094702523 12:32883932-32883954 AGGGAGAAGGGGTGAGAGGAAGG - Intronic
1095154377 12:38834369-38834391 GGGGAGAAGGAGATTGAGGCAGG - Intronic
1095181892 12:39155455-39155477 AGGGAGAAGGAGTCTATCTCTGG - Intergenic
1095418710 12:42002742-42002764 AGGGAGTAGAAGTGGGTGGGTGG + Intergenic
1096065861 12:48739666-48739688 AGAGAGAAGGGGTGGGTGGGTGG + Intergenic
1096530920 12:52242455-52242477 AGGGAGCAGGAGTGGGTGCTGGG + Intronic
1097043098 12:56168048-56168070 AGCGAGAAGCAGTGAGTAGCAGG - Exonic
1098752300 12:74309941-74309963 AAAGAGAAGGAGTATTTGGCAGG + Intergenic
1099709086 12:86196786-86196808 AGAGAGACAAAGTGTGTGGCTGG - Intronic
1099709090 12:86196871-86196893 AGAGAGACAAAGTGTGTGGCTGG - Intronic
1100664282 12:96733992-96734014 AGGGAGGAAGAGTGTGGGGAGGG + Intronic
1101544957 12:105703892-105703914 AGGGAAAAGGAATGTCTGGTGGG - Intergenic
1101602647 12:106224051-106224073 GGGGAGGAGGTGGGTGTGGCTGG - Intergenic
1101709226 12:107249331-107249353 AGCGAGGAGGGCTGTGTGGCTGG - Intergenic
1102236307 12:111296636-111296658 AGGGAGGAGGTGTGTCTGGGAGG - Intronic
1102236418 12:111297024-111297046 AGGGAGGAGGCGTGTCTGGGAGG - Intronic
1102236449 12:111297136-111297158 AGGGAGAAGGCCTGTCTGGGAGG - Intronic
1102236462 12:111297192-111297214 AGGGAGGAGGCGTGTTTGGGAGG - Intronic
1102430926 12:112882192-112882214 AGAGATGAGGAGTGTGTGGTTGG - Intronic
1102509437 12:113404076-113404098 AGGGAGGAGGAGTGGGTTGTGGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102535115 12:113575595-113575617 AGGGAGCAGGAGAGAGTGGGTGG + Intergenic
1103089924 12:118090564-118090586 AGGGAGAAGGCCGGCGTGGCAGG - Intronic
1103248233 12:119476781-119476803 AGAAAGTAGGAGAGTGTGGCTGG - Intronic
1103500570 12:121398890-121398912 AGAGAGAGAGAGTGCGTGGCAGG - Intronic
1103606177 12:122087602-122087624 AGAGGGCAGGAGTGAGTGGCAGG + Intronic
1103678156 12:122672927-122672949 AGGGAGAAGGGGAGTGCGACAGG - Intergenic
1103680296 12:122688602-122688624 AGGGACAAGGAGTTTGTGTGTGG - Intergenic
1103944698 12:124519529-124519551 AGAGAGAAGGCTGGTGTGGCCGG + Intronic
1104014445 12:124952750-124952772 AGGGAGAAGGAGGGAATGGGGGG - Intronic
1104958445 12:132477048-132477070 AGGGAGGAGGAAGGTGCGGCCGG - Intergenic
1105068957 12:133222340-133222362 AGGGAGCTGGGGTGTGGGGCAGG + Intronic
1106584984 13:31049040-31049062 AGGGAGAAGGGATGTCTGGAGGG + Intergenic
1106871810 13:34029796-34029818 AGGGAGAGGGAGAGGGTAGCAGG + Intergenic
1107633791 13:42371397-42371419 AGGGAGAAGGATTGGGAGGAGGG - Intergenic
1107972622 13:45658511-45658533 ATGGGGCAGGAGTGGGTGGCTGG + Intergenic
1109142023 13:58725296-58725318 ATGGAGAAGGAGCTGGTGGCAGG + Intergenic
1112199581 13:97261894-97261916 AGGGGGAAGGACAGGGTGGCTGG - Intronic
1112219344 13:97472048-97472070 AGGGAGAAGTTGTGTGATGCAGG + Intergenic
1112299164 13:98214263-98214285 AGGAAGTGGGAGTGTCTGGCTGG + Intronic
1112521086 13:100095758-100095780 AGGGAGGAGGAGTGGGTAGGCGG + Intronic
1112780830 13:102898921-102898943 AGGGACATGATGTGTGTGGCTGG - Intergenic
1113018119 13:105851442-105851464 AGAGGGGAGGAGTGTGCGGCTGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113403384 13:110016395-110016417 TGGGTTAAGGAGGGTGTGGCAGG + Intergenic
1113654996 13:112062588-112062610 AGGGAAAGGGGGTGTGTGGAAGG - Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1114572623 14:23684211-23684233 AGCGAGAAGGCCAGTGTGGCTGG + Intergenic
1116427149 14:44805337-44805359 AGGGACAAGCAGTGTGTTTCAGG + Intergenic
1116579665 14:46623419-46623441 AAGGAGAAAGAATGTGTGGCTGG - Intergenic
1117812106 14:59558177-59558199 AGGAAGAAGGATGGTGAGGCTGG + Intronic
1117812991 14:59568196-59568218 AGGGAGCAGGGGTCTGAGGCTGG - Intronic
1118242578 14:64074300-64074322 AGGGAGAAGATCAGTGTGGCTGG + Intronic
1118946150 14:70389296-70389318 TGGGAGAAGGAAAGTGTGGAAGG - Intronic
1119220285 14:72900960-72900982 AGGGAGAAGGGGGCTGGGGCTGG - Intergenic
1119343049 14:73897152-73897174 AGTGAGAAGAAGTGTGTGTCTGG + Intronic
1119643537 14:76331491-76331513 AGGGAGGAAGTGTGTGTGGTTGG + Intronic
1120826161 14:88957512-88957534 AGGGAGAAGTAGTTTGGGGGTGG - Intergenic
1121313343 14:92946879-92946901 AAGGAGATGGAGAGTGTGTCAGG + Intronic
1122048677 14:99040886-99040908 AGGGAGAAGGAGTGCGAAGGAGG - Intergenic
1122175859 14:99918390-99918412 AGGCAAAATGTGTGTGTGGCTGG - Intronic
1122931935 14:104937177-104937199 AGAGACCAGGAGTGTGTGGGAGG + Exonic
1123133828 14:106009876-106009898 AGGGAGAAGGAGTTTATGGAGGG - Intergenic
1123165527 14:106322228-106322250 AGGGAGAAGGAGTTTATAGAGGG - Intergenic
1123409083 15:20043829-20043851 AGAGAGAAGGAGGGGGTGGGAGG + Intergenic
1123457809 15:20441955-20441977 AGGAAGTATGAGTGGGTGGCAGG - Intergenic
1123518414 15:21050537-21050559 AGAGAGAAGGAGGGGGTGGGAGG + Intergenic
1123583852 15:21740297-21740319 AGGGAGAAGGAGTTTATGGAGGG - Intergenic
1123620502 15:22182900-22182922 AGGGAGAAGGAGTTTATGGAGGG - Intergenic
1123660260 15:22558454-22558476 AGGAAGTATGAGTGGGTGGCAGG + Intergenic
1123826362 15:24086287-24086309 AAGGTGAAGCAGTTTGTGGCAGG - Intergenic
1124004560 15:25785579-25785601 AGGCAGAAGCAGTGAGTGGCAGG + Intronic
1124045067 15:26141139-26141161 AGTGAGAAAGAAAGTGTGGCTGG + Intergenic
1124314118 15:28652945-28652967 AGGAAGTATGAGTGGGTGGCAGG + Intergenic
1125093612 15:35825603-35825625 AGGGAAAAGAAGTGTGTTCCAGG - Intergenic
1125694199 15:41621693-41621715 GGGGGGAAGGAGAGGGTGGCGGG + Intronic
1125762636 15:42107503-42107525 TGTGAGAAAGTGTGTGTGGCGGG - Intergenic
1126208941 15:46077937-46077959 ATGGAAAAGGAGAGTTTGGCAGG + Intergenic
1126334029 15:47566509-47566531 AGGGACAAGAAGTGTGTCCCTGG + Intronic
1126389287 15:48128684-48128706 TAGGAGAATGAGTGTGTAGCAGG - Intronic
1126910852 15:53415660-53415682 AGAGAAAAGGAGTCTTTGGCTGG - Intergenic
1127171669 15:56309820-56309842 AGGGAGAATGAGAGAGTGGGAGG + Intronic
1127588183 15:60397746-60397768 AGGGACAAGGTGTTTGGGGCAGG - Intronic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1128253290 15:66178785-66178807 AGAGAGAAGGAGAGTGGGGGTGG + Intronic
1128525778 15:68411347-68411369 TTGAAGAAGGAGTGTGTGGGAGG - Intronic
1128555248 15:68627402-68627424 AGGAAGAAAGAGTGTGTTGGTGG + Intronic
1128683674 15:69668589-69668611 AGGCAGAAAGAGGGTGAGGCTGG + Intergenic
1128717176 15:69917178-69917200 AGAGATAAGGGGTGTGAGGCTGG + Intergenic
1128905531 15:71464614-71464636 AGGGACAATGAGTGTGTTGCAGG - Intronic
1128954122 15:71921463-71921485 CGGGAGAAGGAGTGGGTGGAAGG - Intronic
1128996807 15:72303310-72303332 AAGGAGAATGTGTGTGTGGATGG + Intronic
1129689243 15:77703994-77704016 AGGGACAAGGAGTTTGAGTCCGG + Intronic
1129786359 15:78312829-78312851 AGAGAGCAGGAGTGAGGGGCAGG - Intergenic
1130866434 15:87936967-87936989 AGGCAGGAGGAGTGTGTGCGAGG - Intronic
1132346897 15:101114015-101114037 AGGGAGAAGGAGAGCATGGGAGG - Intergenic
1132356471 15:101174649-101174671 AGGGAGGGAAAGTGTGTGGCAGG + Intergenic
1132564500 16:615256-615278 AGGCAGAAGGACGGTGTGGGTGG + Intronic
1132611229 16:817248-817270 AGCGAGAAGGGGAGGGTGGCTGG + Intergenic
1132664741 16:1076247-1076269 AGGGAGAGGGAGGGGGTGGCAGG - Intergenic
1132670116 16:1099070-1099092 AGGGAGGGGGAGGGTGTGGGTGG - Intergenic
1133254559 16:4508709-4508731 TGGGAGAATGAGACTGTGGCAGG - Intronic
1133581150 16:7145811-7145833 ATGGAGAAGTAGTGTGTGTGCGG - Intronic
1133855249 16:9543590-9543612 AGGGAGGAGGCAAGTGTGGCTGG - Intergenic
1134001591 16:10787139-10787161 ATGGAGCAGGAGCGTGGGGCTGG - Intronic
1134784656 16:16930681-16930703 AGGTAGGGGGAGTGTGTGGCAGG + Intergenic
1135575834 16:23584944-23584966 AGGTAGAAGTAATGTGTGCCAGG - Intronic
1135595897 16:23742993-23743015 AGGGAGGAGGAGTGAGAGGATGG - Intergenic
1135620274 16:23949914-23949936 AGGGAAGAGGTGTGGGTGGCTGG - Intronic
1135925684 16:26691790-26691812 GGGAAGAAGGCCTGTGTGGCTGG - Intergenic
1136020391 16:27436396-27436418 AGGGAGGAGGTCAGTGTGGCTGG + Intronic
1136864998 16:33741304-33741326 GGGAAGAAGGATTGTGAGGCAGG - Intergenic
1137419944 16:48324411-48324433 AGGGACAAGAAGTGTGTTACTGG - Intronic
1138212240 16:55173311-55173333 AGGGGGAAGGAGTGGGGGACCGG + Intergenic
1138398805 16:56729512-56729534 AGAAAGAAGGGGTGTGCGGCTGG - Intronic
1138493097 16:57388368-57388390 AGAGAGAAGGAGGCTGAGGCGGG - Intergenic
1138928372 16:61619859-61619881 AAAGAGAAGGACTGTGTGGCTGG + Intergenic
1139392449 16:66613393-66613415 AGGAAGAAGGAGGGTTTGGCTGG - Exonic
1139669196 16:68480252-68480274 AGGCAGAAAGGGTATGTGGCTGG + Intergenic
1140022052 16:71247970-71247992 AGGGGGAGGGGGTGAGTGGCTGG + Intergenic
1140195088 16:72848787-72848809 AGGAAGAAGGTATGTGTGGTTGG - Intronic
1141266129 16:82498791-82498813 AGGGAGTAGGGGAGTGGGGCTGG + Intergenic
1141483070 16:84319604-84319626 AGGGAGAAGGGGACTGGGGCAGG - Intronic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141685343 16:85566840-85566862 AGGGAGGAGGAGAGAATGGCGGG + Intergenic
1141965066 16:87436447-87436469 AGGCACAAGGAGTGAGGGGCCGG + Intronic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142159992 16:88552421-88552443 AGGGCTCAGGAGTGTGGGGCTGG - Intergenic
1142210488 16:88806201-88806223 CGGGAGAAGCTGTGAGTGGCAGG - Intronic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1142330143 16:89446891-89446913 AGGGACAGAGGGTGTGTGGCAGG - Intronic
1142664607 17:1455696-1455718 GGGGAGCAGGAGTGTGGGGGAGG - Intronic
1142682257 17:1557089-1557111 AGGGAGAATGAGGGAATGGCTGG - Intronic
1143200103 17:5107090-5107112 AGGGAAAAAGAGTGTGTTGCCGG + Intronic
1143502775 17:7348636-7348658 AATGAGAAGGAATGTGGGGCTGG + Intronic
1144604384 17:16652015-16652037 AGGGTGAAGGAGTGGGAGGGGGG + Intronic
1145278860 17:21454157-21454179 ATGGAGAGGGTGTGTGGGGCAGG + Intergenic
1145398999 17:22516323-22516345 ATGGAGAGGGTGTGTGGGGCAGG - Intergenic
1145416658 17:22718881-22718903 GAGCAGAGGGAGTGTGTGGCTGG - Intergenic
1146289234 17:31596277-31596299 GGGGAGCAGGAATGCGTGGCAGG - Intergenic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146458535 17:33025640-33025662 ATGGAGAAGGAGTGGGTTTCAGG - Intronic
1146478436 17:33181896-33181918 AGAGTGAGGGAGTGTGTGGCAGG + Intronic
1146920752 17:36708994-36709016 GGGGAGGAGGAGAGTGTGACTGG - Intergenic
1147177191 17:38663344-38663366 AGGGCAAGGGAGTGTGGGGCGGG + Intergenic
1147239292 17:39080030-39080052 TGACAGAAGGAGAGTGTGGCTGG - Intronic
1147315332 17:39617709-39617731 GAGGAGAAGGAGCGAGTGGCGGG - Intergenic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1147421999 17:40326566-40326588 AGTGGGCAGGAGTGTGGGGCTGG + Intronic
1147838963 17:43356798-43356820 AGGGAGAATGACTGTCTGACAGG + Intergenic
1148797820 17:50205603-50205625 TGGGCTAAGGAGTGTGTGGGAGG + Intergenic
1149030230 17:52074055-52074077 GGGGAGAAGGAGGGTGAGTCAGG - Intronic
1149309387 17:55379166-55379188 GGGCAGAAGGTGTGTGTGCCAGG - Intergenic
1149417580 17:56476029-56476051 CGGGAGAAAGAGAGTGAGGCAGG + Intronic
1149863363 17:60136706-60136728 AGGCTGGAGGAGTGTGTGTCGGG - Intergenic
1150589993 17:66553865-66553887 CAGGAGATGAAGTGTGTGGCCGG + Intronic
1150641190 17:66950915-66950937 AAGGAGAAGGACAGTGTCGCTGG + Intergenic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1151243433 17:72776004-72776026 AGGGAGAGGGAACATGTGGCAGG - Intronic
1151438892 17:74115489-74115511 AGGAAGCAGGAGTGAGGGGCAGG + Intergenic
1151470262 17:74313668-74313690 AGAGACAGGAAGTGTGTGGCAGG - Intronic
1151573565 17:74939529-74939551 AGGAAGAAGGAGTGTCCGGTGGG + Intronic
1151647180 17:75441259-75441281 AGAGAGAAGGCCAGTGTGGCTGG + Intronic
1151948222 17:77330907-77330929 AGGGACAAGCTGTGTGGGGCTGG - Intronic
1152400916 17:80065664-80065686 AGAGAGAGGGGGTGTGGGGCGGG - Intronic
1152443913 17:80329182-80329204 AGGAAGCAGGAGTGAGTAGCGGG - Intronic
1152859107 17:82685269-82685291 AGGGAAAAGGAGGGTGGGGAGGG + Intronic
1153362095 18:4208788-4208810 AGGGAGAAGGAGAGGTTGGGGGG + Intronic
1153608662 18:6859564-6859586 AGGCAAATGGAGTTTGTGGCAGG + Intronic
1154477623 18:14779067-14779089 AGGAAGAGGGATTGTGAGGCAGG + Intronic
1155149311 18:23110379-23110401 AGGGAGAAGGGGTGAGTAGCTGG + Intergenic
1155654202 18:28176640-28176662 AGGCAGCAGGAGGGTGAGGCAGG - Intronic
1155944254 18:31829749-31829771 AGGGTGTAGGAGTGGGTGGCAGG - Exonic
1156377906 18:36531303-36531325 AGGGAGCAGGGGTGGGTTGCAGG - Intronic
1156490214 18:37491647-37491669 AGGGAGAAGGAGTGTGTGGCAGG + Intronic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156669634 18:39452769-39452791 AGGTAGAAGGCATGTGTAGCTGG + Intergenic
1157476853 18:48029212-48029234 AGGGAGAAGGACTGGAGGGCTGG + Exonic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1158010230 18:52719883-52719905 TGGGATAAGGAGTGGGTGCCTGG + Intronic
1158085842 18:53651111-53651133 AGAGAGAAGGAGTGTATGCAGGG - Intergenic
1158851013 18:61495966-61495988 AGGGAAAAGGAGTGGGGAGCGGG - Intronic
1159787189 18:72727901-72727923 AGGGAAAAGGCATGTGGGGCTGG - Intergenic
1160209360 18:76863254-76863276 TAGGAGAAAGAGTGTGGGGCTGG + Intronic
1160210102 18:76870756-76870778 AGGCTGAAGGAGTGTGTTGGTGG + Intronic
1160499254 18:79394302-79394324 GGGGAGAAGGAGGGCGGGGCGGG + Intergenic
1160689854 19:456477-456499 AGGGAGGAGGAGGGTCTGGAAGG - Intronic
1160758801 19:772152-772174 AGGGAGGAGGCCCGTGTGGCTGG - Intergenic
1161096794 19:2396693-2396715 AGGGAGGAAGAGCGGGTGGCCGG + Intronic
1161205555 19:3039395-3039417 AGGGAGAAGGCCTGTGTGGCTGG - Intronic
1161245853 19:3251440-3251462 AGGGAGGAGGCCCGTGTGGCTGG + Intronic
1161249509 19:3272824-3272846 TGGGAGAAGGATTGTGTCCCAGG + Intronic
1161251233 19:3281418-3281440 AGGGAGATGGAGGGAGAGGCAGG - Intronic
1161257293 19:3316469-3316491 AGCGAGGAGGCCTGTGTGGCTGG + Intergenic
1161286445 19:3470979-3471001 AGTGAGGAGGCCTGTGTGGCTGG + Intergenic
1161291834 19:3498110-3498132 AGCGAGGAGGCCTGTGTGGCTGG - Intronic
1161301611 19:3545414-3545436 AGGGAGGAGGCCTGTGTGGCTGG - Intronic
1161482730 19:4518891-4518913 AGCGAGGAGGCCTGTGTGGCTGG - Intergenic
1161623209 19:5310080-5310102 AGCGAGGAGGCCTGTGTGGCTGG - Intronic
1161624713 19:5319666-5319688 AGCGAGGAGGCCTGTGTGGCTGG - Intronic
1161642954 19:5435731-5435753 AGCGAGGAGGCCTGTGTGGCTGG - Intergenic
1161647825 19:5465234-5465256 AGAGAGAAGGAGTCAGTGGCCGG + Intergenic
1161663812 19:5563066-5563088 AGCGAGGAGGCCTGTGTGGCTGG + Intergenic
1161821631 19:6533761-6533783 AGGGAGAAGGTGTCTCTGGAGGG - Intronic
1161852224 19:6743590-6743612 GTGGAGAAGGTGTGTGTGGCGGG + Exonic
1162425791 19:10594650-10594672 AGGGAGAAGGAGTGTTTCATAGG - Intergenic
1162567594 19:11452984-11453006 ACGGGAAAGGAGTGTGGGGCTGG + Exonic
1162594863 19:11620832-11620854 AGGGAGAAGGACTCAGTGGTTGG - Intergenic
1162973878 19:14197357-14197379 AGGGAGAAGGTGTTGGGGGCGGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1164027117 19:21362474-21362496 AGTGAGCAGGAGTGGGTGGAAGG + Intronic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164714087 19:30378975-30378997 AGGCATAAGGAGTGTGGGGAGGG + Intronic
1164835481 19:31352600-31352622 AGGGAGAAATAGTGTCTGGATGG + Intergenic
1165312867 19:35039500-35039522 AGAGAGAAGGAGTCTATGGGTGG - Intronic
1165389239 19:35528812-35528834 AGGGAGAAGGCCTGTGTGGCTGG - Intergenic
1165744861 19:38224507-38224529 TGTGAGTAGGAGTGTGTGGGAGG - Intronic
1165825557 19:38703775-38703797 AGGGAGAGGAACTGGGTGGCGGG + Intronic
1166053232 19:40273689-40273711 AGGGGGAAGGTGTGTGTGTGGGG - Intronic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166390719 19:42407481-42407503 AGGGAGACGGTGTGTGAGGTTGG + Intronic
1166453338 19:42919395-42919417 AAGGAGCAGGTGTGTGGGGCAGG + Intronic
1166465616 19:43027979-43028001 AAGGAGCAGGTGTGTGGGGCAGG + Intronic
1166471758 19:43084183-43084205 AAGGAGCAGGTGTGTGGGGCAGG + Intronic
1166482894 19:43187999-43188021 AAGGAGCAGGTGTGTGGGGCTGG + Intronic
1166485377 19:43207132-43207154 AAGGAGCAGGTGTGTGGGGCAGG + Intronic
1166492523 19:43271051-43271073 AAGGAGCAGGTGTGTGGGGCAGG + Intergenic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166730263 19:45055358-45055380 AGAGAGAAGGCCCGTGTGGCTGG + Intronic
1166736353 19:45087622-45087644 AGCGAGGAGGCCTGTGTGGCTGG + Intronic
1167639119 19:50670649-50670671 AGGGAGGAGGCCTGTGTAGCAGG - Intronic
1167691543 19:50987203-50987225 AGGCAGAAGGAGTGAATGCCTGG - Intergenic
1167765521 19:51479716-51479738 AGGGAGAAGGAGTCCCTGCCGGG + Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925224062 2:2167362-2167384 AAGGTGAAGGTGTGTGTGGTGGG - Intronic
925227621 2:2199463-2199485 CGGGGGAAGGAGAGTGTGACGGG - Intronic
925274768 2:2640998-2641020 AGGCAGAAGGGGTGTGGGGCAGG + Intergenic
925355519 2:3238493-3238515 AGAGAGAAGGAATGTGAGGAAGG - Intronic
925380382 2:3420827-3420849 ATACAGAAGAAGTGTGTGGCAGG + Intronic
926046169 2:9711215-9711237 AGGGAGAACGAGCGGGAGGCAGG + Intergenic
926720911 2:15959503-15959525 AGGGAGAAGGACTGGCTGGATGG + Intergenic
927242793 2:20933152-20933174 GGGGAGAGGGGGAGTGTGGCAGG + Intergenic
927429748 2:23017418-23017440 AGGGTGCAGGCGTGTGGGGCGGG - Intergenic
928234347 2:29526985-29527007 AGGGAGCAGGAGTCTGGGGTGGG + Intronic
928902798 2:36338673-36338695 AGAGAGAAGGGGAGGGTGGCAGG - Intergenic
929652132 2:43691092-43691114 AAAGAGACTGAGTGTGTGGCTGG - Intronic
929687130 2:44044654-44044676 AGGTGGGAGGAGGGTGTGGCTGG - Intergenic
931195351 2:60047508-60047530 AGGGAGATACAGAGTGTGGCTGG + Intergenic
931417169 2:62092093-62092115 AGAGAGAAGGAGTGTGGGGTAGG + Intronic
931756792 2:65381878-65381900 AGGAAAAAGGTGTGTGTGGTGGG - Intronic
931786034 2:65620168-65620190 TGGGAGGAGGTGAGTGTGGCAGG + Intergenic
932060620 2:68494455-68494477 AGGGAGAGGGAGTGAGGGGAAGG + Intronic
932827989 2:74958925-74958947 GGGGAGGTGGAGTGTGGGGCGGG + Intronic
932838994 2:75064204-75064226 AGGGAGGAGGAGTGTGGGTGAGG - Intronic
933652151 2:84858243-84858265 AGGGAGCTAGAGTGTGGGGCTGG - Intronic
934115212 2:88783380-88783402 AGGAAGAGGGATTGTGAGGCAGG + Intergenic
934159474 2:89234821-89234843 AGGGAGGAGGAGGGGGTGGGAGG - Intergenic
934163036 2:89270467-89270489 AGGAAGAAGGAAAGTGTAGCAGG - Intergenic
934628367 2:95885574-95885596 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934628494 2:95887450-95887472 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934628746 2:95891195-95891217 AGGAAGACGGATTGTGAGGCAGG - Intronic
934629148 2:95896800-95896822 AGGGAGATGGATTGTGAGGCAGG - Intronic
934629564 2:95902416-95902438 AGGGAGACGGATTGTGAGGCAGG - Intronic
934630382 2:95913642-95913664 AGGAAGACGGATTGTGAGGCAGG - Intronic
934631066 2:95923021-95923043 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934716398 2:96547123-96547145 AGGGGGAAGGGGTGTGTCCCTGG - Intronic
934802593 2:97180388-97180410 AGGAAGAGGGATTGTGAGGCAGG + Intronic
934803383 2:97191630-97191652 AGGAAGACGGATTGTGAGGCAGG + Intronic
934803527 2:97193500-97193522 AGGAAGACGGATTGTGAGGCAGG + Intronic
934804373 2:97204710-97204732 AGGAAGACGGATTGTGAGGCAGG + Intronic
934804645 2:97208453-97208475 AGGAAGACGGATTGTGAGGCAGG + Intronic
934804779 2:97210319-97210341 AGGAAGACGGATTGTGAGGCAGG + Intronic
934805033 2:97214067-97214089 AGGAAGAGGGATTGTGAGGCAGG + Intronic
934805157 2:97215949-97215971 AGGAAGAGGGATTGTGAGGCAGG + Intronic
934832326 2:97541437-97541459 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934832450 2:97543313-97543335 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934832828 2:97548938-97548960 AGGAAGACGGATTGTGAGGCAGG - Intronic
934833603 2:97560188-97560210 AGGAAGAGGGATTGTGAGGCAGG - Intronic
934955498 2:98614330-98614352 AGGAAGAGGGAGTGGGTGGGAGG + Intronic
935105789 2:100042104-100042126 AGGAAGAAGGCCAGTGTGGCAGG - Intronic
935115503 2:100132009-100132031 AAGGAGGTGGAGTGTGTGGCGGG - Intronic
936152999 2:110031880-110031902 AGGGAGAGGGAGGGTGGGGCTGG + Intergenic
936191681 2:110339532-110339554 AGGGAGAGGGAGGGTGGGGCTGG - Intergenic
936608346 2:113979068-113979090 AGAAAGCAGGTGTGTGTGGCCGG - Intergenic
937302095 2:120848805-120848827 AGGAAGAAGGAAGGAGTGGCAGG + Intronic
937367358 2:121273324-121273346 AGGGATGAGGAGGGTGTGGAGGG - Intronic
937851252 2:126638310-126638332 AGGGAGAATGACTGGGGGGCGGG + Intergenic
938069059 2:128298965-128298987 AGGGAGAGGGAGTGAGGGGTGGG - Intronic
938091151 2:128435700-128435722 AGGGAGCAGGAGTGCGGGGCAGG + Intergenic
938138757 2:128779988-128780010 AGCGTGAATGAGTGAGTGGCTGG + Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
938588102 2:132711706-132711728 AGGGAAAAGGAGGGTCTGTCTGG - Intronic
938770072 2:134494096-134494118 AGAGAGAATGTGTGTGTGGCGGG - Intronic
938781896 2:134592052-134592074 AGGGAGAAGGAGAGTGTTACAGG + Intronic
939040873 2:137188259-137188281 AGGGAGAAGGAGCTCTTGGCAGG - Intronic
939423377 2:142002804-142002826 AGAGAGATGTAGTGGGTGGCAGG + Intronic
939460490 2:142491636-142491658 AGGGAAATGGAGTGAGTGTCAGG + Intergenic
940077349 2:149757621-149757643 TGGTAGGAGGAGTGTGTGGGAGG - Intergenic
940463288 2:153995811-153995833 AGGGAGAAGGTGGGAGTGGTAGG - Intronic
941195293 2:162443367-162443389 AGGGAGAAAAAGTGTGTTGTGGG - Intronic
941710949 2:168712726-168712748 AGTGAGGAGGTGAGTGTGGCTGG - Intronic
942095523 2:172533816-172533838 AGGGAGATGGGGTGGGTTGCGGG + Intergenic
942131568 2:172885281-172885303 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942131573 2:172885301-172885323 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942459142 2:176157723-176157745 AGGGAGAGGGTGTGTGTGCGAGG + Intronic
942716364 2:178896979-178897001 AGAGAGAAGGGTGGTGTGGCTGG - Intronic
944090509 2:195904700-195904722 AGGGAGCAGCAAGGTGTGGCAGG + Intronic
944352552 2:198746041-198746063 GGGGAGAAGCAGTGTGCAGCAGG + Intergenic
945470370 2:210222310-210222332 AGGGATCAGGAGTATGTGCCTGG + Intronic
946427367 2:219606437-219606459 AGGGGGAGGGAGTATGTGGTAGG - Intronic
946564158 2:220944496-220944518 AGAGGGATGGAGTGTGGGGCTGG + Intergenic
947003673 2:225486825-225486847 AGGGAGGAGGAGTTAATGGCTGG - Intronic
947612239 2:231531297-231531319 GGGGAGCAGGAGGCTGTGGCTGG - Intergenic
947722539 2:232378615-232378637 AGGGAGTGGCAGGGTGTGGCTGG - Exonic
947726876 2:232406708-232406730 AGGGAGTGGCAGGGTGTGGCTGG - Intergenic
947729470 2:232420045-232420067 AGGGACGAGGAGAGTCTGGCGGG + Intergenic
948091793 2:235301744-235301766 AGGGAGAAGGAGGGAGGGGGAGG - Intergenic
948093866 2:235317818-235317840 AGGAAGGAGAAGTGTGTGGCAGG + Intergenic
948242143 2:236446774-236446796 AGGCCTGAGGAGTGTGTGGCTGG - Intronic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
948642787 2:239386007-239386029 AGGGAGAAGGAATCTGGGTCGGG + Intronic
948642971 2:239387071-239387093 GGGGAGCACGAGTGTGTGGGTGG + Intronic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
949070110 2:242019354-242019376 GGTGAGAGGGGGTGTGTGGCTGG + Intergenic
1168888355 20:1276087-1276109 AGGGAACAGGAGGGTGTGGAGGG - Intronic
1169046202 20:2536381-2536403 TGAGAAGAGGAGTGTGTGGCCGG + Intergenic
1169900337 20:10546363-10546385 TCGTAGAAGCAGTGTGTGGCCGG + Intronic
1170361864 20:15555110-15555132 GGGAAGAAGGAGTGTGTGAAGGG + Intronic
1170363985 20:15580361-15580383 AGGGAGATGGAGTGTGGGAGTGG - Intronic
1170429784 20:16265446-16265468 AAGGAGAAGGTGTGTGGGCCTGG + Intergenic
1172583888 20:36068915-36068937 TGGGAGAAGAAATGGGTGGCTGG + Intergenic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1173142449 20:40495959-40495981 AGGGTGAAGTAGGGTCTGGCTGG - Intergenic
1173848588 20:46203279-46203301 GGGAGGAAGCAGTGTGTGGCAGG + Intronic
1173872788 20:46352238-46352260 AGGGAGAGAGAGTGGGAGGCCGG + Intronic
1174098693 20:48109983-48110005 AGGGTGAAGGGGTGGGTGGATGG - Intergenic
1174184025 20:48692918-48692940 CAGGAGCAGGAGTGTTTGGCTGG + Intronic
1174185350 20:48702474-48702496 TGGGAGATGTAGTCTGTGGCTGG - Intronic
1174218353 20:48934291-48934313 AGCGAAAAAGTGTGTGTGGCAGG - Intronic
1174313952 20:49682449-49682471 AGCGAGAAGGCCCGTGTGGCTGG - Intronic
1174416968 20:50373863-50373885 AGGGAGGAGGCCAGTGTGGCTGG + Intergenic
1174850519 20:53989577-53989599 AGTGAGCAGGGGTGGGTGGCTGG - Intronic
1175030472 20:55948688-55948710 AGGGAAAATGATGGTGTGGCAGG - Intergenic
1175172600 20:57090961-57090983 AGGGCGGAGGTGTGTGTGGGCGG - Intergenic
1175293171 20:57891621-57891643 AGGGAGGAGGAGGGCGTGGGAGG + Intergenic
1175366334 20:58458832-58458854 AGAGAGAAGGCCAGTGTGGCCGG + Intergenic
1175881514 20:62262139-62262161 TAGGAGCAGGAGTGTGAGGCCGG - Intronic
1176164936 20:63667925-63667947 AGGGGGAGTGAGTGTGGGGCCGG - Intronic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176896519 21:14384657-14384679 AGGAGAAAGGAGTGAGTGGCAGG - Intergenic
1179182435 21:39057275-39057297 AGGGAAGAGGAGTGTCTGGCGGG - Intergenic
1179269278 21:39837799-39837821 AGGGAGAAGCTGTGTGTCCCTGG + Intergenic
1179408156 21:41142321-41142343 CAGGAGGATGAGTGTGTGGCAGG - Intergenic
1179471702 21:41614645-41614667 GAGGAGAAGGAGTTTGTGCCAGG - Intergenic
1179534536 21:42042957-42042979 AGGGAAGAGGTGTGTGTAGCGGG - Intergenic
1179831578 21:44000412-44000434 AGGGAGGAGGGGAGTGGGGCCGG + Intergenic
1179839246 21:44060052-44060074 AGGGAGATGAAGTGTGGGGACGG + Intronic
1179959259 21:44759084-44759106 AGGAAGGAGGAGACTGTGGCGGG - Intergenic
1180016330 21:45087537-45087559 ACGGAGGAGGAGTGGGTGCCAGG + Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1181426803 22:22849055-22849077 AGGGAGAGGGAGGGGGTGGTAGG - Intronic
1181572234 22:23773834-23773856 AGGGAGCAGGAGGGTGTGACAGG + Intronic
1182541265 22:31043811-31043833 AGGGAGCAGGAAGGGGTGGCTGG + Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1183329639 22:37212395-37212417 AAGGAGAATGAGGGGGTGGCAGG + Intergenic
1183978933 22:41528452-41528474 AAGGAGAAGGTGGGTGTGGGTGG - Exonic
1184386624 22:44180234-44180256 AGGGTGAAGGAGGGAGTGGGTGG - Intronic
1184607945 22:45585118-45585140 AGAGAGAAGTGGCGTGTGGCAGG + Intronic
1185141835 22:49106895-49106917 AGGGAGAAAGGGTGGGAGGCAGG - Intergenic
949216088 3:1568881-1568903 AGGGAGTAAGAGAGTGTGGCAGG - Intergenic
949598403 3:5572566-5572588 AGGGAGCAGTAGTGGATGGCAGG + Intergenic
949667447 3:6356526-6356548 AGAGGGAAGGACAGTGTGGCAGG + Intergenic
950155141 3:10716355-10716377 AGGGAGGAGGCCAGTGTGGCTGG - Intergenic
950413024 3:12851259-12851281 AGAGAGAATGAGTGGGTGGGGGG + Intronic
950612732 3:14136690-14136712 GGGGAGAGGGAGTGGGTGGGGGG + Intronic
950867999 3:16204786-16204808 GGGGAGAAGCAATGTGGGGCAGG + Intronic
952181917 3:30925686-30925708 AGGGAGAAGGAGGGTCAGACAGG + Intergenic
952298633 3:32084563-32084585 AGGGAGAGGGAATGTGTGCATGG + Intergenic
952334612 3:32393052-32393074 TGGGGAAAGGAGTGTGGGGCTGG + Intronic
953183759 3:40619851-40619873 AAGGAGGAGGTGGGTGTGGCAGG - Intergenic
953979225 3:47405395-47405417 AGGCAGGAGGAGAGTGTGGCTGG + Intronic
954380789 3:50217992-50218014 AAGGAGTAGGTGTCTGTGGCTGG + Exonic
954384447 3:50236905-50236927 AAGGAGAAGGAGGGAGTGGGTGG - Intronic
954469849 3:50683842-50683864 GGGGAGAGGGAGTGGGTGGGGGG - Intronic
954836914 3:53477946-53477968 TGGGAGTGGTAGTGTGTGGCTGG + Intergenic
955360713 3:58272096-58272118 AGGGAGAGGGAGAGAGAGGCCGG - Intronic
955528311 3:59844005-59844027 AAAGAGAAGGAGGGTGTGGGAGG - Intronic
956510270 3:69985658-69985680 AGGGAGAAGGGATGTGGGGAGGG + Intergenic
959919029 3:111850294-111850316 AGGGAGAAGGTGAGGGGGGCAGG + Intronic
959985406 3:112565808-112565830 AAAGAGAAGGAGTGGTTGGCTGG + Intronic
960483275 3:118219520-118219542 AGGAAGAAAGAGTGTGTGTTGGG + Intergenic
961034932 3:123635527-123635549 AGGGAGGAGGGGTGTGTGTGTGG - Intronic
961514524 3:127424426-127424448 AGGGAGAGGGAATCAGTGGCCGG - Intergenic
961716511 3:128861302-128861324 AGAGAGAATGAGTGGGTGGGGGG - Intergenic
961805185 3:129484081-129484103 AGAGAGAATGAGTGGGTGGGGGG + Intronic
962076018 3:132082319-132082341 AGGGAGAGGGAGAGAGAGGCAGG - Intronic
962090765 3:132241979-132242001 AAGGAGACTGAGTGTGTGGGAGG - Intronic
963807561 3:149740156-149740178 AGGGAGAAGAATTGTATGGAAGG - Exonic
964634877 3:158847744-158847766 AGGGAGCAGGAGTGAGGGACAGG + Intergenic
965275746 3:166679634-166679656 ATGGAGAAGGACGGTGTGGTTGG - Intergenic
967105548 3:186252253-186252275 TGGGAGATGGACAGTGTGGCAGG + Intronic
967123116 3:186401314-186401336 AGAAAGAAGGTCTGTGTGGCTGG - Intergenic
967972841 3:195012077-195012099 AGAGAGAAGGTGTGGGGGGCCGG + Intergenic
968701944 4:2061523-2061545 GGGGAGAGGGCTTGTGTGGCAGG + Intronic
968854868 4:3112238-3112260 AGGGAGTATCAGTGTTTGGCAGG - Intronic
968942232 4:3644791-3644813 AGGATGAATGAATGTGTGGCGGG + Intergenic
969244439 4:5923439-5923461 AGGGAGGAGGCTTTTGTGGCGGG + Intronic
969583938 4:8081245-8081267 AGAGAGAAGGTGGGTTTGGCTGG - Intronic
972322119 4:37981647-37981669 AGGGAGAAGGGAGGTATGGCTGG + Intronic
972810669 4:42582495-42582517 GGGGAGAGAGAGTGTGTGGGGGG - Intronic
973370548 4:49243656-49243678 AGCCAGAAGGAGTGTTTGGAAGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973390477 4:49551760-49551782 AGCCTGAAGGAGTGTGTGGAAGG + Intergenic
973710664 4:53627169-53627191 AGGGAGAAGGAAAGCGTAGCTGG + Intronic
974646713 4:64704169-64704191 AGGGAAAAGATGTGTGTTGCTGG + Intergenic
975185523 4:71397792-71397814 AAGGAGAAGCAGTGTGTGAAGGG + Intronic
975728574 4:77316264-77316286 AGGAAGCAGGATTGGGTGGCAGG + Intronic
976550789 4:86392778-86392800 AGGGATAAGGAGGAAGTGGCTGG + Intronic
976666794 4:87603436-87603458 AGGGGGAAGGAGTGGGAGGAAGG - Intergenic
977309867 4:95372726-95372748 AGGCAGAACGAATGTGTGGTTGG + Intronic
978294642 4:107190779-107190801 AGGGAGATGGACTGATTGGCTGG + Intronic
978560667 4:110030333-110030355 AGTGAGGAGGAGAGTGGGGCCGG + Intergenic
978573131 4:110162017-110162039 AGGGAGGAGAATTGTGTGGTTGG + Intronic
978701091 4:111647115-111647137 GAGGAGAAGGAGAGTGTGTCAGG + Intergenic
979454404 4:120910431-120910453 AGAGAGAAGGATTGGGTAGCTGG - Intronic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
980380688 4:132011419-132011441 AGTAAGAAGGAGTGGCTGGCCGG - Intergenic
980491519 4:133533699-133533721 GGGGAGAAGGGGTGGGGGGCGGG + Intergenic
980959551 4:139461316-139461338 AGGGAGAATGAGGGTTAGGCTGG + Intronic
980977489 4:139625016-139625038 AGGGGGAAGGAGGGAGTGGTAGG + Intergenic
981663919 4:147200002-147200024 AGGATAAAGGTGTGTGTGGCTGG - Intergenic
982772326 4:159408223-159408245 AAGAAGAAGGCCTGTGTGGCAGG - Intergenic
983942779 4:173553372-173553394 ACGGGGCAGGAGTGTGTGGATGG + Intergenic
984185538 4:176538603-176538625 AGGAAGCAGGATTGTGTGGAAGG + Intergenic
985178648 4:187231303-187231325 AGGGAGAAGGTGTGTGAGTTCGG + Intergenic
985585840 5:733570-733592 AGAGAGATGGAGTGAGAGGCAGG - Intronic
985599503 5:819344-819366 AGAGAGATGGAGTGAGAGGCAGG - Intronic
985600261 5:824982-825004 AGAGAGATGGAGTGAGAGGCAGG - Intronic
985884802 5:2669285-2669307 AGTGAGCAGGAGTGTGTGTGTGG - Intergenic
986127397 5:4895693-4895715 AGGGATAAGGGGTGTGGGGGCGG - Intergenic
986141607 5:5036167-5036189 AGAGAGCAGGATTGGGTGGCAGG - Intergenic
986269781 5:6220497-6220519 AGGGAGGAGGAGTGTGGTGTCGG - Intergenic
986662811 5:10074369-10074391 ACAGAGAAGGAATCTGTGGCAGG - Intergenic
987029516 5:13963035-13963057 AGGGAGAGGGAGAAGGTGGCTGG - Intergenic
987174150 5:15289744-15289766 AAAGAGAAGGATTGTGTGGAAGG - Intergenic
988640296 5:33034300-33034322 AGGGAGAAGGAGTGGGATTCTGG - Intergenic
988987957 5:36639096-36639118 CTGGAGAAGCAGTGTGTGGTAGG + Intronic
990504135 5:56427834-56427856 AAGGGGAAGGAGAGTGTTGCAGG - Intergenic
990709590 5:58565158-58565180 AGGGAGATGGAGAGTGGGGGGGG + Intergenic
992005293 5:72471501-72471523 GGGGAAAAGGACTGTATGGCTGG + Intronic
992866827 5:80965235-80965257 TGGGAGATGGAGAGTGTGGATGG + Intronic
993127636 5:83855101-83855123 AGGTAGAAGGAATGAGTAGCAGG - Intergenic
994162071 5:96567938-96567960 ATGGAGGAGGAGAGGGTGGCAGG + Intronic
994812778 5:104543348-104543370 AGAGAGAATGAGTGTGTAGAAGG - Intergenic
995051267 5:107707246-107707268 AGGTAGAAGGAGTGATTGACAGG + Intergenic
995130918 5:108629620-108629642 AGGGAGAAGGTCTGGGTGGAAGG + Intergenic
995991211 5:118241865-118241887 AGGGAGCAGGGGTGTGTGGCAGG - Intergenic
996148106 5:119999919-119999941 AGGGAGAAAGAGAGAGAGGCAGG + Intergenic
997198233 5:131993844-131993866 AGGCAGAAGGAGTGCCTGGTAGG + Intronic
997260339 5:132460906-132460928 AGGGAACTGGCGTGTGTGGCTGG - Exonic
997361410 5:133297636-133297658 AGGGAGCAGGAGGCTGTGGCTGG - Intronic
997973257 5:138421933-138421955 AGCAAGAAGGTGGGTGTGGCTGG - Intronic
998044772 5:138977815-138977837 AGCCAGAAGGTGAGTGTGGCTGG - Intronic
998386579 5:141760618-141760640 GGGGAGGAGGAGTGTGTGCAGGG - Intergenic
998424624 5:142015826-142015848 AGGGAGAAGGAGTCTCTGAATGG - Intergenic
998545165 5:143021554-143021576 ATGGAGGAGTAATGTGTGGCTGG + Intronic
999248758 5:150169165-150169187 AGGGAAAAGGAGTGTGTCAGTGG + Intronic
999275292 5:150325898-150325920 AGGGAAAAGGTGAGTGAGGCAGG - Intronic
999286235 5:150395930-150395952 AGGGAGATGGAGTCTGGAGCTGG - Intronic
999742406 5:154566254-154566276 AGGCAGGAGGAGTGTGAGGTAGG + Intergenic
1000956366 5:167548362-167548384 CGTGAGAAGGAATGTGTGGTTGG + Intronic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1001322380 5:170693255-170693277 AGGGACAATGTGTGTGTGTCGGG - Intronic
1002017905 5:176340511-176340533 AGGGAGACCGTGTGTGTGACTGG - Intronic
1002568683 5:180128216-180128238 AGGGAGAGGGAGGCTGGGGCGGG - Intronic
1002883804 6:1275970-1275992 AGCGAGAAGGAGAGAGTGGAAGG + Intergenic
1002925261 6:1602102-1602124 AGGGAAAAGGAGAGAGTGGGTGG - Intergenic
1003365370 6:5469354-5469376 AGGGATATGAAGTGTGGGGCGGG - Intronic
1003627751 6:7758767-7758789 AGGGTGAAGGGGTTTGTGGTTGG - Intronic
1003766658 6:9244879-9244901 AGGGAGAAGGTGTATGTTCCAGG + Intergenic
1003894234 6:10591652-10591674 AGGAGGAGGGAGTGGGTGGCAGG - Intronic
1003998172 6:11564913-11564935 AGGGAGAAGGAGTCAGTGCAAGG + Intronic
1004455877 6:15790983-15791005 AGGGAGAAGCAATGCTTGGCAGG + Intergenic
1004667580 6:17762534-17762556 AGGGGCAAGGAGGGTGTGGCAGG - Intronic
1004979586 6:21008366-21008388 AGGAAAAAGGATTCTGTGGCAGG + Intronic
1005881067 6:30061388-30061410 AGGCAGGAGGCGTGCGTGGCAGG + Exonic
1006579481 6:35068593-35068615 GGGGAGAGGGGGTATGTGGCGGG - Intronic
1007342183 6:41198288-41198310 AGGAAGAAGAAGTGTGAGCCTGG - Exonic
1007375707 6:41455267-41455289 AGGCATAAGGAGTGAGTTGCAGG - Intergenic
1007494857 6:42252676-42252698 TGGGAGAAGGAGGTGGTGGCTGG + Intronic
1007938485 6:45754865-45754887 AGGCAGGAGGACTGTGTGGAGGG - Intergenic
1008268113 6:49457114-49457136 AAGGAGAAGGAGTACGTTGCTGG + Intronic
1009750473 6:67873500-67873522 AGAGAGAAGGGGTGTGGGGGGGG + Intergenic
1010451471 6:76008590-76008612 AGGGAGGATGAGTGTCTGGTTGG - Intronic
1011480022 6:87784566-87784588 AGGGAAAAGTAGAGTGAGGCAGG + Intergenic
1012249539 6:96964281-96964303 AGGGAGAAGAAGTGTCTGCCTGG + Intronic
1012883059 6:104814786-104814808 AGGGAGAAAGAGCGTGAGGGGGG - Intronic
1013444451 6:110208460-110208482 AAGGAGAAGGAGGGTGTTTCTGG - Intronic
1013738869 6:113259970-113259992 AGAGAGAAGCAGTGTGTGATTGG + Intergenic
1014275015 6:119378128-119378150 AGAGAGAGAGAGTGTGTGTCTGG + Intergenic
1014397589 6:120945144-120945166 AGACAGAAGGAGTGAGGGGCAGG + Intergenic
1015110960 6:129590790-129590812 AGGGAGAGAGAGTGTGTGTGTGG + Intronic
1015218808 6:130780911-130780933 TAGGAGAATGAGGGTGTGGCGGG + Intergenic
1016100889 6:140098758-140098780 AGGGAGCAGGAGAATGTGACGGG + Intergenic
1016192899 6:141293047-141293069 AGGCAGAAGGAGTGTTGGACAGG - Intergenic
1016351894 6:143177686-143177708 AGGGAGCATGGGTGTATGGCAGG + Intronic
1017145424 6:151230181-151230203 AGGGAGCAGGAGTGGGTGTCTGG + Intergenic
1018800406 6:167217829-167217851 AGGGACAGGGAGGGTGTGGCTGG - Intergenic
1018809749 6:167289516-167289538 AGGGACAGGGAGGGTGTGGCTGG + Intronic
1018828018 6:167422828-167422850 AGGGAGACGCCGTGTGTGGTGGG - Intergenic
1018914064 6:168121922-168121944 AGGGAGAAGGAGTGGGGAGACGG + Intergenic
1019298835 7:292926-292948 AGGGAGAAGGAGTCGGAGTCCGG + Intergenic
1019332331 7:466591-466613 AGGGTGAAGGAGAGTGAGGGAGG - Intergenic
1020061519 7:5155992-5156014 AGGGCAAAGGAGGGTGAGGCTGG + Intergenic
1020126247 7:5533957-5533979 AGGGAGGGGCAGTGTGAGGCAGG - Intronic
1020166638 7:5812668-5812690 AGGGCAAAGGAGGGTGAGGCTGG - Intergenic
1020188178 7:5974473-5974495 AGGGAGAAAGGGTGTAAGGCAGG + Intronic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020294739 7:6750295-6750317 AGGGAGAAAGGGTGTAAGGCAGG - Intergenic
1020437596 7:8182348-8182370 AGGCAGAAGCAGTGAGTGCCTGG + Intronic
1021312569 7:19111948-19111970 AGTAAGAAGGAGCATGTGGCAGG - Intronic
1021781274 7:24109117-24109139 AGGGAGCAGGAATGAGGGGCAGG - Intergenic
1022209120 7:28191222-28191244 AAGGGGAAGGAGTGTGTGGGGGG + Intergenic
1022310157 7:29189689-29189711 AGGGAGAAGGGGAGTGTAGGGGG - Intronic
1022395615 7:29985762-29985784 GGAGAGAAGGAGTATGTGGTGGG - Intronic
1022819864 7:33948979-33949001 AGGGAGAAGGGGGCTGTGCCCGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023119375 7:36893935-36893957 AGAGAGCAGGTGTGTGTGGTGGG + Intronic
1023291486 7:38672726-38672748 AGGGAGATCCAGGGTGTGGCTGG - Intergenic
1023752352 7:43384762-43384784 CGTGAGAGGGAGTGGGTGGCTGG + Intronic
1024457880 7:49629799-49629821 ATGGAGAAAGTGTGTGTGGAGGG - Intergenic
1026396754 7:69963128-69963150 AAGGAGAAGGAGTTTATGCCAGG + Intronic
1027046344 7:74993916-74993938 AGGGGGAAGGAGGGTGCAGCAGG - Intronic
1027185346 7:75967762-75967784 AGGGAGGAGGGGTGTGTGCCCGG + Intronic
1027229651 7:76264836-76264858 AGGGAGAACGAATGGGGGGCTGG - Intronic
1027428246 7:78083343-78083365 AGGGAGAAGGAGATGGTGGGGGG + Intronic
1028123912 7:87089367-87089389 AGGGTGAGGGAGTGAGTGGTTGG + Intergenic
1029238379 7:99142621-99142643 AGGGAGGAGGACGGTGTGGGGGG + Intronic
1029386635 7:100247692-100247714 AGGGGGAAGGAGGGTGCAGCAGG + Intronic
1029452000 7:100646655-100646677 AGGGAGAAGGAGTGAGCTGCGGG + Intronic
1031133737 7:117862590-117862612 AGGGAGGAGCAGAGTGTGCCTGG - Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031925329 7:127633176-127633198 AGGAAGAAGGAGCATGTGGGAGG + Intergenic
1032480834 7:132245429-132245451 GGGGAGAAGGATTGTGTGCAGGG + Intronic
1032995603 7:137442744-137442766 AGGGAGAAGGAGTTTTAGGCTGG - Intronic
1033896535 7:146077840-146077862 AGGGAGGATGAGGGTTTGGCTGG + Intergenic
1034914236 7:155023616-155023638 AGGGAGAAGGAATGAGTAACAGG - Intergenic
1034965384 7:155387473-155387495 AGGGAGAGGGTGTGTGCAGCTGG + Intronic
1034993204 7:155560993-155561015 ACGATGAAGGAGTGTGTGGCAGG - Intergenic
1035359497 7:158301318-158301340 AGGGAGGAGGGGAGTGTGTCAGG - Intronic
1035362027 7:158319813-158319835 AGGGAGACTGAGTGTGTGTGAGG - Intronic
1035971872 8:4258294-4258316 AGGGAGAAAGAGAGTGAGGGAGG + Intronic
1036524112 8:9519159-9519181 TGGGATCAGGAGTGTGTGCCAGG - Intergenic
1036730529 8:11259038-11259060 AGGGAGCAGGAGTGAGGGGTAGG - Intergenic
1036757499 8:11480995-11481017 CAGGAGCAGGAGGGTGTGGCTGG - Intergenic
1036982301 8:13483599-13483621 AGGGAGAGAGAGTGTGTGAGAGG + Intronic
1037300244 8:17443987-17444009 AAGGAGGAGGAGTGAGGGGCAGG - Intergenic
1037319765 8:17631613-17631635 TGGGCAAAGGAGTGTGTGGGAGG - Intronic
1037648576 8:20816245-20816267 AGGCAGAGGGAGTGTGAGGGAGG - Intergenic
1037928685 8:22864968-22864990 AGGGGGCAGGAGTGCGGGGCGGG + Intronic
1038375981 8:27040916-27040938 AGAGAGAAGGTTAGTGTGGCTGG - Intergenic
1039381851 8:37092876-37092898 AGGGAGGCGGTCTGTGTGGCTGG + Intergenic
1039407832 8:37328085-37328107 AGGGAAAAGGACTATCTGGCTGG + Intergenic
1039921731 8:41897699-41897721 ATGGAGAGGGAGTGGGTGGGCGG - Intergenic
1040783724 8:51140835-51140857 AGAGAGAAGTGGTGTGAGGCAGG - Intergenic
1040948604 8:52912758-52912780 AGGGAGAAGGAGTGAGGGACTGG - Intergenic
1041059420 8:54021979-54022001 AGGGAGAAGGAGGGAGGGGGCGG + Intronic
1041944065 8:63422432-63422454 AGTGAGGTGGAGTGGGTGGCAGG - Intergenic
1043161479 8:76852933-76852955 AGGGAGGAGGAGGAGGTGGCGGG - Exonic
1043529653 8:81135343-81135365 AGGAAGAAGGGCGGTGTGGCAGG - Intergenic
1043639913 8:82439144-82439166 TGGGAAAGGGTGTGTGTGGCAGG - Intergenic
1044230625 8:89773430-89773452 AGTGAGAAGGCCTGTGTGGCTGG + Intronic
1044501778 8:92966102-92966124 TGGGAGTAGGGGTGTGCGGCTGG - Exonic
1044559347 8:93597187-93597209 AGGGAGAAGGAAGATGTCGCAGG - Intergenic
1045142178 8:99298897-99298919 AAGGCCAAGGAGTGAGTGGCAGG + Intronic
1045266554 8:100623489-100623511 AGGGAGGAGGAGAGTGTGGCTGG - Intronic
1045347347 8:101305017-101305039 AGGAAGAGGGAGGGTGAGGCAGG + Intergenic
1045725799 8:105171692-105171714 AGGGGGAAAGAGTGGGAGGCGGG - Intronic
1046228835 8:111325895-111325917 AGGGAGCAAGAGTGTCTGGCTGG + Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1047252452 8:123191159-123191181 AGGGAGAATGAATGCTTGGCAGG + Intronic
1047586518 8:126279677-126279699 AGGGAGATGGAGTGTGAAGGTGG - Intergenic
1048184293 8:132225366-132225388 AGTGAGAAGGAGATTGTGGCTGG + Intronic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049254344 8:141605816-141605838 AGGGAAGAGGAGGGTGGGGCGGG - Intergenic
1049477160 8:142802086-142802108 AGGGAGGAGGGGTGGGTGGATGG + Intergenic
1050818217 9:9842489-9842511 AGGAAGAAAGAGAGTGTGGGAGG + Intronic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1053004741 9:34596963-34596985 AGGGAGAGGGAGTGGGAGGTGGG + Intergenic
1053011591 9:34636901-34636923 ATGGAAAAGGAGTGTGTTGGGGG - Intronic
1053199031 9:36140342-36140364 AGGGAGAAGCTGTGTGGGCCAGG + Intronic
1053303018 9:36965053-36965075 AAGGAGAAGGGGTGTGGGGGTGG - Intronic
1053522195 9:38791504-38791526 AGGGATAGGAAGTGTGTGGAGGG - Intergenic
1053542043 9:38983622-38983644 CGAGAGAGAGAGTGTGTGGCTGG + Intergenic
1053564344 9:39232640-39232662 AGGGAGGCTGAGGGTGTGGCTGG - Intronic
1053806384 9:41806251-41806273 CGAGAGAGAGAGTGTGTGGCTGG + Intergenic
1054132806 9:61386396-61386418 AGGGAGGCTGAGGGTGTGGCTGG + Intergenic
1054194422 9:62015968-62015990 AGGGATAGGAAGTGTGTGGAGGG - Intergenic
1054624097 9:67380288-67380310 CGAGAGAGAGAGTGTGTGGCTGG - Intergenic
1054643985 9:67572722-67572744 AGGGATAGGAAGTGTGTGGAGGG + Intergenic
1055111529 9:72564736-72564758 AGAGAGCTGGAGTGTGTGGAAGG - Intronic
1055407139 9:75987169-75987191 AGGCAGAAGGAATGGGAGGCAGG - Intronic
1055481984 9:76717686-76717708 ATGCAGAAGGTGTGTGTGGCTGG - Intronic
1056276467 9:84998617-84998639 AGGGATAAGGAGAGTGAGACAGG - Intronic
1056496233 9:87157971-87157993 AGGGAGCAGGAAGGTGGGGCAGG + Exonic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1058351675 9:104032500-104032522 AAGGAGTAGGAGTGAGGGGCAGG - Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059354238 9:113687101-113687123 AGGGAGGAGGAGGGTGGGGAAGG + Intergenic
1059366289 9:113789045-113789067 AAGGAGAAAGCGTGTGTGGAAGG + Intergenic
1060537383 9:124401282-124401304 AATAGGAAGGAGTGTGTGGCTGG - Intronic
1060915730 9:127389044-127389066 AGGGACAAGGAGTGCGTGACTGG - Exonic
1060933500 9:127503290-127503312 AGGGAGCAGGAGGGCCTGGCTGG + Exonic
1061134604 9:128726229-128726251 AGGGAGAATGAGGGAGTGGAGGG + Intergenic
1061268536 9:129522816-129522838 AGGAGGAAGGAGAGTGTGGCAGG - Intergenic
1061294788 9:129671219-129671241 AGGGAGGAGGAGTGAGTGAGAGG + Intronic
1061763718 9:132868505-132868527 AGGGAGAAGGAGTGGGAGGCTGG - Intronic
1061900401 9:133669310-133669332 AGGGAGAGGGAGGGTGAGGGAGG - Intronic
1061959900 9:133982549-133982571 AGGGCGCAGGAGTCTCTGGCTGG + Intronic
1062002835 9:134225425-134225447 AGTCAGAAGGAGTCTGAGGCAGG + Intergenic
1062083346 9:134636105-134636127 AGGGGGTAGGAGTGGGTGGGAGG - Intergenic
1062123464 9:134846885-134846907 AGGGTGAACGAATGTGTGGATGG - Intergenic
1062170481 9:135132263-135132285 AGGGAGCTGGAGTGTGGGTCGGG + Intergenic
1062402406 9:136378342-136378364 TGGGAGAGGGCGTGTGTGGGAGG + Exonic
1062419554 9:136473270-136473292 AGGTAGAAGGATTGTGTGATAGG - Intronic
1062511710 9:136909887-136909909 AGGGATCAGGAGTGTGAGGGTGG - Intronic
1062543355 9:137051247-137051269 AGGAAGAGGGGGTGTTTGGCTGG - Exonic
1062628019 9:137451798-137451820 AAGGGGAAGGGGCGTGTGGCTGG - Intronic
1062628031 9:137451830-137451852 AAGGAGAAGAGGCGTGTGGCGGG - Intronic
1062628076 9:137451987-137452009 AAGGAGAAGAGGCGTGTGGCGGG - Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548426 Un_KI270743v1:148032-148054 AGCCTGAAGGAGTGTGTGGAAGG - Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203582581 Un_KI270746v1:25170-25192 AGGAAGAGGGATTGTGAGGCAGG + Intergenic
1185726184 X:2423737-2423759 ATGGAGACGGAGTGGGGGGCGGG - Intronic
1186334019 X:8567023-8567045 AGGGAGGAGGCGTTTGTCGCAGG - Intronic
1186342321 X:8657833-8657855 AGGAAGAAGGGGAGTGAGGCAGG + Intronic
1186852086 X:13590607-13590629 AGAGAGAAGGAGGTTGGGGCAGG - Intronic
1186951316 X:14628735-14628757 AGAAAGAAAGACTGTGTGGCTGG + Intronic
1187106302 X:16245938-16245960 AGAGAGAAGGCCAGTGTGGCTGG + Intergenic
1187163832 X:16786853-16786875 AGGGAGAAGGGGTGCGAGGCGGG + Intronic
1187235780 X:17465872-17465894 AGGGGCAAGGAGGGTGTCGCTGG - Intronic
1187882873 X:23862844-23862866 AGGGAGAAGGAGGGAGGGGAGGG + Intronic
1187985800 X:24809165-24809187 AGAGAGAAAGTGTGTGTGTCGGG - Intronic
1188425240 X:30038768-30038790 AGAGAGAAGGAGTCAGTGCCTGG + Intergenic
1189237833 X:39501872-39501894 AGGCAGAAGGGGAGTGTGGTGGG + Intergenic
1189648222 X:43157857-43157879 AGGGAGCAGGAGTGGTTGGGGGG + Intergenic
1189806473 X:44740234-44740256 AAGAAGAAGAAGTGTTTGGCAGG + Intergenic
1189943497 X:46152819-46152841 AGGCAGAAGGAGGTTGTGGGAGG - Intergenic
1190546250 X:51530872-51530894 ATGGAGGAGGAGAGTGTGGGGGG - Intergenic
1192409049 X:70916185-70916207 AGAGAGAAAGTGTGTGTGGTAGG + Intergenic
1195081665 X:101377121-101377143 AGGGAGTCAGGGTGTGTGGCAGG - Intronic
1195392478 X:104376945-104376967 AGAGAAAATGAGTGAGTGGCTGG - Intergenic
1196051848 X:111313900-111313922 AGGGAGAAAGAGTGGGGGGGAGG + Intronic
1197196738 X:123709952-123709974 AAGGAGAAGCAGTGTGTGCAAGG + Intronic
1197333793 X:125186591-125186613 AGAGAGAGAGAGTGTGTGCCAGG - Intergenic
1197761087 X:130028883-130028905 TTGTAGAAGGTGTGTGTGGCGGG + Intronic
1197872225 X:131071241-131071263 AGGGAGCAGCAGTTTGAGGCTGG - Intronic
1197882389 X:131180579-131180601 AGGGAGAAGGGATGTTTGGCTGG + Intergenic
1198153645 X:133935361-133935383 AGGAATAATAAGTGTGTGGCGGG + Intronic
1199791288 X:151157513-151157535 TTGGAGAAGCAGTGTGGGGCAGG + Intergenic
1200093244 X:153645402-153645424 AGGGACATGGGGGGTGTGGCCGG + Intronic
1200796262 Y:7343813-7343835 ATGGAAAAGGAGTGGGTGGGTGG - Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic
1202265641 Y:23014880-23014902 ATTGAAAAGGAGTGTGTTGCCGG + Intergenic
1202418634 Y:24648622-24648644 ATTGAAAAGGAGTGTGTTGCCGG + Intergenic
1202452152 Y:25021464-25021486 ATTGAAAAGGAGTGTGTTGCCGG - Intergenic