ID: 1156490809

View in Genome Browser
Species Human (GRCh38)
Location 18:37494865-37494887
Sequence TGTGGCCTTCTCTTGGGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156490799_1156490809 -8 Left 1156490799 18:37494850-37494872 CCCCACCCCCAATCCTGTGGCCT 0: 1
1: 0
2: 9
3: 85
4: 1891
Right 1156490809 18:37494865-37494887 TGTGGCCTTCTCTTGGGATAAGG 0: 1
1: 0
2: 0
3: 17
4: 219
1156490795_1156490809 -1 Left 1156490795 18:37494843-37494865 CCTCCCTCCCCACCCCCAATCCT 0: 4
1: 4
2: 42
3: 385
4: 2890
Right 1156490809 18:37494865-37494887 TGTGGCCTTCTCTTGGGATAAGG 0: 1
1: 0
2: 0
3: 17
4: 219
1156490800_1156490809 -9 Left 1156490800 18:37494851-37494873 CCCACCCCCAATCCTGTGGCCTT 0: 1
1: 0
2: 3
3: 45
4: 456
Right 1156490809 18:37494865-37494887 TGTGGCCTTCTCTTGGGATAAGG 0: 1
1: 0
2: 0
3: 17
4: 219
1156490801_1156490809 -10 Left 1156490801 18:37494852-37494874 CCACCCCCAATCCTGTGGCCTTC 0: 1
1: 0
2: 3
3: 30
4: 372
Right 1156490809 18:37494865-37494887 TGTGGCCTTCTCTTGGGATAAGG 0: 1
1: 0
2: 0
3: 17
4: 219
1156490796_1156490809 -4 Left 1156490796 18:37494846-37494868 CCCTCCCCACCCCCAATCCTGTG 0: 1
1: 2
2: 31
3: 211
4: 1123
Right 1156490809 18:37494865-37494887 TGTGGCCTTCTCTTGGGATAAGG 0: 1
1: 0
2: 0
3: 17
4: 219
1156490797_1156490809 -5 Left 1156490797 18:37494847-37494869 CCTCCCCACCCCCAATCCTGTGG 0: 1
1: 0
2: 12
3: 157
4: 852
Right 1156490809 18:37494865-37494887 TGTGGCCTTCTCTTGGGATAAGG 0: 1
1: 0
2: 0
3: 17
4: 219
1156490794_1156490809 16 Left 1156490794 18:37494826-37494848 CCTTGGAAGGGAGAGGTCCTCCC 0: 1
1: 0
2: 0
3: 11
4: 190
Right 1156490809 18:37494865-37494887 TGTGGCCTTCTCTTGGGATAAGG 0: 1
1: 0
2: 0
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156490809 Original CRISPR TGTGGCCTTCTCTTGGGATA AGG Intronic
901311659 1:8274033-8274055 TTTGGGTTTCTCTTGGGAAAGGG + Intergenic
901350653 1:8592991-8593013 TGTAGCCATTTCTTGGGATTAGG - Intronic
902980390 1:20118498-20118520 TGTGTCCATCCCTTGGGAGAAGG - Intronic
903551045 1:24157492-24157514 TGTGGACTCCTCCTGGGACAGGG - Exonic
904207389 1:28863868-28863890 TGTGGCCTCATCTTTGGATACGG + Intergenic
906046258 1:42833097-42833119 TGTGGTCTTCTCTTGGCCAAGGG - Intronic
908764316 1:67540299-67540321 TGTGACCTTATCTGGAGATAAGG + Intergenic
915692616 1:157704705-157704727 TGTGGCATTCTCTTGGCTCAAGG + Intergenic
918060873 1:181060316-181060338 TGTGGCCTTCTTTGGAAATAGGG - Exonic
918998713 1:191799435-191799457 TGTGTCCATCTCTTTAGATATGG + Intergenic
921417375 1:214905717-214905739 TGCTGCCTTCTGTTGGGAGAAGG - Intergenic
922485877 1:225972655-225972677 TGGTTCCTTCTCTGGGGATAGGG + Intergenic
923660214 1:235950952-235950974 TGTGACCTTCTTTGGAGATATGG + Intergenic
1063146454 10:3298989-3299011 TGTGGCTTGCTCTTGGGGTGAGG + Intergenic
1063895396 10:10676249-10676271 TGTGGCATTCTGGTGGGAGAAGG - Intergenic
1064857146 10:19782212-19782234 TGTGGCCTTCAGCTGGGTTATGG - Intronic
1065151009 10:22823488-22823510 TGTGTCCTTCTTTTGGCTTATGG + Intergenic
1066434250 10:35382386-35382408 TGATGCCTTCTCTTGGGAGGGGG + Intronic
1067127865 10:43535480-43535502 TGTGGCTTTATTTTGAGATAGGG - Intergenic
1073525462 10:104177546-104177568 TCTGGCTTTCTCTTGGGTTTAGG - Intronic
1075147361 10:119893349-119893371 TGTGCCCCTCTCCTAGGATACGG + Intronic
1075652676 10:124139589-124139611 TGTTGCCCTCTCTTGGGTTCTGG - Intergenic
1076566026 10:131400166-131400188 TCTGGCCTTCTCCTGGCAGATGG - Intergenic
1078044681 11:7903017-7903039 TGTCGGCTTCTCCTGAGATAGGG + Intergenic
1078679246 11:13460349-13460371 GGGGGTCTTCACTTGGGATAAGG - Intronic
1078849836 11:15153610-15153632 TGTGGATTTCTCTTTGGAAATGG - Intronic
1078901803 11:15649685-15649707 TGTGACCCTCTCTTGGGGCATGG - Intergenic
1079344119 11:19637156-19637178 TGAAGCTTTCTGTTGGGATAGGG - Intronic
1080800672 11:35607180-35607202 TGTGGCTTTCTTTTGAGACAGGG - Intergenic
1081099551 11:38985730-38985752 TGTGTCCTTCTGTTGGTATCTGG + Intergenic
1081552939 11:44130948-44130970 TGTGGCCTGTTCTTGGGACATGG - Intronic
1081730651 11:45369661-45369683 TGTGGGCTTCGCTGGGGATTGGG + Intergenic
1083695652 11:64440600-64440622 TGTGGCCTTGTCATGGGCAATGG - Intergenic
1083714342 11:64567208-64567230 TGTGCCTTTCTCTTGGAAGATGG - Intronic
1085539517 11:77253862-77253884 TGTGCCCTTTCCTGGGGATACGG - Intronic
1086448548 11:86892955-86892977 TGTGGCCTTATCTGGAAATAGGG + Intronic
1090807710 11:130212749-130212771 TGTGGCCTTCACCTGGGTGAAGG - Intergenic
1092555429 12:9555415-9555437 CATGGCCTTCGTTTGGGATATGG - Intergenic
1093658663 12:21727317-21727339 TGTGGCATTTACTTGGGATGGGG - Intronic
1094516669 12:31135266-31135288 CATGGCCTTCATTTGGGATATGG + Intergenic
1096418377 12:51433511-51433533 TGTGCACTTTTCTTGGGAGAGGG - Intronic
1096439640 12:51629747-51629769 TGTGGCATACTCTTGGGAGAGGG + Intronic
1098188431 12:67923135-67923157 TGTGACCTTATCTGGAGATAGGG + Intergenic
1099383930 12:81990695-81990717 AGTGGCCTTCCCTTTGGCTATGG - Intergenic
1099745917 12:86704978-86705000 TGTAGCCTTTTCTTGGAAAAAGG + Intronic
1100318751 12:93469877-93469899 TGTAGCCCACTCTTGGGATTTGG + Intronic
1100892769 12:99144689-99144711 TGTGGCCTTATTTGGAGATAGGG + Intronic
1101087489 12:101251241-101251263 TGTGGCCTTCATCTGGGAAAGGG + Intergenic
1102056930 12:109903450-109903472 TGTGGCTGTCTCTGGGGATATGG - Intronic
1102611296 12:114114693-114114715 TGTGGCCTTTCCTAGGTATAGGG + Intergenic
1103730862 12:123026964-123026986 TGTGGCCTTATTTTGAAATAGGG - Intronic
1105294963 13:19080042-19080064 TCTGTCCTTCTCTGTGGATAAGG - Intergenic
1105571840 13:21610692-21610714 TGTGGCCGTCTCCTGGAAGACGG - Intergenic
1106992724 13:35441500-35441522 CATGGCCTTCATTTGGGATATGG - Intronic
1108806460 13:54162586-54162608 TGTGGCCTTATTTAGGAATAGGG - Intergenic
1111118469 13:83814199-83814221 TGTGGCCTTCTTTGGACATAGGG - Intergenic
1112443055 13:99438981-99439003 TGTGGCCTTATTTCGGGAAAAGG - Intergenic
1112907467 13:104442761-104442783 TGTGGCCTGTTCTTGGGAGTAGG + Intergenic
1116840713 14:49818604-49818626 TCTGGCCTTCTGTTAGGAAATGG - Intronic
1121266990 14:92610602-92610624 TGTGGCTTTCTGATGGGAGAGGG + Intronic
1123123800 14:105930289-105930311 TGTGTCCTTCCCTGGGGATGAGG + Intronic
1123230065 15:17097795-17097817 TGTGGCCTTCCTTTGGAAAAGGG + Intergenic
1123235712 15:17196124-17196146 TGTGGCCTTCCTTTGGAAAAGGG + Intergenic
1125719601 15:41839005-41839027 TGTGGTCTTCTCCAGGGGTAGGG + Intronic
1127045743 15:55023699-55023721 TGTCTCCTTCTCTTGTTATAAGG - Intergenic
1127670095 15:61186922-61186944 TGCTGGCTTCTCTTGGGAAATGG + Intronic
1129151014 15:73687770-73687792 TCTGACCTTCTCTAGGCATAGGG + Intronic
1129435103 15:75533163-75533185 TCTGGTCTTCCTTTGGGATAAGG + Intronic
1131175421 15:90206250-90206272 TGTGGCCCTCCCTGGGGATCGGG + Intronic
1132826963 16:1909935-1909957 TGTGCCCTCCCCTGGGGATAGGG - Intergenic
1134372481 16:13638287-13638309 TGTGACCTTATTTAGGGATAGGG - Intergenic
1135092376 16:19528881-19528903 TTTTTCCTTCTTTTGGGATAGGG - Intronic
1135092385 16:19528932-19528954 TTTTTCCTTCTTTTGGGATAGGG - Intronic
1135271664 16:21074823-21074845 TCTGGCTTGCTTTTGGGATAGGG - Intronic
1135818326 16:25656363-25656385 CTTGGCCTTCTCATGGGATGTGG - Intergenic
1136265579 16:29115654-29115676 TGTGGCCCTGACTTGGGATTTGG - Intergenic
1138686770 16:58733521-58733543 TTTGGCCTTTGCTTGGGAAAGGG - Intronic
1138718262 16:59048766-59048788 TGTGACCTTCTATGGGAATAGGG + Intergenic
1138721974 16:59092668-59092690 TGGGGGCTTCTGTTGGGAGAGGG + Intergenic
1139401380 16:66684558-66684580 TGTGGCCTTTTCTCGAGATGGGG - Intronic
1140016486 16:71191883-71191905 TGATGCCTACACTTGGGATATGG - Intronic
1140751659 16:78029785-78029807 TAAGGCCATGTCTTGGGATAGGG + Intronic
1140829465 16:78737948-78737970 GGTGCCTTTCTCTTGGGATGGGG - Intronic
1140932700 16:79642430-79642452 TCTGGCCTTGTCTTGGGTGAAGG - Intergenic
1141065523 16:80910827-80910849 GTTGGCCATCTCCTGGGATAAGG + Intergenic
1141192700 16:81835995-81836017 TGTGGCCTTCTTTGGAAATAGGG - Intronic
1141505833 16:84477815-84477837 TGTGGGCTTCTCTTGGTGCACGG - Exonic
1142054391 16:87983587-87983609 TGTGGCCCTGACTTGGGATTTGG - Intronic
1143100889 17:4504110-4504132 TGTGGCTCTCTCTTTAGATAAGG + Intronic
1143666977 17:8368399-8368421 TATGGCCTTCTCAGGGGAGAAGG + Intergenic
1144411685 17:15007780-15007802 TCTTGCCTTCTCTTGGGTTCAGG + Intergenic
1145764786 17:27451137-27451159 TGTGCCCAACTCTAGGGATACGG - Intergenic
1146811987 17:35911208-35911230 TGGGGCCTTCTCTTGGGTTGTGG + Intergenic
1151306070 17:73263360-73263382 TGGGGCCATCTCTGAGGATAGGG - Intergenic
1151727203 17:75892058-75892080 TGTGGCCTCCTCTTGGAAGAGGG - Exonic
1152211598 17:79005337-79005359 TGAGCCCTTCTCCTGGGAAAGGG - Intronic
1152312916 17:79561763-79561785 TGTGCCCCTCTCTTGGGAAGAGG - Intergenic
1153956072 18:10097372-10097394 TGGGCCATTCTCCTGGGATACGG + Intergenic
1156490809 18:37494865-37494887 TGTGGCCTTCTCTTGGGATAAGG + Intronic
1157159885 18:45304302-45304324 TGTGGGTTTCTCATGGCATAGGG + Intronic
1157533499 18:48441691-48441713 TCTGGCCTCCTCTTTGGAAAAGG + Intergenic
1159159902 18:64630652-64630674 TTTTGCCTTTTCTTAGGATATGG - Intergenic
1159957969 18:74533181-74533203 TGTGACCTTCTATGGAGATAGGG + Intergenic
1160067082 18:75585398-75585420 TGTGTCTTTCTCTTTGAATAAGG + Intergenic
1164271558 19:23677385-23677407 TTTGGCCTTTGCTTTGGATATGG - Intronic
1164530411 19:29044102-29044124 CGTGGCCTTCTCCTAGGAGAAGG - Intergenic
1165073560 19:33268948-33268970 TGTGGGAGTCTCTTGGGAAAGGG - Intergenic
1166920007 19:46222794-46222816 TGTGTCCTTCTGTTGGGAGGAGG - Intergenic
1167036056 19:46995587-46995609 TGTGGCCTTCTCTTGGCCTCTGG + Intronic
1167360732 19:49028973-49028995 TCTGGCCTTCTGTGGGGAGAAGG - Intronic
1167365649 19:49053756-49053778 TCTGGCCTTCTGTGGGGAGAAGG - Intergenic
925581855 2:5418571-5418593 TCTTGTCTTCTCTTGGGAAATGG - Intergenic
926831672 2:16969516-16969538 TGTGGACTTCTGTTTGGAAAAGG + Intergenic
927083645 2:19654059-19654081 TGTGGACTTCTCTTGGGGTCAGG - Intergenic
927603794 2:24467817-24467839 TGTGGCTTTCTCTCAGGAAAAGG + Intergenic
928791852 2:34966184-34966206 TGTAGGCTTCTCCTGGGAAAAGG - Intergenic
929818084 2:45251833-45251855 TGTGGTCTCCTCTTTGGATCAGG - Intergenic
930185730 2:48410626-48410648 TGTAGGCTTCTCTTGGCAAAAGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
933899735 2:86840844-86840866 TGTGACCTTCTCCTGGCATCTGG - Intronic
934718899 2:96559211-96559233 TGTGGCCTTATTTGGGAATAGGG + Intergenic
935590805 2:104844378-104844400 AGGGTCCTTCTCTTGGGAGAGGG - Intergenic
936600093 2:113887490-113887512 TGTTGCCTTCTGTTGGGTTGTGG + Intergenic
937001939 2:118475641-118475663 TATTTGCTTCTCTTGGGATATGG - Intergenic
939008149 2:136813409-136813431 TTTTTCCTTCTCTTGGGAAATGG - Intronic
940135744 2:150434467-150434489 TGTGGCATTTTCTTGGGAAGAGG - Intergenic
941012136 2:160312263-160312285 TGTGTCCTTCTCTTTGCATTAGG - Intronic
944578672 2:201113735-201113757 AATGGCTTTCACTTGGGATAGGG + Intergenic
946140400 2:217685586-217685608 TGTGTCCTTCACTTGGGCTGGGG - Intronic
946653993 2:221925262-221925284 TTTGACCTTCTCTTGGCAGATGG - Intergenic
947844080 2:233230098-233230120 CTTGGACTTCTCTTGGGCTAAGG + Intronic
947986305 2:234450488-234450510 TCAGGTCTTCTCTGGGGATATGG - Intergenic
948222853 2:236287297-236287319 TGTGGGCTTCCCTTGGGCTGTGG + Intergenic
948430573 2:237915906-237915928 TGTGGCCTTATCTGGAAATAAGG + Intergenic
1168921263 20:1537985-1538007 TGGGGCCACCTCTTGGGAGAAGG + Intronic
1168987098 20:2058839-2058861 TGTGGCCTCCTCATGTGACAGGG + Intergenic
1169675892 20:8154436-8154458 TGTAGCCCTCTCTGGGAATATGG + Intronic
1176181166 20:63750178-63750200 TGTGGCCTTCTCTGGGGTCCTGG - Intronic
1177239952 21:18443608-18443630 TGTGGCCTCCACTGGGGCTATGG - Intronic
1182951216 22:34377714-34377736 TGTGGCCTTCTCTAGAGCCAAGG - Intergenic
1184074206 22:42165698-42165720 TGTGGGTTTCTCTTGGGAGTTGG - Intronic
1184469112 22:44685571-44685593 TGTGGCTTTCACTGGGGAGAGGG - Intronic
1184469118 22:44685594-44685616 TGTGGCTTTCACTGGGGAGAGGG - Intronic
1184469125 22:44685618-44685640 TGTGGCTTTCACTGGGGAGAGGG - Intronic
1184675575 22:46040895-46040917 TGTGACCTTCTCTGAGGACAGGG + Intergenic
1184823701 22:46932669-46932691 TGTGGCATTCTCTGAGGATAGGG + Intronic
953850138 3:46459755-46459777 TGTGGCCTCGGGTTGGGATACGG + Exonic
955157108 3:56427544-56427566 TGTAACCTTCTCTGGAGATAGGG + Intronic
957773933 3:84730716-84730738 TCCGGCTTTCTCTTGGGATTTGG + Intergenic
960178045 3:114540552-114540574 TGTAGCCTGCACTGGGGATAAGG - Intronic
962098492 3:132316773-132316795 TGTGGCTGTCACTTGGGAAAGGG - Intergenic
964423867 3:156532177-156532199 AGTGGCCATCTCATGGGATAGGG - Intronic
964823930 3:160804996-160805018 TGTGACCTTCTCCTGGCATCTGG + Intronic
964979867 3:162665685-162665707 TGTGGGCTAGTCTTGGGCTATGG + Intergenic
965839932 3:172893193-172893215 TGTGGCCTTATCTGGAGATAGGG + Intronic
966600694 3:181772437-181772459 TGAGGCCATCTCTTGGGACATGG + Intergenic
969074977 4:4570700-4570722 TGTGACTTTCTCATGGGGTAGGG + Intergenic
969176758 4:5404746-5404768 TGTGGCCTTATCTGGAAATAAGG - Intronic
969313757 4:6369586-6369608 GGGGGCTTTCTCTTGGGGTAGGG - Intronic
969499104 4:7542318-7542340 TGTGTCCTTCTTTGGGAATAGGG + Intronic
973976988 4:56272448-56272470 TGGGACCTTCTCTTCGGATGAGG + Exonic
975545590 4:75557159-75557181 GGGGGCCTTGCCTTGGGATATGG - Intronic
975885806 4:78963437-78963459 TGTGTCCTTCTCATGGCAGATGG - Intergenic
978770410 4:112450591-112450613 TCTGGCCTTCTCTTGGCATCTGG - Intergenic
979954748 4:126938955-126938977 CTTGGCCTTCTGTTGGGGTATGG - Intergenic
980096884 4:128500984-128501006 TGTGGAATTCTCTTGTTATAAGG - Intergenic
980610910 4:135162336-135162358 TGTGGCCTTATTTAGAGATAGGG + Intergenic
983184488 4:164685922-164685944 TGTTGCCTTCTCTTTGGAAGAGG - Intergenic
983202354 4:164874568-164874590 TGTGGCCTTATTTTGAAATAGGG - Intergenic
985011888 4:185591345-185591367 TGAGGCCTTTTCTTGAGAGAGGG + Intronic
990675163 5:58176091-58176113 TGTGGCCTTATCTGGAGAAAGGG - Intergenic
995132942 5:108649281-108649303 TGTGAATTTCTCTAGGGATATGG + Intergenic
995183355 5:109248993-109249015 TGGGGCCTGCTCATGGGAGAAGG + Intergenic
995229518 5:109743400-109743422 TGTAGCATTCTCTTGAGTTAAGG + Intronic
995480943 5:112592100-112592122 TGTGGCCTTATCTGGAAATAGGG - Intergenic
995744439 5:115389371-115389393 TGTGGGATTCTCTTTGGTTATGG + Intergenic
995768805 5:115647560-115647582 TGAGGCCTTTTCTTTGAATATGG + Intergenic
996230729 5:121060587-121060609 TGTGGCTCTCTTATGGGATATGG + Intergenic
996751854 5:126896677-126896699 TATGGCCTTCTCATGGAAGAGGG + Intronic
997472463 5:134124495-134124517 TCTGGCCTTCTCCTGGGAGGAGG + Intronic
998004382 5:138647488-138647510 TGTGGCCTGTTCTAGGGATGGGG - Intronic
998357823 5:141555990-141556012 TGTGCCCTTCCCTTGGGCAAGGG + Intronic
999210575 5:149885023-149885045 TGTGGCTTTCTCTGGGGAAGGGG - Intronic
999305380 5:150515985-150516007 TTTGGCCTTCTCTGAGGACAGGG + Intronic
999846327 5:155484640-155484662 AGTGGCCTTATCATGGGATAAGG - Intergenic
1000461050 5:161518336-161518358 TGAGGCCTCCACTTGGGAGATGG - Intronic
1003248091 6:4401031-4401053 TGTAGCCTTCTCTGAGGATGGGG - Intergenic
1006109708 6:31737100-31737122 TGTGGCCTACACTTGGGATTGGG + Exonic
1007727904 6:43927761-43927783 TGGGGCCTTCTCTTAGTCTAAGG + Intergenic
1015265218 6:131284928-131284950 TGTAGCCTTGTCTTGTGACAGGG + Intergenic
1015590930 6:134822316-134822338 TTTTGCCTACTCTTGTGATATGG - Intergenic
1016173621 6:141051079-141051101 TGTGGTCTTTTTTTGAGATAAGG + Intergenic
1017302215 6:152875038-152875060 TGTGGGCTGCTCTGGGAATAGGG + Intergenic
1019937166 7:4264388-4264410 TGTGGACCTCTCCTGGGGTAAGG + Intronic
1019937226 7:4264621-4264643 TGTGGACCTCTCCTGGGGTAAGG + Intronic
1019937246 7:4264708-4264730 TGTGGACCTCTCCTGGGGTAAGG + Intronic
1021498964 7:21308156-21308178 TGTGACCTTATTTGGGGATATGG - Intergenic
1022497519 7:30862301-30862323 TGTGGCTGTCTCATGGGATCTGG - Intronic
1024043297 7:45571384-45571406 TGTGGCCTTATCTGGAAATAAGG - Intergenic
1024274829 7:47669139-47669161 TGTGACCTTCTTTGGAGATAGGG - Intergenic
1024336535 7:48212201-48212223 TGTTGCATTCTATTGTGATAGGG + Intronic
1029203629 7:98855427-98855449 TGTGGCCTGCTCTTAGGAGAGGG - Intronic
1031038619 7:116815169-116815191 CATGGAGTTCTCTTGGGATAAGG + Intronic
1034991658 7:155551333-155551355 TGTGGCCTTATTTGGGAATAGGG + Intergenic
1036619246 8:10413071-10413093 AGTGGCCTTCAGTTGGGAAATGG + Intronic
1037124295 8:15326832-15326854 TGTGGCCTTCTCTGAGTACAGGG - Intergenic
1037646063 8:20793838-20793860 TGTGTGCTTGTGTTGGGATAGGG + Intergenic
1039059989 8:33565721-33565743 TGTGGCCTTCACTTGGGCTCAGG + Intronic
1041279463 8:56196449-56196471 TGTGACCTTCTGTCTGGATATGG + Intronic
1042323737 8:67506142-67506164 GCTGGCCCACTCTTGGGATAGGG + Intronic
1045124840 8:99078491-99078513 TGTGGCTTTTTCTTGGGAGGAGG + Intronic
1045294451 8:100861329-100861351 TGTGGCCTTCTTTGGAAATAAGG - Intergenic
1046724099 8:117655737-117655759 TCTGGCCTTCTCCTCGGAAAGGG - Intergenic
1048964527 8:139605963-139605985 TCTGGCCTTCTCTGTGGAGATGG - Intronic
1049930188 9:448780-448802 TGTGACCTTCTTTGGAGATAGGG - Intronic
1051707869 9:19899504-19899526 ACTGGCCTTCTCCTGGTATAAGG - Intergenic
1053016265 9:34664044-34664066 GTAGGCTTTCTCTTGGGATAGGG + Intronic
1053143980 9:35699550-35699572 TGTGGAGTGCTCTAGGGATAGGG - Intronic
1055533333 9:77210242-77210264 TGAGGCCTTGTCTTGGGAAGGGG - Intronic
1055666636 9:78559686-78559708 TGTGGCCTTCTGAAGGGAGAAGG + Intergenic
1058446858 9:105062445-105062467 TGTGGCCTTCTGCTGGGAGGTGG + Intergenic
1058528033 9:105879438-105879460 TTTGGGCTTCTCTGGAGATAAGG - Intergenic
1058887946 9:109337009-109337031 TGTTGCCTTCACTTGGGTCAGGG + Intergenic
1058920674 9:109611723-109611745 TGAGCCCTGCTCTTGGGACAGGG + Intergenic
1059098884 9:111450260-111450282 TGTGGCCTTCTCTTACTATTAGG - Intronic
1060162040 9:121372558-121372580 TCAGGCCTTCTCTTGGGGTGTGG + Intergenic
1061013550 9:127969105-127969127 TCAGGCCTTCTCCTGGGATTTGG + Intronic
1188560406 X:31461946-31461968 TGTGGTCCACTCCTGGGATATGG - Intronic
1190949653 X:55130727-55130749 TGTGGCCCTGTCTTGTGAAAAGG - Intronic
1191646579 X:63488192-63488214 TGTTGCTTTCTGTTGGGACAGGG - Intergenic
1192587923 X:72334574-72334596 TTTGGACTTCTCTTGGAAAATGG - Intronic
1194355476 X:92878710-92878732 TGTGGCTTTTTCTTGGCTTAGGG - Intergenic
1197500623 X:127237418-127237440 TGTAGCATTACCTTGGGATATGG + Intergenic
1197970529 X:132110481-132110503 TTTTGCCTTCTGCTGGGATAAGG + Intronic
1198274879 X:135090810-135090832 TGGGGCCTTCTCCTTGGACATGG - Intergenic
1198950398 X:142063963-142063985 TGTGAGCTCTTCTTGGGATAGGG + Intergenic
1199736090 X:150688029-150688051 TATGGCAGTCTCTTGGCATATGG + Intergenic