ID: 1156494933

View in Genome Browser
Species Human (GRCh38)
Location 18:37519426-37519448
Sequence CTTCTGCAGGTCATCTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156494924_1156494933 17 Left 1156494924 18:37519386-37519408 CCTCCTCACTTTGTCTGGCTTTG 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1156494933 18:37519426-37519448 CTTCTGCAGGTCATCTTTCTTGG 0: 1
1: 0
2: 0
3: 22
4: 192
1156494925_1156494933 14 Left 1156494925 18:37519389-37519411 CCTCACTTTGTCTGGCTTTGTTT 0: 1
1: 1
2: 4
3: 50
4: 520
Right 1156494933 18:37519426-37519448 CTTCTGCAGGTCATCTTTCTTGG 0: 1
1: 0
2: 0
3: 22
4: 192
1156494923_1156494933 18 Left 1156494923 18:37519385-37519407 CCCTCCTCACTTTGTCTGGCTTT 0: 1
1: 0
2: 2
3: 53
4: 471
Right 1156494933 18:37519426-37519448 CTTCTGCAGGTCATCTTTCTTGG 0: 1
1: 0
2: 0
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156494933 Original CRISPR CTTCTGCAGGTCATCTTTCT TGG Intronic
901530922 1:9852023-9852045 CTACTGCAGGTATTCTCTCTGGG + Intronic
901844386 1:11972756-11972778 CTGCTGCAGGTCAGCTTACAGGG - Intronic
905480035 1:38255436-38255458 CTTCTTTAGGTCAAGTTTCTAGG + Intergenic
908030123 1:59990217-59990239 CTTCTCCTGGTCATTATTCTAGG - Intronic
910118918 1:83762274-83762296 ATTCTGCATGTCACCTCTCTGGG - Intergenic
911276661 1:95868647-95868669 CTTTTCCAGGTCTTCATTCTAGG + Intergenic
914077557 1:144370042-144370064 ATTCAGCAGGTCATATTTTTGGG + Intergenic
914101622 1:144596463-144596485 ATTCAGCAGGTCATATTTTTGGG - Intergenic
914172468 1:145238583-145238605 ATTCAGCAGGTCATATTTTTGGG + Intergenic
914297344 1:146341048-146341070 ATTCAGCAGGTCATATTTTTGGG + Intergenic
914527111 1:148479585-148479607 ATTCAGCAGGTCATATTTTTGGG + Intergenic
914639287 1:149587550-149587572 ATTCAGCAGGTCATATTTTTGGG - Intergenic
914733490 1:150393790-150393812 GTTCTGCAGGACATCTGGCTTGG + Intronic
916826446 1:168446278-168446300 CTTCTCCAGGCCATCTTCCAGGG + Intergenic
919267930 1:195296800-195296822 TATTTGCAGGTCATTTTTCTAGG + Intergenic
919968054 1:202549136-202549158 CTTCTGAACTTCATCTTTCAAGG + Intronic
1064752298 10:18543221-18543243 CAGCTGCAGGGCATCTTTCTTGG + Intergenic
1068796098 10:61082041-61082063 CTTCTGAAGGTCAGATTCCTGGG - Intergenic
1069756797 10:70778563-70778585 CTTCTTCAGTTCATCCTCCTTGG + Exonic
1070701926 10:78610104-78610126 CCTCTGCAGGTCATGTTGCTTGG + Intergenic
1071436376 10:85651548-85651570 CTTCTGCAAGTCATCCTTTTAGG - Intronic
1071919442 10:90332633-90332655 CTTCTGCAGATCACCTTTATGGG - Intergenic
1072439952 10:95445580-95445602 CTTCTGCTGGTCAAGGTTCTTGG - Intronic
1076031935 10:127166627-127166649 CCTCTGTAGGTCATCTGTATGGG + Intronic
1076040270 10:127241632-127241654 ATTCTTCTGGTCTTCTTTCTAGG + Intronic
1077115471 11:882707-882729 TTTCTGGAGGACATCTTTCCTGG - Intronic
1078305561 11:10182283-10182305 TTCCTGTAGGTCATCTCTCTAGG - Intronic
1078397704 11:10995997-10996019 CTTCTGCATTTGTTCTTTCTGGG - Intergenic
1079904515 11:26228801-26228823 CTTCAGCTGTTCATCTTTCTAGG - Intergenic
1082228355 11:49735164-49735186 TGTCTGCAGGTCAACTTTCCAGG + Intergenic
1082229225 11:49743333-49743355 CATCTGCAGCTCAACTTTCCAGG + Intergenic
1084360452 11:68665524-68665546 CTTCTTCACGTCTTATTTCTGGG - Intergenic
1084707127 11:70822067-70822089 TTTCAGGAGGTCTTCTTTCTTGG - Intronic
1085849624 11:80104773-80104795 CATCTGGAAGTCATTTTTCTCGG - Intergenic
1086554307 11:88091062-88091084 CTTCTCCTGGTCCTTTTTCTTGG - Intergenic
1086620860 11:88885809-88885831 CCTCTGCAGCTCAACTTTCCAGG - Intronic
1086755244 11:90553165-90553187 CTTCTACATGTCTTCATTCTAGG + Intergenic
1087125190 11:94618561-94618583 CATCTGCAGCTCAGCTTTCATGG - Intronic
1087934391 11:104015441-104015463 GAACTACAGGTCATCTTTCTTGG + Intronic
1088095897 11:106101265-106101287 CCTCTGCAGGTCACCTTTAGGGG + Intergenic
1089396396 11:118138799-118138821 CTTTTCCTGCTCATCTTTCTTGG - Intronic
1089613675 11:119683509-119683531 CATCTGCAGGTCACCTGACTGGG + Intronic
1093382919 12:18517133-18517155 CTTTTGCAGGTGATCTTTGGTGG + Intronic
1096031078 12:48415642-48415664 ATGCTGCAGGTCTTCTTTCCAGG + Intergenic
1096091402 12:48904237-48904259 CTTCTGGAAGTCCCCTTTCTAGG + Exonic
1101986700 12:109452750-109452772 CTTCTGGAGGTCTTCTGTCCTGG - Intronic
1102087740 12:110157504-110157526 CTCTTTCAGTTCATCTTTCTTGG + Intronic
1102802186 12:115745371-115745393 TTTCTGCAGGTCAGGTATCTAGG + Intergenic
1105021872 12:132822090-132822112 CTCCTGGAGGCCATCTTGCTCGG + Exonic
1105937198 13:25113524-25113546 CTACTGAATGACATCTTTCTAGG + Intergenic
1109318812 13:60784353-60784375 CTTTTGAAGGACACCTTTCTAGG + Intergenic
1109319386 13:60791121-60791143 CTTCTAAATGTCATCTTTGTTGG - Intergenic
1112660768 13:101504982-101505004 ATTCAGCAGGTCATCTCTCCAGG + Intronic
1115404426 14:32998772-32998794 CTTCTTCCTGTCTTCTTTCTTGG + Intronic
1116866961 14:50039091-50039113 CTTCATCATGTCATCTTTCTTGG + Intergenic
1118751803 14:68813251-68813273 CTGCTGCAGGTCTGCTTTCTGGG - Intergenic
1119470764 14:74897125-74897147 CTTCTGCAGCTCTTGTGTCTTGG + Intronic
1119669771 14:76509567-76509589 CTTCTGCAGGGCATGTCTTTGGG - Intergenic
1127773049 15:62245706-62245728 CTTCTTCAGTTCGTGTTTCTGGG + Intergenic
1129160864 15:73746933-73746955 AATCTGCTGGTCATGTTTCTGGG - Intronic
1129467133 15:75730523-75730545 CTTCTGCAAGTCACCTCTCTGGG - Intergenic
1129492583 15:75943362-75943384 CTTCAGCACATCAGCTTTCTGGG + Exonic
1129720098 15:77873196-77873218 CTTCTGCAGGTCACGTCTCTGGG + Intergenic
1129912794 15:79242086-79242108 TTTCTGCATGACATCTTTTTTGG - Intergenic
1131064194 15:89422917-89422939 CTTCTGGAGGAGTTCTTTCTGGG + Intergenic
1132362489 15:101228604-101228626 CTTTTAAAGGACATCTTTCTTGG - Intronic
1134292284 16:12912030-12912052 CTGCTGGTGGTCATCTTCCTTGG + Intronic
1134628781 16:15741823-15741845 CTTCTGCAGTTCATCCTCCTTGG + Exonic
1135570604 16:23546398-23546420 CTTGGGCAAGTCATCTTTCTGGG + Intronic
1137391571 16:48085673-48085695 CTTCTGCCTGTAATTTTTCTGGG + Exonic
1137581617 16:49637025-49637047 CTTCTGCAGGTCATCCACCGAGG + Exonic
1139151951 16:64392767-64392789 CTTCTTCAGCTTGTCTTTCTAGG - Intergenic
1141771841 16:86094290-86094312 CTGCACCAGGTCATCTTCCTGGG + Intergenic
1145909129 17:28532641-28532663 CTTTTGAAGATCATTTTTCTGGG + Intronic
1148869961 17:50652031-50652053 CTTTTGCAGCTCATCTGACTTGG - Intronic
1149054045 17:52341309-52341331 AATCTGCAGGACATTTTTCTGGG - Intergenic
1150546888 17:66168239-66168261 CGTGTGCAGGGAATCTTTCTGGG - Intronic
1151565358 17:74894380-74894402 CATCCGGAGGTCATCATTCTGGG + Intergenic
1156494933 18:37519426-37519448 CTTCTGCAGGTCATCTTTCTTGG + Intronic
1158508331 18:58067114-58067136 CTTCTGCTGTTGATCTTTCTCGG - Intronic
1159977579 18:74733741-74733763 TTGCTGCAGGTCAGCTTTCATGG + Intronic
1160437323 18:78861777-78861799 CTTCTGCAGGTGATATTCCTGGG - Intergenic
1161315220 19:3614493-3614515 CAGCTGCAGGTCATCTTCCAGGG - Exonic
1162234572 19:9297894-9297916 CTTATCCAGGGCATCTTTATGGG - Exonic
1162940149 19:14004636-14004658 CTTCTCCAGGTACTTTTTCTAGG - Intronic
1163586740 19:18168483-18168505 CTTCTGCCGGGCGCCTTTCTGGG - Exonic
1165134853 19:33661439-33661461 CTTGTGGAGGTCACCTTTATGGG + Intronic
1166772779 19:45294361-45294383 TTTCTGCGGGTCATCATGCTAGG - Exonic
926445117 2:12932282-12932304 GTTCTGCAGGTCAGATTTCCAGG + Intergenic
930305774 2:49672921-49672943 GTTCTGCAGGTCAGAATTCTAGG + Intergenic
931161621 2:59698522-59698544 CTTCTCCAGGACATCAGTCTGGG - Intergenic
931522519 2:63114661-63114683 CTTCTGAAAGTCAGCTTTTTTGG + Intergenic
931616801 2:64167565-64167587 CTTCTCCAGGAAATCTTCCTTGG + Intergenic
933310996 2:80661130-80661152 CTTCTGTAGGCCATATTTGTTGG - Intergenic
934726463 2:96623420-96623442 TTTCTACAGGTCATTGTTCTAGG + Intronic
935083560 2:99822976-99822998 CTGCTGCACCTCATTTTTCTGGG + Intronic
935611785 2:105033234-105033256 CTTCTGCAGGGTATATATCTAGG + Intergenic
936540858 2:113350096-113350118 CTTCTGCCGGACATTCTTCTAGG - Intergenic
937329941 2:121020076-121020098 CTTCTGCAGGACATCTGGCCTGG + Intergenic
938805917 2:134807173-134807195 CTACAGCAGGTCAACTATCTAGG - Intergenic
940005823 2:149008653-149008675 TTTCAGCAGGTCATTTGTCTTGG + Intronic
941304559 2:163846483-163846505 CAGCTGGAGGTCATCATTCTGGG + Intergenic
942848716 2:180457069-180457091 CCTCTGCAGGACATCTCTCCTGG + Intergenic
942901082 2:181119436-181119458 CATATGCAAGTCATCTTTTTAGG + Intergenic
943399819 2:187393797-187393819 CTGATTCAGGTCATCTTGCTTGG + Intronic
944024230 2:195144235-195144257 CTTCTGCCTCTCACCTTTCTTGG + Intergenic
945811078 2:214550942-214550964 CTTCAGCACTCCATCTTTCTGGG + Intronic
946800553 2:223411460-223411482 CTTCTCCGGGTCATCTTCTTGGG - Intergenic
947671063 2:231935534-231935556 CATCGCCAGGTCATCTTCCTTGG - Intergenic
947960091 2:234229212-234229234 CTTCTCCAGGTTGTCTTACTGGG + Intergenic
1170882484 20:20309394-20309416 TTGCTGCAGGTCTTATTTCTAGG - Intronic
1173103602 20:40110529-40110551 CATCTGCACATCATTTTTCTTGG - Intergenic
1173335570 20:42109999-42110021 CCTCTGCAGCTCGGCTTTCTTGG - Intronic
1173599919 20:44287293-44287315 CTTCTGCAGGACAGTTCTCTGGG + Intergenic
1173772811 20:45678339-45678361 CTTTTGCAGGTGCTCTTTCATGG + Intergenic
1175314288 20:58036518-58036540 ATTCTACAGGTCAATTTTCTTGG + Intergenic
1175603357 20:60292805-60292827 CTTGTACATGTCCTCTTTCTAGG - Intergenic
1176975197 21:15312863-15312885 TTTTTGAAGGTCATCTTTCTTGG - Intergenic
1177496433 21:21897726-21897748 AGTCTGCAGGTCAACTGTCTAGG - Intergenic
1178566981 21:33695830-33695852 CTGCTGCTGGTCATCTTTCCTGG - Intronic
1182482375 22:30617450-30617472 CTTCTTCAGGACATCTTCCACGG - Exonic
1183115183 22:35686345-35686367 CTTCTGCAGCACAGCTCTCTGGG - Intergenic
1183159578 22:36103153-36103175 CTTCTTTAAGTTATCTTTCTTGG + Intergenic
1183193923 22:36340319-36340341 CACCAGCTGGTCATCTTTCTGGG - Intronic
949200508 3:1372915-1372937 CTACTGCAGATAAACTTTCTAGG - Exonic
949973224 3:9429521-9429543 ATTTTGAAGGTCCTCTTTCTAGG - Intronic
950573619 3:13817510-13817532 CTGCTGGAGGACAGCTTTCTAGG + Exonic
950655597 3:14434442-14434464 CTTCTGCAGGTCAGCTTGGTAGG + Intronic
952858230 3:37790952-37790974 TTTCTGCAGGCCAGCTTTCCAGG - Intronic
957856735 3:85889097-85889119 CAGCTGCAGGTCAAGTTTCTTGG - Intronic
958045838 3:88282627-88282649 TTTGTGCTGGTCATCTTTGTGGG - Intergenic
958905284 3:99935428-99935450 CTCCTGAAGGTTATCGTTCTAGG - Intronic
958978935 3:100697966-100697988 CTTCTTCGGTTCTTCTTTCTGGG - Intergenic
959871044 3:111328735-111328757 CTACTGCAAGGCTTCTTTCTAGG - Intronic
960643932 3:119857109-119857131 CTTCTGCGAGTCATCTTTTGTGG + Intronic
962390895 3:134971685-134971707 CATCTGCAGGGCATCATGCTGGG - Intronic
962760024 3:138502921-138502943 CATCTGTAGTTCACCTTTCTTGG + Intronic
963127957 3:141832831-141832853 CATCAGAAGGCCATCTTTCTCGG - Intergenic
966591005 3:181682872-181682894 ATTCTGCAGGACATTGTTCTGGG - Intergenic
966642441 3:182205740-182205762 CTTCTTCAGGGCATATTGCTGGG - Intergenic
970829263 4:20316950-20316972 ATACTGCAGGTCCTCCTTCTGGG - Intronic
970879621 4:20913643-20913665 CTACTGCAGCTCATAGTTCTAGG + Intronic
972618515 4:40723413-40723435 CCCCTGCAGGTCATCTGGCTTGG - Intergenic
980213840 4:129825340-129825362 CTTTTCTAGGTCATCATTCTAGG + Intergenic
981833342 4:149027513-149027535 GGTCAGCAGGTCATCTTTCCAGG + Intergenic
983825497 4:172253293-172253315 CTTCTTCCAGTCATCTTTTTAGG - Intronic
983911813 4:173248161-173248183 CCTCTGCATGATATCTTTCTGGG - Exonic
984293474 4:177824768-177824790 CTTCAGCAGTTCAACTTTCAAGG + Intronic
986049689 5:4077101-4077123 CTTCTCCAGGTCTGTTTTCTGGG + Intergenic
987573258 5:19693406-19693428 CATCTGAAGTGCATCTTTCTTGG + Intronic
988936881 5:36092719-36092741 TTTCTGCAGATTTTCTTTCTAGG + Intergenic
989980418 5:50636758-50636780 ATTCAGCAGGTCATATTTTTGGG - Intergenic
990832328 5:59972939-59972961 GTTCTGCTGGTGATCTTTTTTGG + Intronic
992979020 5:82147713-82147735 CTTCTGGCTGTCTTCTTTCTTGG + Intronic
997415886 5:133728281-133728303 CTTCTGCAGGTTCTCATTGTAGG - Intergenic
998903184 5:146877711-146877733 CTTCCTGGGGTCATCTTTCTGGG + Intronic
1004108819 6:12694173-12694195 ATTCTGCAAGTCATTTTCCTTGG - Intergenic
1005681915 6:28216665-28216687 CTTCTGCAGTACTTCTCTCTGGG + Intergenic
1005734592 6:28733833-28733855 TTTCTGCAGCTCCACTTTCTAGG - Intergenic
1006548885 6:34803835-34803857 CTGCTTCTGGTCATCTGTCTCGG + Intronic
1006794443 6:36722631-36722653 CTCTTCCATGTCATCTTTCTGGG + Exonic
1008560265 6:52717222-52717244 CTTATTCAGGCCATCTTTCTGGG - Intergenic
1008797857 6:55326706-55326728 CTACAGCACATCATCTTTCTTGG - Intergenic
1009782956 6:68293570-68293592 GTTCTGCAACTCATCTTTCAGGG - Intergenic
1012004754 6:93699113-93699135 TATTTGCAGGTCAGCTTTCTGGG - Intergenic
1013436251 6:110111368-110111390 CTTCTTTAGGTTGTCTTTCTTGG - Intronic
1015605563 6:134951876-134951898 CTTCTGTAGCCCATCTTCCTGGG + Intergenic
1017049010 6:150372889-150372911 CTTCAGCAACTCTTCTTTCTTGG - Intronic
1017805882 6:157945228-157945250 CCTCTGTGAGTCATCTTTCTTGG - Intergenic
1018374781 6:163200855-163200877 CTTCTGCACGTCAGCGTGCTTGG + Intronic
1018423977 6:163663579-163663601 CTCCTGATGGTCACCTTTCTGGG + Intergenic
1020925956 7:14324851-14324873 CTTCTGCAGCAACTCTTTCTAGG - Intronic
1021818969 7:24477970-24477992 CTAATGCAGGGCCTCTTTCTGGG - Intergenic
1022410011 7:30132159-30132181 CTTCTGCAGATGAACTTTCCAGG + Intergenic
1024829179 7:53427986-53428008 CTTCTGCAGGTGTTAATTCTAGG - Intergenic
1026426063 7:70295057-70295079 CTTCTGCCCTTCATCTTTCTAGG - Intronic
1028091302 7:86705991-86706013 CATCTGCAGATAATCTGTCTAGG + Intronic
1029247854 7:99215447-99215469 CATCTGCAGCTGAGCTTTCTCGG - Intergenic
1030537623 7:110789026-110789048 CTTCCCCAGGTCGTCTTTCCAGG - Intronic
1030716909 7:112818616-112818638 CATCAGCAGGTAATCATTCTTGG + Intergenic
1031192574 7:118572998-118573020 CTGCTGCAGAACATCTTTGTTGG - Intergenic
1033145086 7:138864327-138864349 CATCTGCAGATCATCTCTCTCGG - Intronic
1037107105 8:15122465-15122487 TTTTTGTAGGTCATCTTTCCAGG + Intronic
1041700115 8:60779345-60779367 CTTCTACACAGCATCTTTCTGGG - Intronic
1042571910 8:70174822-70174844 CTTCTGCACTTCATCTATGTTGG + Exonic
1043201469 8:77374444-77374466 ATTCTCCAGGTCTTCTTTCAGGG + Intergenic
1043733097 8:83710158-83710180 CTTCTACAGGTCACTCTTCTAGG - Intergenic
1043919215 8:85962006-85962028 CTTCTTCACGTGATCTCTCTGGG - Intergenic
1046517929 8:115287631-115287653 ATTCTGCAGGTGATCTATCTAGG - Intergenic
1047002942 8:120591058-120591080 CTTCTGCAGATGCTCTCTCTTGG - Intronic
1049912010 9:277995-278017 CTTTTGCACTTCATCTTTCAAGG + Intronic
1050109747 9:2201981-2202003 CTCCTGTAGGTCATGATTCTCGG - Intergenic
1051814204 9:21086762-21086784 TTTCTGAAGGTCAACTTTGTTGG - Intergenic
1051877560 9:21807665-21807687 CTTCAGCAGGTAGTCTTTTTTGG - Intronic
1055543644 9:77343100-77343122 CTCCTGCAGGACCTCTTTATCGG - Intronic
1056667591 9:88593296-88593318 CCTCTGCAGGTCAGGCTTCTAGG + Intergenic
1058177413 9:101753310-101753332 CATGTACAGGTCATTTTTCTTGG - Intergenic
1059569324 9:115417422-115417444 CATCTGCTGGTCATAGTTCTGGG - Intergenic
1061562483 9:131414881-131414903 CTTCTGTTGGTCGTCATTCTGGG + Intronic
1061902484 9:133680220-133680242 CTTCTGCGGGTCGCCTCTCTGGG - Intronic
1061912018 9:133729977-133729999 CCTCTGCAGGGCTTCTTTCTGGG - Intronic
1061932751 9:133841703-133841725 CTTCTGCAGGTAATGGGTCTGGG + Intronic
1062232629 9:135490573-135490595 CCTCAGGAGGTCTTCTTTCTGGG - Intergenic
1186304948 X:8246581-8246603 TTTCTGCAGGTCAGGATTCTGGG + Intergenic
1187749415 X:22445569-22445591 CTTCTTCAGGTCATCTGACATGG - Intergenic
1188052748 X:25507812-25507834 TGTTTGCAGGTCATGTTTCTTGG + Intergenic
1189732834 X:44039674-44039696 CTTCTGCAGATACTCTTTATGGG - Intergenic
1192183162 X:68928975-68928997 CTTCAGCTGGGCATCATTCTTGG - Intergenic
1195011123 X:100732950-100732972 CCTCTTCAGGTCCTCTTTATGGG + Intergenic
1195453212 X:105038728-105038750 CTGCTGCAGAACCTCTTTCTAGG + Intronic
1197567801 X:128109865-128109887 ATTCTCCAGGACATTTTTCTGGG - Intergenic
1199445545 X:147916526-147916548 CTCCTGCAGGTTTTCTTTCTTGG + Intronic
1199820907 X:151444740-151444762 CTTTTGCAGATTATCTTTATTGG + Intergenic
1202370304 Y:24191626-24191648 CTTGTGTAAGTCACCTTTCTTGG - Intergenic
1202500480 Y:25478491-25478513 CTTGTGTAAGTCACCTTTCTTGG + Intergenic