ID: 1156498564

View in Genome Browser
Species Human (GRCh38)
Location 18:37542358-37542380
Sequence CTGGCTGCTCTGATCTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156498562_1156498564 -5 Left 1156498562 18:37542340-37542362 CCCACTGAACTTCACGAGCTGGC 0: 1
1: 0
2: 0
3: 9
4: 48
Right 1156498564 18:37542358-37542380 CTGGCTGCTCTGATCTTCCATGG 0: 1
1: 0
2: 3
3: 36
4: 254
1156498563_1156498564 -6 Left 1156498563 18:37542341-37542363 CCACTGAACTTCACGAGCTGGCT 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1156498564 18:37542358-37542380 CTGGCTGCTCTGATCTTCCATGG 0: 1
1: 0
2: 3
3: 36
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156498564 Original CRISPR CTGGCTGCTCTGATCTTCCA TGG Intronic
901783025 1:11607050-11607072 CTGGCTGCTTTCATCTATCATGG - Intergenic
901956329 1:12788258-12788280 CTGACCCCTCTGGTCTTCCAAGG - Intergenic
901979710 1:13024313-13024335 CTGACCCCTCTGGTCTTCCAAGG - Intronic
902021602 1:13350389-13350411 CTGACCCCTCTGGTCTTCCAAGG + Intergenic
902210562 1:14901561-14901583 GAGGCTGCTGTGATCGTCCAGGG + Intronic
903845601 1:26278230-26278252 CTGGGTACTCTGAACTTTCAAGG - Exonic
904013754 1:27405239-27405261 CCAGCTGCTCTGAGCCTCCAAGG + Exonic
904852816 1:33472295-33472317 GTGTCTGCTTTGATCTTTCAGGG + Intergenic
904903789 1:33878674-33878696 CTTCCAGCTCTGACCTTCCAAGG - Intronic
905125709 1:35714833-35714855 GTGGCTGCTCTGGCCTGCCATGG - Exonic
905162284 1:36046857-36046879 AGAGCTGCTCAGATCTTCCAGGG - Intronic
906320646 1:44813462-44813484 CTGCCGGTTCTGCTCTTCCAGGG - Exonic
906620695 1:47275835-47275857 CTGGCTGGTCTCATATTCCTGGG + Intronic
907359920 1:53906212-53906234 CTGGCTGCTCTGGTTCTGCATGG - Exonic
907979968 1:59471848-59471870 CTGCCTGCTCTGCTTCTCCATGG - Intronic
908152886 1:61322449-61322471 CTTACTGCTCTGCTATTCCACGG + Intronic
908608503 1:65827620-65827642 TTGGATGCTCTGATCTTCTTCGG - Intronic
908785745 1:67732960-67732982 CCAGCTGCTCAGATCCTCCAAGG - Intronic
913340408 1:117752619-117752641 CTGTTTTCTATGATCTTCCAGGG - Intergenic
914934565 1:151967172-151967194 CATGGTGCTCTGATATTCCATGG + Intergenic
915565757 1:156711681-156711703 CTGGCTCCTTTGATCCCCCAGGG - Intergenic
915946160 1:160153181-160153203 CTTGGTGCTCAGCTCTTCCAAGG - Exonic
916874010 1:168949120-168949142 CTTGCAGCTCTGAAATTCCATGG - Intergenic
919983650 1:202658143-202658165 CTTTCGGCTCTGATATTCCATGG + Intronic
920034449 1:203056786-203056808 GTTGCTGCCCTGATCCTCCAAGG - Exonic
922057548 1:222055746-222055768 CTTGCCGCTCTCATCATCCAAGG + Intergenic
922975127 1:229777962-229777984 CTTGCTACTCTGGTCTCCCATGG - Intergenic
923752034 1:236755053-236755075 CTGGTTCATCTGGTCTTCCAGGG - Exonic
923927317 1:238647027-238647049 CTCGCTGCACTTTTCTTCCAGGG - Intergenic
1062826502 10:572823-572845 CTGGCTGCCCTGGTCTTTGAGGG - Intronic
1063409834 10:5828761-5828783 CTGGCTGCTCTGACTTGCTATGG + Intronic
1063543141 10:6954787-6954809 CCTGCTGCTCTGAGTTTCCATGG - Intergenic
1065032310 10:21599809-21599831 CTGCCTGCTCTGGCCTCCCAAGG + Intronic
1065328099 10:24568333-24568355 CTGGCAGCCCTGCTCTTCAAAGG - Intergenic
1067032102 10:42884923-42884945 CTGCCTGCTCTGCTTGTCCAGGG + Intergenic
1067708339 10:48627696-48627718 CAGTCTCCTCTGATATTCCAAGG + Intronic
1069598458 10:69687720-69687742 GAGCCTGCTTTGATCTTCCAAGG - Intronic
1069826049 10:71255915-71255937 CTGCCTGCTCTGAGCCCCCACGG + Intronic
1070500910 10:77071608-77071630 CAGGCTGCTCTCATCCTGCATGG - Intronic
1070799199 10:79235208-79235230 CTGGCTCCCCTCATCTGCCATGG + Intronic
1071120581 10:82272359-82272381 CTGGCTGCGCTGATCCTGGAGGG + Intronic
1071553697 10:86586318-86586340 AAGGCTGCTCTGATCCTCCTGGG + Intergenic
1072694258 10:97591153-97591175 CTGGCTGCTCCCCTCTTCCCTGG - Intronic
1073920737 10:108455566-108455588 ATGGCTGCTCTAATCTTTCTGGG + Intergenic
1075163186 10:120042283-120042305 CTTGCTGCTGTGTTCTTCCATGG + Intergenic
1075397607 10:122139238-122139260 CTGGCTGGTCAGCTCTTCCCTGG - Intronic
1078430033 11:11281476-11281498 CTGGCTGCTCAGCTCATCCTTGG + Intronic
1079612975 11:22456149-22456171 CTTCCTGCTCTGCTCCTCCAAGG + Intergenic
1082640420 11:55653453-55653475 CTGGCTGCTTTGACCTTCCCTGG - Intergenic
1083096421 11:60255669-60255691 CTGGCTGTCCTGAGCCTCCAAGG + Intergenic
1083597045 11:63922910-63922932 CTGGGTGCTCTGCTCTGCCAGGG + Intergenic
1084007509 11:66331173-66331195 CTGCCTGCTCTGGGCTTCCTTGG + Intronic
1084169204 11:67392359-67392381 CTGGCGGCTGTCATCTTCCCAGG + Intronic
1084220502 11:67674726-67674748 GTGTCTGCCCTGTTCTTCCAGGG + Intronic
1084520147 11:69657844-69657866 CTGGCTTCTCTGGACTCCCATGG - Intronic
1085510865 11:77087471-77087493 GTGGCTGCTCTGTTCTTAGAGGG + Intronic
1087708600 11:101523134-101523156 CTTCATGCTCTGATCTACCAAGG + Intronic
1089679353 11:120110718-120110740 CAGGCTTCTCTGAGTTTCCAGGG + Intergenic
1091076455 11:132622610-132622632 CTGGCTGGACTGGACTTCCAGGG - Intronic
1091283262 11:134394259-134394281 GTGGCTGCTCTGAACATCGAGGG - Intronic
1091553475 12:1554346-1554368 CTGGCTTCTCTGCTCTGCCCAGG - Intronic
1091593158 12:1857340-1857362 CTGGCTGCTTTGCTCTGCCCTGG - Intronic
1092010210 12:5103771-5103793 CACGCTGCTCTAATATTCCATGG - Intergenic
1094257821 12:28454952-28454974 CTGGATCCTCTGTCCTTCCATGG - Intronic
1095528644 12:43158255-43158277 CCAGCTGCTCTAATCTTCCTAGG - Intergenic
1096592780 12:52672782-52672804 CTGGCTGCTCAGGGCCTCCATGG - Intergenic
1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG + Intronic
1101904350 12:108813889-108813911 ATGGCTGCTCTGGTCTTCCCAGG + Intronic
1102439375 12:112949533-112949555 CTGGCTGCTCTGAGCTTACCAGG + Intronic
1103261742 12:119594348-119594370 CTGACTCCTCTGACCTTCCTAGG + Intronic
1103759034 12:123234305-123234327 CTGGCAGATCTGTTATTCCAAGG - Intronic
1103974145 12:124691019-124691041 CAGCCTGATCTGAACTTCCAAGG - Intergenic
1104041217 12:125132468-125132490 CTTGCAGCTCTCATCTTCCAGGG + Intronic
1105020441 12:132813198-132813220 TTGGCTTCTCTGAGCTGCCATGG - Intronic
1105213325 13:18270729-18270751 CTGGCTGCCCTCAGCCTCCAAGG - Intergenic
1105358969 13:19688638-19688660 CTGGCTGCGTTTATCTTCGATGG + Intronic
1105813761 13:24015667-24015689 CTGGCTGGTCTGACCTTCTAGGG - Intronic
1105911024 13:24867750-24867772 CTGGGTGCCGTGATCTTCCTGGG + Intronic
1106167084 13:27257369-27257391 CTGGAGGCTCTGATGTCCCAAGG + Intergenic
1106191618 13:27458506-27458528 CTGGCTGGTGTGATGTGCCATGG - Intergenic
1108509937 13:51147393-51147415 GTGGCTGCTGTGATCCTCCAGGG + Intergenic
1108592915 13:51926516-51926538 CAGGCTGCTCTAATGCTCCAGGG - Intergenic
1108902901 13:55435220-55435242 CTGTCTGCTCTCCTCTCCCAGGG + Intergenic
1112398687 13:99056953-99056975 CAGGCTGCTCTAATCCCCCAGGG - Intronic
1112973162 13:105285587-105285609 CCAGCTCTTCTGATCTTCCAGGG - Intergenic
1114207184 14:20583162-20583184 CTGGCTCCTCTATTCTTCCATGG + Intergenic
1114532445 14:23404362-23404384 CTGGATGATCTGGTCCTCCAGGG + Exonic
1114537375 14:23431651-23431673 CTGGATGATCTGGTCCTCCAGGG + Exonic
1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG + Intergenic
1115777502 14:36731837-36731859 CTGGCTGCCCTGCTCTCCCCTGG + Intronic
1116130240 14:40847026-40847048 AGGGCTGCTCTCAGCTTCCAGGG - Intergenic
1118469762 14:66065066-66065088 GTGGCTGCTCTGCTCATCCCAGG - Intergenic
1120606501 14:86584626-86584648 CAGGCTGCTCTCATGTTTCAGGG - Intergenic
1120813843 14:88832294-88832316 CTGGATGCTGTGATTTGCCAAGG - Intronic
1121173926 14:91876350-91876372 GATGCTGCTGTGATCTTCCAGGG - Intronic
1121174703 14:91882477-91882499 CTGACTGCTCTGTTCCTGCAAGG - Intronic
1202892128 14_KI270722v1_random:168470-168492 CTGGATGCTCTGTCCTTTCATGG + Intergenic
1123945649 15:25237609-25237631 CCGCCTGCTCTGTTCCTCCAGGG + Intergenic
1124708524 15:31985454-31985476 CTGGCTCATCTGAAGTTCCATGG + Intergenic
1125508474 15:40280875-40280897 CTGGCTGTTATGTTTTTCCAGGG - Intronic
1128632816 15:69282741-69282763 ATGGATGCTCTGCTCTTCCCTGG - Intergenic
1129454732 15:75670602-75670624 CTGGCTGCCCTGCTCCTCCATGG + Intergenic
1129713664 15:77834496-77834518 AGGGCTGCTCTGTGCTTCCAAGG - Intergenic
1131770377 15:95730184-95730206 CTGGGTGCTCTCAGCTTCCTAGG + Intergenic
1131890899 15:96970448-96970470 CTGGCTGGTCTTATCTTCCCTGG - Intergenic
1132143805 15:99415106-99415128 GTGGCTACTCTGTTCTACCAAGG - Intergenic
1133207892 16:4244867-4244889 CAGGCTCCTCTGAACTTCCCAGG + Intergenic
1134136441 16:11679519-11679541 CAGGCTGTGCTGCTCTTCCAGGG + Exonic
1134215238 16:12312072-12312094 GTGGCTGCTCTGAGCTGCAAGGG + Intronic
1135417089 16:22276708-22276730 CTTTCTGCTCTGACCTTCCCTGG - Intronic
1136336735 16:29614786-29614808 ATGCCTGCTGTGAGCTTCCAAGG - Intergenic
1136512056 16:30744135-30744157 CAGCCTGCTCTGTTCTTTCAGGG + Intronic
1137664954 16:50244737-50244759 CCAGCTGCTCAGATCTTCCCGGG + Intergenic
1138341262 16:56290485-56290507 CTACCTGCTCTGATTTTACAAGG - Intronic
1141275696 16:82585902-82585924 CTGGCTGCTGGGACCTCCCAGGG + Intergenic
1141434304 16:83990603-83990625 CTGGCTGGTCTGTTCCTCGATGG - Exonic
1141703522 16:85652988-85653010 CTGGCCCCTCTGAGCTTCCCAGG - Intronic
1141913499 16:87077047-87077069 GTGGTTGCACTGATCTTCCTGGG + Intergenic
1142037461 16:87870570-87870592 ATGCCTGCTGTGAGCTTCCAAGG - Intergenic
1143159257 17:4858372-4858394 CTGGCAGCCTTGTTCTTCCAAGG + Intronic
1143924504 17:10357801-10357823 CTGGATGATCTGATCCTCTAGGG + Exonic
1144386249 17:14751450-14751472 GAGCCTGCTCTGATCTCCCAGGG + Intergenic
1144833349 17:18143824-18143846 GTGCCTGCTCTGATCTGCCTGGG - Intronic
1145286010 17:21506360-21506382 CTGCCTGCTGTGATCTACCGCGG - Intergenic
1146538464 17:33673715-33673737 CTGGCAGCTCTCATCTTCAGGGG + Intronic
1146990549 17:37267205-37267227 CTGGCAGTTCTGATCTTGCCTGG + Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147642940 17:42016105-42016127 CTGGCTTCTCTGATATCCCAGGG + Intronic
1149433565 17:56614834-56614856 CTGGCTCATCAGATCATCCAAGG - Intergenic
1152989128 18:346755-346777 CTGGCTGTTCATATCCTCCAGGG + Exonic
1154028292 18:10727006-10727028 CTGTTTGCTCTGTGCTTCCACGG + Intronic
1155004392 18:21714947-21714969 CTGTCTGCCATGATCCTCCATGG - Intronic
1156252502 18:35364617-35364639 CTTGCTGTTCTGATCTTCTCTGG + Intergenic
1156498564 18:37542358-37542380 CTGGCTGCTCTGATCTTCCATGG + Intronic
1157272962 18:46290633-46290655 CTGGCTGCTCTGAGCCTTCCAGG + Intergenic
1159603819 18:70453966-70453988 CTTGCTGCTCTGAACTTTAATGG - Intergenic
1160143262 18:76345208-76345230 CTGCCTCCTCTGTTCTCCCAGGG + Intergenic
1161324755 19:3658246-3658268 CTCGCTGTTCTGAGCTGCCAAGG - Intronic
1162192343 19:8956832-8956854 CTGGCTCCTCTGAGATTACAAGG - Exonic
1163550046 19:17961364-17961386 CAGGCTGCTCTCATATTCCTGGG - Intronic
1163714132 19:18864228-18864250 CTGGCTGCTCCGATCATAGACGG - Exonic
1165123495 19:33578550-33578572 CTGTCTGCACAGATATTCCAGGG + Intergenic
1166160068 19:40946009-40946031 TTGGCTGCCCTGATTGTCCAAGG + Intergenic
1166169010 19:41013974-41013996 TTGGCTGCCCTGATTGTCCAAGG + Intronic
1166581149 19:43901215-43901237 CTGGCTCCTCGGCGCTTCCAAGG + Intronic
1166766788 19:45255923-45255945 CTGCCTGCTCTGAGCTGCCCTGG - Intronic
1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG + Exonic
1168662920 19:58182293-58182315 CAGGGTGCTCTCATCTTCCTTGG - Intergenic
1168716219 19:58529227-58529249 CAGGCTGCTCTCATATTCCTGGG - Intronic
925878844 2:8333707-8333729 CTGGGTGCTCTGATCTGCCAGGG + Intergenic
926468342 2:13219647-13219669 GTGGCTAATCTGATTTTCCATGG + Intergenic
926799419 2:16646518-16646540 GTGGCTTCTCTGGTCTTGCAGGG - Intronic
927662281 2:25003083-25003105 CTGGCAGCTCTCAATTTCCAGGG - Intergenic
927920986 2:26971359-26971381 CTGGCTGCTCAGAGCTTGCAGGG + Intronic
928948371 2:36792209-36792231 CTGCCTGGCCTGATTTTCCAGGG + Intronic
930838910 2:55824975-55824997 CTAGCTGCTCTGCGCTTCCCTGG + Intergenic
933624769 2:84586095-84586117 CTCCCTGCTCTGATCTTGGAAGG - Intronic
937671330 2:124540623-124540645 TTCCCTGCTCTGATCTTCCTTGG + Intronic
940193368 2:151065934-151065956 CTGGCTTCTATGATCTGCCTTGG + Intergenic
942644241 2:178093794-178093816 CTGGCTCCCCTGGTCCTCCATGG - Intronic
946016916 2:216611341-216611363 CTGGCTTCTCTGACCCTCCTTGG + Intergenic
946256296 2:218444678-218444700 CTGTCTGCTCCAATCTTGCAAGG + Intronic
947463761 2:230324050-230324072 CAGGCTGGTCTGATCCTCCCTGG - Intergenic
947472582 2:230412490-230412512 CAGGCTGGTCTGATCCTCCCTGG - Intergenic
948880262 2:240853228-240853250 GTGGCCTCTCTGATCTGCCAGGG + Intergenic
1169414972 20:5408497-5408519 TGGGCTGCGCAGATCTTCCATGG - Intergenic
1170163144 20:13336374-13336396 CTGCCTCCTCTTATCTCCCAGGG + Intergenic
1172018084 20:31891548-31891570 CTGGCTGGTCTCAAATTCCAGGG + Intronic
1174406721 20:50307537-50307559 CTGGCTTCTTTGAGCTTCCCAGG - Intergenic
1174868023 20:54156754-54156776 GTGGCTGCTTTCATGTTCCAAGG + Intronic
1175390214 20:58622328-58622350 GTGGCAGCTCTGATGTTCCTGGG + Intergenic
1175579670 20:60088618-60088640 TTGGCCTCTCTGCTCTTCCATGG - Intergenic
1175735260 20:61381640-61381662 CTGGTGGCTCAAATCTTCCAAGG - Intronic
1178373046 21:32042963-32042985 CTGGCTGCTATGTCCTGCCAGGG + Intronic
1178718490 21:34988191-34988213 TGGGCTTCTCTGATCTTCCTTGG - Intronic
1179298805 21:40088379-40088401 CTGGGTACTCTGCCCTTCCAGGG - Intronic
1179769793 21:43606071-43606093 CTTCCTGCTCTGCTCTTCCTTGG - Intronic
1179769805 21:43606122-43606144 CTCCCTGCTCTGCTCTTCCTTGG - Intronic
1180054761 21:45351987-45352009 CAAGCTGCTCAGATTTTCCAGGG - Intergenic
1180749787 22:18116330-18116352 CTTGCAGCTCTGAACTCCCAGGG - Intronic
1180783762 22:18535728-18535750 CTGTCTGCTCTGAGGTTCCAAGG + Intergenic
1181127331 22:20709777-20709799 CTGTCTGCTCTGAGGTTCCAAGG + Intronic
1181240663 22:21475080-21475102 CTGTCTGCTCTGAGGTTCCAAGG + Intergenic
1181699361 22:24611153-24611175 CTGGCTGCCCTCAGCCTCCAAGG + Exonic
1181880046 22:25971577-25971599 CTGGCAGCTCTGAGTTTCCCAGG + Intronic
1182775792 22:32830098-32830120 CAGGCTGCTGTGAGCTTGCACGG + Intronic
1182856990 22:33526679-33526701 AAGGCTGTTCTGATCTTCCAGGG + Intronic
1182973796 22:34603388-34603410 CTCCCTCCTCTGAGCTTCCATGG + Intergenic
1183381910 22:37494380-37494402 ATGGCTGCTCTCATCTGCCTGGG - Intronic
1183582769 22:38735603-38735625 CTGGCTGCTGTGATCTTCTAAGG - Exonic
1183903103 22:41021159-41021181 CTGGCTCCTGGCATCTTCCAGGG + Intergenic
949313207 3:2723483-2723505 AGGGCTGCTCTGTGCTTCCAAGG + Intronic
949751142 3:7354071-7354093 CTGGCTTCTCTTTTATTCCAGGG - Intronic
949974283 3:9440800-9440822 CTGGCTAATCTGTTATTCCATGG - Intronic
950450257 3:13061257-13061279 CTGGCTGCTCTGAGCCTCCCTGG - Intronic
950849834 3:16051692-16051714 CTGGCTGGCCTGAGCTTCTATGG + Intergenic
951036456 3:17938317-17938339 CTGCCTGCCCTGCTCTACCAAGG + Intronic
951891951 3:27575788-27575810 CTGGTTGGTCAGATGTTCCAGGG - Intergenic
952138305 3:30449177-30449199 CTGGCTTTTCTAATCATCCATGG + Intergenic
952340156 3:32438774-32438796 CTTCCTGCTCTGAGCCTCCAGGG - Intronic
955649780 3:61181587-61181609 CAGGCTGCTCTGATATTCCCTGG + Intronic
959798792 3:110464917-110464939 CTCCCTGATCTGATCTTCAATGG + Intergenic
959929165 3:111959758-111959780 CTTGCTCCTCAGATCTTCCAAGG - Intronic
960083512 3:113566516-113566538 CAGGTTCCTCTGCTCTTCCAAGG + Exonic
960703048 3:120455771-120455793 GTGGGTGCTTTCATCTTCCAGGG + Intergenic
962258059 3:133885630-133885652 CTGACTGCTCTGGCCTTCCATGG - Intronic
964893365 3:161563421-161563443 CTTGCTCCTCTGTTCTTACATGG - Intergenic
965678524 3:171225545-171225567 CTGCCTTCTCAGTTCTTCCAAGG - Intronic
966767041 3:183472775-183472797 CTAGCTGTTCTGAGCTGCCATGG - Intergenic
969258209 4:6017300-6017322 CTGGCTGCTCTGCCCTGCCCTGG - Intergenic
969591654 4:8125784-8125806 CTGTCTGCTCTGGGCATCCACGG + Intronic
973604055 4:52569601-52569623 CTTACTGCTCTACTCTTCCAGGG + Intergenic
975416057 4:74105971-74105993 CTTGCTGCTCTCTCCTTCCAGGG - Intergenic
981270766 4:142845841-142845863 CTGGCCTCGCTGACCTTCCAAGG - Intronic
984452450 4:179919944-179919966 CTGGTTACTCAGATTTTCCATGG + Intergenic
986217827 5:5737474-5737496 CTGGCTGCTGTGATTTACCTGGG + Intergenic
986292209 5:6409248-6409270 AGGGCTGCTCTCAGCTTCCAAGG - Intergenic
988320991 5:29696660-29696682 CAGGCTGCTCTCAAATTCCAGGG - Intergenic
989339016 5:40353935-40353957 CTGGCTTCTCAGCGCTTCCACGG + Intergenic
992614276 5:78534380-78534402 CAGGCTGCACTGCTCTTCCAGGG + Intronic
993230278 5:85226609-85226631 CTCTCTGCTCTGCTCTTCCTGGG + Intergenic
993877839 5:93328917-93328939 CTGGTTGGTCTTATCCTCCAAGG + Intergenic
994829039 5:104754179-104754201 CTTGCTTCTCTGATGTTCCCTGG + Intergenic
996582546 5:125047706-125047728 CTGGCTGCTTTTCTCTTCAAAGG + Intergenic
997157018 5:131572253-131572275 CTGGCTGGTCTGATGACCCAGGG - Intronic
997201132 5:132010957-132010979 CTGGCTCCTCTGCTCTGCCCAGG - Intronic
997242205 5:132315655-132315677 CTGGCTTGACTGATCTTCCATGG - Intronic
997448500 5:133961812-133961834 CAGGCTGCTCTCATATTCCAGGG + Intronic
997612942 5:135227848-135227870 CTGTCTGCTCTGCTCTCACAAGG + Intronic
998016142 5:138733908-138733930 CCGACTGCTCTGCCCTTCCAGGG - Intronic
998650774 5:144118988-144119010 CTGGGTGCTCTCTGCTTCCAGGG - Intergenic
999384761 5:151146195-151146217 CTGGCCTCTCTGATCTTCCAGGG + Intronic
1003641030 6:7875172-7875194 CTGGGAGCTCTGATGTCCCAGGG + Intronic
1004188163 6:13440128-13440150 CAGGCTGTTCAGTTCTTCCACGG + Intronic
1004376586 6:15095991-15096013 CTGGCTGCCCTGATGTTTGAAGG - Intergenic
1006903537 6:37518120-37518142 TTGGCTGCTCTGGACTTCCCTGG + Intergenic
1009778205 6:68233624-68233646 GTGACTGCTCTGGTCTTCCTTGG - Intergenic
1010365137 6:75041655-75041677 CTGGCTGGGCTGATCTTCCCAGG + Intergenic
1012412224 6:98971480-98971502 CCTGCTGTTCTGATCCTCCATGG - Intergenic
1012473967 6:99601670-99601692 CTGGCTTCTCTGCTCCTCAAGGG + Intergenic
1013159067 6:107523767-107523789 CTGGCTCCTATGATCCTTCATGG + Intronic
1014701420 6:124693586-124693608 TTGCCTTCTCTCATCTTCCAAGG - Intronic
1015290936 6:131537791-131537813 AGGGCTGCTCTCTTCTTCCAAGG - Intergenic
1017892306 6:158648987-158649009 GTGGCTGCTCTGAGCTTCTTGGG + Intergenic
1019125875 6:169839889-169839911 CTGGCTGCCCTTCTCTCCCAGGG + Intergenic
1019371760 7:665745-665767 CTGGCTTCTCTGAGCCTTCACGG - Intronic
1019771790 7:2887933-2887955 CTGGCTGTTCTGTTCTTCAACGG + Intergenic
1022509825 7:30927979-30928001 CTGGCTGACCTGATCTTCCTAGG - Intergenic
1023092008 7:36625860-36625882 CTTCCTGCTCTGATGCTCCAGGG + Intronic
1024120367 7:46231127-46231149 CTGGATGATGTGATCTTCCTGGG - Intergenic
1024911919 7:54456281-54456303 CTTGGTGCTCTCATCTTCCTTGG - Intergenic
1026254115 7:68696035-68696057 CCTTCTGCTATGATCTTCCAAGG - Intergenic
1026384374 7:69831495-69831517 CTGGCTACTTTGATCTTCCCAGG + Intronic
1027034257 7:74913212-74913234 CTGGGGGCTCTGCTCTTCCTGGG + Intergenic
1029395794 7:100307908-100307930 CTGGGGGCTCTGCTCTTCCTGGG - Exonic
1029936636 7:104432044-104432066 CTGGTTTCTGTGATTTTCCAAGG + Intronic
1032856875 7:135842271-135842293 CAGGCTGCTCTGATCTTCTCAGG + Intergenic
1033243797 7:139702248-139702270 CTGGCTGCTCTGAGCTGCAGAGG + Intronic
1033566085 7:142579476-142579498 CTCTGTGCTCTGATCTTCAATGG - Intergenic
1035565458 8:637840-637862 CTGGCTGCTGTGCTCTCGCACGG - Intronic
1037423426 8:18728183-18728205 CTCTCTTCTCTGATTTTCCATGG + Intronic
1037903799 8:22703642-22703664 CTGGCTGCTCTGAGCCCCGAGGG + Intergenic
1037935356 8:22911847-22911869 CTGTGTGCGCTGATCTACCAAGG - Intronic
1037962121 8:23105473-23105495 CTGGCTCCTCTGTTCCTCCATGG - Intronic
1037965401 8:23129988-23130010 CTGGCACCTCTGTTCCTCCATGG - Intergenic
1037969333 8:23160934-23160956 CTGGCTCCTCTGTTCCTCGATGG + Intronic
1037977021 8:23221019-23221041 CTGGCTCCTCTGTTCCTCCACGG + Intronic
1038365209 8:26924529-26924551 AGGGCTGCTCTCAGCTTCCAAGG - Intergenic
1040513677 8:48117338-48117360 CTGCCTGCCCTATTCTTCCATGG + Intergenic
1040594690 8:48825716-48825738 CTGGCTGGGCTGAGCTTCCCAGG + Intergenic
1041263141 8:56038911-56038933 CTGTCTGCTCTGACCTTGCAAGG - Intergenic
1043138402 8:76557198-76557220 AGGGCTGCTCTTTTCTTCCAAGG - Intergenic
1043172794 8:76986446-76986468 CTGGCTGCTCTCCTCTCTCATGG + Intronic
1045099414 8:98829262-98829284 ATGGCTGCTCTGCTATTCCCTGG + Intronic
1049440091 8:142605536-142605558 CTGCTTGCTGTGTTCTTCCATGG + Intergenic
1049595248 8:143480410-143480432 GGGGCTGCTCTGACCTGCCACGG - Intronic
1050471636 9:5997837-5997859 CTGTCTGCTCTGAGCTTACATGG + Intronic
1053722385 9:40959824-40959846 CTGGCTGCTTTTCTCTACCATGG - Intergenic
1054343584 9:63892174-63892196 CTGGCTGCTTTTCTCTACCATGG + Intergenic
1057443986 9:95101045-95101067 CCGGCTCCTCTGATGTCCCAAGG + Exonic
1057603055 9:96475702-96475724 CTGGCAGCTCTTACCTTCCAGGG - Intronic
1058419881 9:104823546-104823568 CTCTCTGCCCTGAACTTCCATGG - Intronic
1060110561 9:120903750-120903772 CTGGCTTCTCTGACCCTCAAAGG - Exonic
1060472758 9:123962321-123962343 CTGGATGTTCTTGTCTTCCAAGG - Intergenic
1060959487 9:127669877-127669899 CTGCCTCCTTTTATCTTCCAGGG + Exonic
1061849171 9:133404588-133404610 CTGCCTCCTCTGTTCTTGCATGG + Intronic
1186070405 X:5813386-5813408 CTGGGTGAACTGATCATCCATGG - Intergenic
1190137178 X:47807694-47807716 CCAGCTGCTCTGAGCCTCCAAGG - Intergenic
1196392706 X:115225212-115225234 CTGGCTTCTGTGATCCTCCTTGG + Intronic
1199516346 X:148680748-148680770 CTGTCTGCTCTGGGCTCCCAGGG - Intronic
1199640710 X:149858459-149858481 CTGTCTGCTCTCATCTCCCAGGG + Intergenic
1200130198 X:153838283-153838305 AAGGCTGCTCTTTTCTTCCATGG + Intergenic
1200808051 Y:7452705-7452727 CTTGCTGCTGCGCTCTTCCAAGG - Intergenic
1202297416 Y:23374726-23374748 CTGGGTGCTCTGGTCTTGGATGG + Intergenic