ID: 1156499035

View in Genome Browser
Species Human (GRCh38)
Location 18:37545318-37545340
Sequence GCTACTAGGCAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 823}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156499035_1156499041 6 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499041 18:37545347-37545369 ACTCACGCTGGAGCCAGAGGTGG 0: 1
1: 0
2: 0
3: 23
4: 224
1156499035_1156499050 25 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499050 18:37545366-37545388 GTGGGCTGGGGCCAGGCTTGGGG 0: 1
1: 1
2: 3
3: 75
4: 792
1156499035_1156499049 24 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499049 18:37545365-37545387 GGTGGGCTGGGGCCAGGCTTGGG 0: 1
1: 0
2: 12
3: 89
4: 831
1156499035_1156499040 3 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499040 18:37545344-37545366 ATGACTCACGCTGGAGCCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 144
1156499035_1156499046 18 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499046 18:37545359-37545381 GCCAGAGGTGGGCTGGGGCCAGG 0: 1
1: 1
2: 14
3: 106
4: 1077
1156499035_1156499051 29 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499051 18:37545370-37545392 GCTGGGGCCAGGCTTGGGGATGG 0: 1
1: 1
2: 12
3: 127
4: 1313
1156499035_1156499042 7 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499042 18:37545348-37545370 CTCACGCTGGAGCCAGAGGTGGG 0: 1
1: 0
2: 0
3: 28
4: 555
1156499035_1156499043 11 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499043 18:37545352-37545374 CGCTGGAGCCAGAGGTGGGCTGG 0: 1
1: 0
2: 2
3: 34
4: 495
1156499035_1156499039 -6 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499039 18:37545335-37545357 AGTAGCAAAATGACTCACGCTGG 0: 1
1: 0
2: 0
3: 7
4: 59
1156499035_1156499048 23 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499048 18:37545364-37545386 AGGTGGGCTGGGGCCAGGCTTGG 0: 1
1: 0
2: 20
3: 163
4: 1088
1156499035_1156499044 12 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499044 18:37545353-37545375 GCTGGAGCCAGAGGTGGGCTGGG 0: 1
1: 0
2: 5
3: 79
4: 591
1156499035_1156499045 13 Left 1156499035 18:37545318-37545340 CCTTCCTCCTGCTGCCTAGTAGC 0: 1
1: 0
2: 1
3: 30
4: 823
Right 1156499045 18:37545354-37545376 CTGGAGCCAGAGGTGGGCTGGGG 0: 1
1: 0
2: 5
3: 79
4: 813

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156499035 Original CRISPR GCTACTAGGCAGCAGGAGGA AGG (reversed) Intronic
900784573 1:4639838-4639860 GCTACTTGGCAGCCTGAGGTGGG - Intergenic
901210191 1:7520251-7520273 GTTTTTAGGCAGGAGGAGGAGGG - Intronic
901268686 1:7933581-7933603 GCTACTTGGCAGGATGAGGCAGG + Intronic
901275312 1:7986671-7986693 CATACCAGGCAGCAGGAGCAGGG + Intergenic
901296055 1:8161720-8161742 GCCACGGAGCAGCAGGAGGAAGG - Intergenic
901349817 1:8584433-8584455 GCTACTAGGGAGTATGAGGCAGG + Intronic
901652615 1:10751889-10751911 GCTCCTTGGCTGCAGGAGGCTGG + Intronic
903018951 1:20380140-20380162 GCTAATAAGCAGCAGGGTGAGGG - Intergenic
903162668 1:21500502-21500524 GCTACTCGGGAGAAGGAGGCAGG + Intergenic
903251769 1:22059235-22059257 GCTACTAGGGAGGTGGAGGCAGG - Intronic
903452327 1:23462645-23462667 GCTACTAGGGAGGCGGAGGCAGG + Intronic
903821521 1:26106529-26106551 GCTACTAGGGAGTCTGAGGAAGG - Intergenic
905136827 1:35807038-35807060 GTTTCTAGTCAGCAGAAGGAAGG - Intergenic
905188087 1:36211247-36211269 GCTACTAGGCAGGCTGAGGTGGG + Intergenic
905445980 1:38028754-38028776 GCTACCAGCCAGCAAGAGGAGGG - Intergenic
906005005 1:42461656-42461678 GCTACTAGGGAGGCTGAGGAAGG - Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906901816 1:49843920-49843942 CCTGCCAGGAAGCAGGAGGAAGG + Intronic
907123214 1:52025938-52025960 GCTACTAGGGAGCCTGAGGCAGG - Intronic
907213881 1:52845787-52845809 GCTACTAGGGAGGCTGAGGAGGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908154711 1:61341173-61341195 GCTACTCGGCAGGCGGAGGCAGG - Intronic
908610760 1:65857573-65857595 GCTACTAGGGAGCCTGAGGCAGG + Intronic
908735084 1:67268005-67268027 GCTACTAGGGAGGATGAGGCAGG + Intergenic
908845327 1:68318787-68318809 GCTACTAGGCAGGCTGAGGCAGG - Intergenic
908895782 1:68897019-68897041 GCTACTAGGCAGACGGAGGTGGG - Intergenic
910321756 1:85954397-85954419 GCTAAGAGGAAGCAGGATGATGG + Intronic
911340736 1:96633349-96633371 GCTACTAGGGAGAATGAGGCAGG + Intergenic
912445413 1:109732279-109732301 GCTCCAGGGCAGCAGGAGGAGGG + Intronic
912845534 1:113071670-113071692 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
914412031 1:147438602-147438624 GCTACCAGGGAGGAGGGGGAAGG - Intergenic
914751778 1:150539610-150539632 GCTACTACGAGGCAGGAGAATGG + Intergenic
915111435 1:153566633-153566655 GCTACTCGACAGCTGGAGCAGGG - Intronic
915241811 1:154528333-154528355 GCTACTAGGGAGGCTGAGGAAGG - Intronic
915637405 1:157196133-157196155 GCTCCTAGGCAGGAAGAGGCAGG + Intergenic
916881895 1:169026927-169026949 GCTACTCGGCAGCCTGAGGCAGG - Intergenic
917423551 1:174889839-174889861 GCTACTTGGGAGCCTGAGGAGGG - Intronic
918175894 1:182045039-182045061 GCTACTTGGGAGCATGAGGTTGG - Intergenic
918271686 1:182907319-182907341 GCTACTAGGGAGGTGGAGGCAGG + Intronic
918448065 1:184634084-184634106 GCCACTAGGGAGCAGGATGGTGG - Intergenic
918724105 1:187895543-187895565 GCTACTTGGCAGGATGAGGTAGG - Intergenic
918727341 1:187942314-187942336 GCTAAGAGCCAGCAGGAGGCAGG + Intergenic
918878001 1:190074853-190074875 GCTACTTGGCAGCCTGAAGAGGG + Intergenic
918901809 1:190431466-190431488 GCTACTAGGGAGGATGAGGCAGG - Intronic
919239183 1:194889553-194889575 GCTCCTGGGCAGAAGGAGGCAGG + Intergenic
919397902 1:197073200-197073222 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
919637183 1:200014241-200014263 GCTACTAGGCAGGCTGAGGTGGG + Intergenic
919948900 1:202344326-202344348 GCTACTAGGCAGGCTGAGGCAGG - Intergenic
920442383 1:205989633-205989655 GGAACAGGGCAGCAGGAGGAAGG - Intronic
921224679 1:213006350-213006372 GCTACTAGGGAGCCTGAGGCAGG + Intronic
921643929 1:217590130-217590152 GCTACTAGGAAGGATGAGGCAGG - Intronic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
922238477 1:223738998-223739020 GCTCCCAGGCAGCAGGATGGAGG + Intronic
922480336 1:225936076-225936098 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
922985737 1:229864868-229864890 GCTCCAAGGCTGCAGGAGGCGGG + Intergenic
923275228 1:232389513-232389535 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
923539834 1:234880093-234880115 GCTACTTGGGAGCCTGAGGAAGG + Intergenic
923683044 1:236134708-236134730 GCTGCTAGACAGCAGTATGAGGG + Intergenic
924063071 1:240196621-240196643 GCTACTAGGGAGGCTGAGGAAGG - Intronic
924103168 1:240624767-240624789 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
924277092 1:242400054-242400076 GCTACTTGGCAGCGTGAGGCAGG + Intronic
924524405 1:244834085-244834107 GCTACTCGGCAGCCTGAGGAAGG - Intergenic
1062887837 10:1032513-1032535 GCAGCTACTCAGCAGGAGGAAGG - Intergenic
1063660764 10:8034146-8034168 GCTCCTAGGTGGCAGGTGGAAGG - Intergenic
1064401498 10:15025033-15025055 GCTACTAGGGAGGGGGAGGCAGG + Intergenic
1064528130 10:16279363-16279385 GCTACTTGGGAGGATGAGGAGGG + Intergenic
1065008448 10:21401122-21401144 GCTACTTGGGAGGATGAGGAGGG - Intergenic
1065105217 10:22376955-22376977 GCTACTTGGGAGGATGAGGAGGG + Intronic
1065516732 10:26531222-26531244 GCTACTTGGGAGGATGAGGAAGG + Intronic
1066087556 10:31985790-31985812 GCTACTTGGGAGGAGGAGGTGGG - Intergenic
1068009160 10:51426167-51426189 GCTACTAGGGAGCCTGAGGCAGG + Intronic
1068170482 10:53387087-53387109 GCTACTAGGCAGGCTGAGGCAGG - Intergenic
1068324938 10:55472678-55472700 GCTACTAGGGAGGATGAGGCAGG - Intronic
1068329567 10:55545385-55545407 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1068549735 10:58393089-58393111 GCTACTAGGCAGGCTGAGGCAGG - Intronic
1068777083 10:60879443-60879465 GCTACTAGGGAGGTGGAGGTGGG - Intronic
1068993766 10:63179295-63179317 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1069131688 10:64711979-64712001 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1069231387 10:66013010-66013032 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1070037039 10:72736358-72736380 GGTACTAGGCAGCAGCAGTCAGG - Intronic
1070073342 10:73111086-73111108 GCTACTAGGGAGTATGAGGCAGG - Intronic
1071806322 10:89124842-89124864 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1072105287 10:92267928-92267950 GCTACTCGGGAGGAGGAGGCAGG - Intronic
1072496838 10:95970144-95970166 GCTACTTGGCAGGCTGAGGAAGG - Intronic
1072916939 10:99543135-99543157 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
1072921624 10:99581924-99581946 GCTACTAGGGAGGATGAGGCAGG - Intergenic
1073333046 10:102683683-102683705 GCTACTAGGCAGCTAGAGGGTGG - Intronic
1073477571 10:103764277-103764299 GTTTCTAGTGAGCAGGAGGAAGG + Intronic
1073773502 10:106760993-106761015 GCTACTGGGAAGGATGAGGAAGG + Intronic
1075383243 10:122035922-122035944 GCTACTAGGGAGGCTGAGGAGGG - Intronic
1075714032 10:124545581-124545603 GCTCCCAGGTAGCAGGAAGAAGG + Intronic
1076359221 10:129875306-129875328 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1077242788 11:1519469-1519491 GCTACAGGGGAGCAGGAGGCTGG + Intergenic
1077368019 11:2169096-2169118 GTTGCTAGGCAACAGGAGGTGGG - Intronic
1078409147 11:11097400-11097422 ATTACTAGGCAGGAGGATGAAGG - Intergenic
1078590417 11:12636348-12636370 GCTACTAGGGAGGCTGAGGAGGG + Intergenic
1079019703 11:16899383-16899405 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1079656550 11:22992925-22992947 TCTATTAGGCGGGAGGAGGAGGG + Intergenic
1079779573 11:24583813-24583835 GCTACTCGGGAGGATGAGGAAGG - Intronic
1080553450 11:33394272-33394294 GCTACTAGGGAGGATGAGGTGGG + Intergenic
1082116683 11:48336854-48336876 TCTACAAGGCAGCATGAGCATGG + Intergenic
1082257110 11:50043456-50043478 TCTACAAGGCAGCATGAGCATGG - Intergenic
1083022833 11:59524797-59524819 GCTACTTGGCAGGCGGAGGCAGG - Intergenic
1083492140 11:63020990-63021012 GCTCCTTAGCAGCAGGCGGAGGG + Intergenic
1083932095 11:65851621-65851643 GCTCCTAGGAAGCAGTAGGGAGG - Exonic
1084077997 11:66797109-66797131 GCTACTAGGAAGGCGGAGGCAGG - Intronic
1084694477 11:70745463-70745485 TTTTCAAGGCAGCAGGAGGAGGG - Intronic
1085120589 11:73965068-73965090 GCTGCTAGGCTGCAGGAGATAGG - Intronic
1086689162 11:89769068-89769090 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1086716697 11:90070903-90070925 GCTACTAGGGAGGATGAGGCAGG - Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087029755 11:93690618-93690640 GCTACTCGGGAGCATGAGGCAGG + Intronic
1087283134 11:96234367-96234389 GCTACTTGGGAGGAGGAGGCAGG + Intronic
1087504860 11:99006932-99006954 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1087742966 11:101911233-101911255 GCTACTTGGGAGGCGGAGGAAGG - Intronic
1087878936 11:103392214-103392236 ACTGCAAGGCAGCAGGAGGCTGG - Intronic
1088585206 11:111355196-111355218 GGCACCAGGCAGCAGCAGGAAGG - Intronic
1088615383 11:111621800-111621822 GCTACTAGGCAGGCTGAGGCAGG + Intronic
1089717587 11:120377450-120377472 GCTACTTGGGAGCATGAGGTGGG - Intronic
1089927245 11:122271381-122271403 GCCACTTGGCAGCAGGTAGAGGG + Intergenic
1090348804 11:126093207-126093229 GCTACTTGGGAGGATGAGGAAGG - Intergenic
1090514678 11:127412432-127412454 GCTCCTGGGCAGGAGGAGGTGGG - Intergenic
1091225180 11:133952896-133952918 TCTTCTAGGAAGCAGGTGGAAGG + Intronic
1091423854 12:368618-368640 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1091527203 12:1315129-1315151 GCTACTTGGCAGGCTGAGGAAGG - Intronic
1091770323 12:3147231-3147253 GCTGCTGGGCAGCAGGAGGCAGG + Intronic
1091900632 12:4141282-4141304 CCCACCAGGAAGCAGGAGGATGG - Intergenic
1092574151 12:9760954-9760976 GCAAGTAGGCGGCAAGAGGAAGG - Intergenic
1093493030 12:19726162-19726184 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1093644358 12:21567224-21567246 GATATTTGGCAGCAGGAGAAAGG + Intronic
1093661599 12:21763743-21763765 GCTACTACTGAGCAGCAGGAAGG + Intergenic
1094058086 12:26286463-26286485 GCTGGGAGGCAGCAGGAGAAAGG + Intronic
1094703389 12:32892422-32892444 GCTACTAGGGAGCCTGAGGCAGG - Intronic
1094796946 12:33985509-33985531 GCTACTAGGGAGCCTGAGGTGGG - Intergenic
1095109695 12:38279446-38279468 GCTACTAGGGAGCCTGAGGTGGG - Intergenic
1095594656 12:43945430-43945452 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1095977613 12:47950353-47950375 GCAAGGAGGCAGCAGGAGGGTGG + Intergenic
1096059805 12:48687148-48687170 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1096090343 12:48895529-48895551 GCTACTAGGGAGCCTGAGGCAGG - Intergenic
1096467519 12:51855506-51855528 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
1096645396 12:53031386-53031408 GCTACTGGGGAGGATGAGGAAGG - Intronic
1097115634 12:56694826-56694848 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1097117287 12:56706944-56706966 GCTACTAGGGAGGCGGAGGTGGG - Intergenic
1097132802 12:56825544-56825566 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1097410598 12:59247924-59247946 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1097697940 12:62792714-62792736 GCTTCTAGGGAGGAGGGGGAGGG - Intronic
1097868674 12:64581605-64581627 GCTACTAGGGAGGATGAGGTGGG + Intergenic
1098267607 12:68738336-68738358 GCTACTAGGGAGGTGGAGGCAGG + Intronic
1099520895 12:83660738-83660760 TCTCCTAGGCAGCAGTAGAAAGG + Intergenic
1100030034 12:90175593-90175615 GCTACTAGGGAGGCTGAGGACGG - Intergenic
1100344105 12:93710455-93710477 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1100573046 12:95860667-95860689 GCTACTAGGGAGGATGAGGTGGG - Intronic
1100604997 12:96144454-96144476 GCTACTAGGCAGGGTGAGGTGGG - Intergenic
1101103495 12:101418373-101418395 GCTACTTGGGAGGAGGAGGCAGG - Intergenic
1102479435 12:113211191-113211213 GCTACTCGGGAGCATGAGGCAGG - Intronic
1102599813 12:114021208-114021230 GCTACTAGGGAGCCTGAGGAAGG - Intergenic
1103106364 12:118229817-118229839 GCTACTAGGGAGCCTGAGGCAGG + Intronic
1103434192 12:120912068-120912090 GCTACTAGGAAGGCGGAGGCAGG + Intergenic
1104465514 12:128986659-128986681 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1104484714 12:129140725-129140747 GCTACTAGGGAGGATGAGGCAGG + Intronic
1104559817 12:129833511-129833533 GCTACTTGGGAGGAGGAGGTGGG + Intronic
1105311072 13:19211840-19211862 GCTACTAGGGAGCCTGAGGCAGG - Intergenic
1105361298 13:19719414-19719436 GCTACTAGGGAGCCTGAGGCAGG - Intronic
1105384282 13:19915613-19915635 GCTACTAGGGAGGTTGAGGAGGG - Intergenic
1105698017 13:22909821-22909843 GCTACTAGGAAGGATGAGGCAGG - Intergenic
1106624866 13:31410263-31410285 GCCAATGGGCAGCAGGAGAAAGG - Intergenic
1106830338 13:33574628-33574650 GCTACTTGGGAGCCTGAGGAGGG + Intergenic
1106922370 13:34577230-34577252 GCTACTAGGCAGGCTGAGGTGGG + Intergenic
1107069552 13:36255548-36255570 GCTACTCGGCAGGCTGAGGAAGG + Intronic
1107279939 13:38722129-38722151 GCTACTAGGGAGGCGGAGGCAGG - Intronic
1108649356 13:52460554-52460576 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1109289449 13:60455956-60455978 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1111590898 13:90348089-90348111 GCTACTAGGCAGGCCGAGGCAGG - Intergenic
1111604586 13:90520588-90520610 GCTAGGAGGCAGTAGGAGGAGGG - Intergenic
1111817205 13:93168660-93168682 GCTACTAGGGAGGTGGAGGCAGG + Intergenic
1111985189 13:95058850-95058872 GCTGCCAGGCAGCAGGAGCCCGG + Intronic
1112036736 13:95503817-95503839 GCTGCTAGGGAGAAGGGGGAGGG + Intronic
1112119808 13:96397090-96397112 GCTACTAGGGAGCCTGAGGCAGG + Intronic
1112649378 13:101376403-101376425 GCTACTTGGCAGGCTGAGGAAGG + Intronic
1112906180 13:104425221-104425243 GCTACTGGGCAGGCTGAGGAGGG + Intergenic
1112976609 13:105327231-105327253 GCTATTAGGGAGCAGGTGGCAGG + Intergenic
1113103141 13:106742727-106742749 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
1113217399 13:108058330-108058352 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1113271860 13:108683345-108683367 GCTACTATAGAACAGGAGGAAGG - Intronic
1113538854 13:111091091-111091113 GCTACCAGGGAGAATGAGGAAGG + Intergenic
1114038736 14:18655822-18655844 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
1114119878 14:19659225-19659247 GCTACTAGGGAGCCTGAGGCAGG - Intergenic
1114250587 14:20956907-20956929 GCTACTCGGGAGGCGGAGGAAGG - Intergenic
1114344099 14:21777572-21777594 GCTACTAGGGAGCCTGAGGCTGG - Intergenic
1114667416 14:24387607-24387629 GCTACTAGGAAGGCTGAGGAAGG - Intergenic
1115686801 14:35804815-35804837 GCTACTAGGGAGGTAGAGGAAGG + Intronic
1115819252 14:37196776-37196798 GCTACTAGGGAGGATGAGGTGGG - Intergenic
1115919875 14:38360582-38360604 GCTACTAGGTAGCTTCAGGATGG - Intergenic
1116251317 14:42485917-42485939 GCTACTAGGCAGGCTGAGGCTGG + Intergenic
1116747924 14:48845564-48845586 GCTACTAGGGAGGTGGAGGCAGG - Intergenic
1116833893 14:49749564-49749586 GCTACTCGGGAGGATGAGGAGGG + Intronic
1116847722 14:49880307-49880329 GCTACTAGGCAGGGTGAGGCAGG + Intergenic
1117361036 14:54974319-54974341 GCTACTCGGAAGGCGGAGGACGG + Intronic
1117432102 14:55677808-55677830 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1118026459 14:61773817-61773839 GCTACTCGGGAGGCGGAGGAAGG - Intronic
1118164756 14:63325257-63325279 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
1118268810 14:64322168-64322190 GCTACTCGGGAGCATGAGGCAGG - Intronic
1118985430 14:70750594-70750616 GCTACTCGGCAGGTGGAGGCAGG - Intronic
1119174841 14:72561545-72561567 GCGACTGGGCACCAGGAGGAGGG - Intronic
1119285671 14:73452246-73452268 GCTACTAGGGAGGATGAGGCAGG + Intronic
1119463551 14:74833358-74833380 GCTACTAGGGAGGATGAGGTGGG - Intronic
1119750108 14:77071177-77071199 GCTACTAGGGAGGTTGAGGAAGG + Intergenic
1119830833 14:77700981-77701003 GCTACTAGGCAGGCTGAGGTGGG + Intronic
1120870186 14:89329742-89329764 GCTACTAGGGAGGATGAGGCAGG + Intronic
1121663535 14:95653960-95653982 GCTACTTGGGAGGATGAGGAAGG + Intergenic
1121851058 14:97221342-97221364 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1121961058 14:98260288-98260310 GCTACTAGGAAGGATGAGGCAGG - Intergenic
1121979768 14:98444464-98444486 GCAACCTGGCAGCAGGTGGAAGG - Intergenic
1122241805 14:100373490-100373512 GCAACAAGGCAGCAGCAGTAAGG + Intronic
1122850302 14:104524602-104524624 GCTACTAGGGAGGATGAGGTGGG - Intronic
1202927168 14_KI270724v1_random:37248-37270 GCTACTTGGGAGCCGGAGGTGGG - Intergenic
1124609425 15:31198161-31198183 TCTACGAGGGAGGAGGAGGAGGG - Intergenic
1125495825 15:40192960-40192982 GCTACTAGGGAGGATGAGGTGGG - Intronic
1125553686 15:40566778-40566800 GCTACTAGGGAGCCTGAGGTGGG + Intergenic
1126761380 15:51972708-51972730 GCTACTAGGGAGGATGAGGCAGG + Intronic
1126893588 15:53233936-53233958 GATATTAGGCAGGAGGAGGGGGG - Intergenic
1127403446 15:58615160-58615182 GCTACTAGGGAGCCTGAGGCAGG + Intronic
1127408499 15:58680232-58680254 GCTACTAGGGAGGCGGAGGTGGG - Intronic
1127440085 15:58998014-58998036 GCTACTAGGGAGCCTGAGGCAGG - Intronic
1127507017 15:59607436-59607458 GCTACTAGGCAGGCTGAGGCAGG + Intronic
1127847709 15:62886144-62886166 GCTACTAGGAAGGATGAGGCAGG - Intergenic
1127866510 15:63037557-63037579 GCTACTCGGCAGCCTGAGGCAGG - Intergenic
1128074192 15:64816232-64816254 GCCACTAGGGAGCAGGAGGACGG + Intronic
1128127352 15:65202945-65202967 GCTACTCGGCAGGATGAGGTAGG - Intronic
1128291988 15:66485085-66485107 GCTCCTTGGCATCTGGAGGAGGG - Exonic
1128687277 15:69696095-69696117 GCCTCTAGGCTGCAAGAGGAAGG - Intergenic
1129149496 15:73678990-73679012 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1129221811 15:74135611-74135633 GCTACTAGGCAGGCTGAGGCAGG - Exonic
1129417426 15:75393917-75393939 GCTACTCGGCAGAATGAGGTGGG - Intronic
1129919569 15:79309012-79309034 GGAACTAGGCAGAAGGAGCAAGG - Intergenic
1130383797 15:83394058-83394080 GCTACTCGGGAGCCTGAGGAGGG + Intergenic
1131131971 15:89906034-89906056 GCTACTGGGGAGGAAGAGGAAGG - Intronic
1131200453 15:90391124-90391146 GCTACTCGGGAGCCTGAGGAGGG + Intronic
1131780176 15:95847540-95847562 GCTACTAGGCAGGCTGAGGTAGG - Intergenic
1131953543 15:97706705-97706727 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1131972924 15:97910623-97910645 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1132367175 15:101266092-101266114 GTGACCAGGCAGCAGGAGGGTGG + Intergenic
1132467393 16:83627-83649 GCTACTAGGGAGGCGGAGGCAGG + Intronic
1132753437 16:1470034-1470056 GGGGCTGGGCAGCAGGAGGAAGG + Intronic
1132970336 16:2684651-2684673 GCTACTAGGCAGTCTGAGGCAGG + Intronic
1133117151 16:3583888-3583910 GCTACTAGGGAGGATGAGGTAGG + Intronic
1133250927 16:4480454-4480476 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1133656560 16:7870667-7870689 GCTACTAGGGAGGACGAGGCAGG - Intergenic
1134000519 16:10779425-10779447 GTTGCTGGGGAGCAGGAGGATGG - Intronic
1134001192 16:10784215-10784237 GCTACTAGGGAGGATGAGGAAGG + Intronic
1134157069 16:11852272-11852294 GCTACTTGGGAGGCGGAGGATGG + Intergenic
1134490290 16:14691083-14691105 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1134495671 16:14730200-14730222 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1134501219 16:14770513-14770535 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1134579361 16:15358519-15358541 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1134723221 16:16399032-16399054 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1134944207 16:18312838-18312860 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1135006568 16:18828884-18828906 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1135164114 16:20123724-20123746 GCTACTCGGGAGCCTGAGGAAGG + Intergenic
1135231443 16:20711859-20711881 ACCACTAGGAAGCAGGAGGATGG - Intronic
1135898350 16:26431137-26431159 GCTACTCGGCAGGCGGAGGCAGG - Intergenic
1136083397 16:27867703-27867725 TCTACTGGCCACCAGGAGGAGGG + Intronic
1136105868 16:28030147-28030169 GCTACTAGACAAGGGGAGGAGGG - Intronic
1136117464 16:28103832-28103854 GCTAGTAGGGAGCTGGAGGGAGG + Intronic
1136165630 16:28451184-28451206 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1136197342 16:28663825-28663847 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1136213681 16:28777972-28777994 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1136258414 16:29057896-29057918 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1136320081 16:29478420-29478442 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1136434652 16:30217761-30217783 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1136864036 16:33727193-33727215 GCTACTAGGGAGCCTGAGGCAGG - Intergenic
1137291579 16:47055365-47055387 GAAACCAGGCAGCAGGAGCAGGG + Intergenic
1137464313 16:48694234-48694256 GCTACTAGGCAGGCTGAGGCAGG - Intergenic
1137559413 16:49493191-49493213 GCTTGAAGGTAGCAGGAGGATGG - Intronic
1137640926 16:50028067-50028089 GCTACTAGGGAGGATGAGGCAGG - Intronic
1137815524 16:51394342-51394364 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1138290252 16:55840623-55840645 GCTACTCGGGAGCCTGAGGAAGG - Intergenic
1138452692 16:57103232-57103254 GCTACTAGGGAGCCTGAGGCAGG - Intronic
1138735158 16:59241999-59242021 GCTAGTAAGCAGCCAGAGGATGG + Intergenic
1139031124 16:62882156-62882178 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
1139253503 16:65519286-65519308 GCTACATGGCAGGAGGAGGATGG + Intergenic
1139378924 16:66518048-66518070 GCTCCCAGGCAGCAGGAGGTCGG - Intronic
1139600112 16:67981360-67981382 GCTACTTGGGAGGTGGAGGAAGG - Intergenic
1139639287 16:68279228-68279250 GCTACTCGGGAGCCTGAGGAGGG + Intronic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140084815 16:71785768-71785790 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1140271246 16:73468269-73468291 TCTTCCAGGCAGCAGGATGATGG + Intergenic
1140500200 16:75427360-75427382 GCTACTTGGGAGGATGAGGAAGG - Intronic
1141547894 16:84784480-84784502 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1141973818 16:87500736-87500758 GCTACTAGGGAGGATGAGGTGGG - Intergenic
1142027231 16:87820945-87820967 GCAATTCGGCTGCAGGAGGAAGG + Intergenic
1142292554 16:89199678-89199700 GCTGCTGGGCAGCAGGAAAAGGG + Intronic
1142333545 16:89471671-89471693 GCTACTTGGGAGGATGAGGAAGG + Intronic
1203125522 16_KI270728v1_random:1575331-1575353 GCTACTAGGGAGCCTGAGGCAGG - Intergenic
1142574826 17:899776-899798 GCTACTAGGGAGGATGAGGCAGG + Intronic
1142918349 17:3162458-3162480 GCTACTAGGGAGGCGGAGGCAGG - Intergenic
1142951366 17:3483772-3483794 GCTACTAGGGAGCTTGAGGCAGG - Intronic
1143066391 17:4251920-4251942 GCTACTAGGGAGGATGAGGCAGG + Intronic
1143382844 17:6507201-6507223 GCTTCAAGGCGGCAGGAGGCAGG + Intronic
1143649486 17:8254690-8254712 GCTACTAGGCAGGCTGAGGCAGG + Intronic
1143708005 17:8713754-8713776 GCTACTAGGAAGCCTGAGGCAGG + Intergenic
1143919843 17:10322446-10322468 GTTATCAGGAAGCAGGAGGAGGG + Intronic
1144214780 17:13045609-13045631 GCTACTTGGCAGCCTGAGGCAGG + Intergenic
1144700321 17:17333767-17333789 GCTACTAGGGAGGATGAGGCAGG - Intronic
1145350865 17:22081741-22081763 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1146035537 17:29403047-29403069 GCTACTAGGGAGCCTGAGGCAGG + Intronic
1146046516 17:29512792-29512814 GCTACTCGGGAGCCGGAGGCAGG - Intronic
1146251826 17:31353018-31353040 GCTACTAGGGAGGATGAGGCAGG - Intronic
1146282798 17:31556011-31556033 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
1146358439 17:32154781-32154803 GCTACTCGGGAGGATGAGGAAGG + Intronic
1147195418 17:38763240-38763262 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1147421716 17:40325137-40325159 GCTACTAGGGAGGATGAGGCAGG + Intronic
1147427345 17:40352196-40352218 GGGAAGAGGCAGCAGGAGGAGGG - Intronic
1147733764 17:42620863-42620885 GCTACTTGGCAGGCGGAGGCAGG - Intergenic
1147792673 17:43023072-43023094 GCTACTAGGGAGGCGGAGGCTGG + Intronic
1147894593 17:43742272-43742294 GCTACTAGGCAGACTGAGGTGGG - Intergenic
1147945259 17:44077127-44077149 GGTACTGGGGAGGAGGAGGAAGG + Exonic
1147998066 17:44372196-44372218 TTTATTAGGCAGCAGGAGGGGGG + Exonic
1148117971 17:45188741-45188763 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1148289907 17:46436116-46436138 GCTACTTGGCAGGTGGAGGTGGG - Intergenic
1148312075 17:46653688-46653710 GCTACTTGGCAGGTGGAGGTGGG - Intronic
1148696714 17:49564465-49564487 GCTACTAGGGAGGCTGAGGAGGG + Intergenic
1148711671 17:49686237-49686259 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1149736943 17:59003995-59004017 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1149800809 17:59565702-59565724 GCGCCAAGGCGGCAGGAGGAGGG + Exonic
1149944441 17:60906550-60906572 GATTCTAGGAAGCAGGAGGTAGG - Intronic
1150163063 17:62915548-62915570 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1150214379 17:63458442-63458464 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1150279819 17:63923087-63923109 GCTACTAGGGAGCCTGAGGCAGG - Intergenic
1150518823 17:65844900-65844922 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1150535060 17:66029590-66029612 GCTACTTGGGAGGATGAGGAGGG + Intronic
1150564725 17:66328684-66328706 GCTACTTGGCAGGATGAGGCAGG + Intronic
1150652052 17:67016683-67016705 GCTCCCAGGCTGCAGGAGCAGGG + Intronic
1150777324 17:68091992-68092014 GCTACTAGGAAGCCTGAGGCAGG + Intergenic
1151285824 17:73110322-73110344 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1151325289 17:73376080-73376102 GCTACTTGGGAGGCGGAGGAAGG + Intronic
1151360757 17:73587366-73587388 GTTACTTGGCAGCTGGAGCAAGG - Intronic
1151538605 17:74752603-74752625 GCTACTAGGGAGAATGAGGTGGG - Intronic
1151600431 17:75102842-75102864 GCTACTAGGGAAGAGGAGGCAGG - Intronic
1152418083 17:80175877-80175899 CCTGCCAGGAAGCAGGAGGAGGG - Intronic
1152664706 17:81560593-81560615 GCTACTAGGAAGGCTGAGGAAGG + Intronic
1153192654 18:2559426-2559448 GTTACCAGGCAGCAGGGGAAGGG + Intronic
1153241709 18:3036991-3037013 GCTACTCGGAGGCAGGAGAATGG - Intergenic
1153428813 18:4993087-4993109 GCTCCTAGGCAGAAGGAGGTGGG - Intergenic
1153746630 18:8186212-8186234 GCTACTAGGGAGCCTGAGGCAGG + Intronic
1154030403 18:10748539-10748561 TCTTCTTTGCAGCAGGAGGAAGG + Exonic
1154507039 18:15051919-15051941 GATACAAGAGAGCAGGAGGATGG - Intergenic
1155506780 18:26541160-26541182 GCTGCAGGGCAGCAGGAAGATGG - Intronic
1155731233 18:29161127-29161149 GCTACTTGGGAGGCGGAGGAAGG + Intergenic
1155988759 18:32257579-32257601 TCTCCTAGGCAGATGGAGGAAGG - Intronic
1156197423 18:34790954-34790976 GAGAATAGGCAGCGGGAGGATGG + Intronic
1156499035 18:37545318-37545340 GCTACTAGGCAGCAGGAGGAAGG - Intronic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1157042690 18:44059407-44059429 GCTACTTGGGAGGATGAGGAAGG + Intergenic
1157413973 18:47486724-47486746 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
1157463223 18:47920572-47920594 ACAACTGGGCAGCAGGAGGTAGG + Intronic
1157492132 18:48131013-48131035 GCTACTAGGGAGGCGGAGGCAGG - Intronic
1157983022 18:52404433-52404455 TTCACTATGCAGCAGGAGGAAGG - Intronic
1158461844 18:57653394-57653416 GCTACTTGGCAGGATGAGGTGGG - Intronic
1158495250 18:57949474-57949496 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1158635024 18:59148723-59148745 GCTACTTGGGAGCCGGAGGCAGG - Intronic
1159971771 18:74664381-74664403 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1160153521 18:76413356-76413378 GCTCCTAGGCAGCAGGGAGAGGG + Intronic
1160311103 18:77790962-77790984 GCTACTAGGGAGGCTGAGGAGGG + Intergenic
1161125328 19:2552967-2552989 GCCCCAAGCCAGCAGGAGGAAGG + Intronic
1161367182 19:3886823-3886845 GCTACTCGGGGGCATGAGGAAGG - Intronic
1161856683 19:6769734-6769756 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1161938138 19:7384801-7384823 GCTACTCGGGAGGAGGAGGTGGG - Intronic
1162102791 19:8350293-8350315 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1162177972 19:8846040-8846062 GCTACTAGGGAGGCGGAGGCAGG - Intergenic
1162575059 19:11494576-11494598 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1162878689 19:13640559-13640581 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1163399434 19:17083144-17083166 GCTACTAGGGAGAATGAGGTAGG - Intronic
1163423048 19:17225902-17225924 GCTACTCGGGAGCCGGAGGCAGG + Intergenic
1163426121 19:17241902-17241924 GCTACTTGGCAGGCTGAGGAAGG + Intronic
1163428783 19:17254233-17254255 GCTACTCGGCAGGCGGAGGCAGG + Intronic
1163859014 19:19730798-19730820 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1164565383 19:29322376-29322398 GCTACCAGTGAGCAGAAGGAAGG - Intergenic
1164821033 19:31251432-31251454 GTCACTAGGGAGCAGGAGGCAGG - Intergenic
1165074074 19:33271027-33271049 GCTACTAGGGAGGTGGAGGTGGG + Intergenic
1165398962 19:35585606-35585628 GCTACTAGGGAGGATGAGGCAGG - Intergenic
1165709890 19:38003611-38003633 GCTACGAGGCAGCAGGAAAAAGG - Intronic
1165836198 19:38757911-38757933 GCTACTAGGGAGGATGAGGCAGG - Intronic
1166082125 19:40450652-40450674 GCTACTGGGAGGCGGGAGGATGG - Intronic
1166287609 19:41841552-41841574 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1166368403 19:42288781-42288803 GGTACTAGGCAGAAGCAGGCTGG - Intronic
1166645728 19:44530387-44530409 GCTACTAGGCAGGCTGAGGCAGG - Intergenic
1166646320 19:44534308-44534330 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1166889751 19:45983519-45983541 GCTACTAGGGAGCCTGAGGCGGG - Intergenic
1167093831 19:47362880-47362902 GCTACTTGGCAGGTGGAGGTAGG - Intronic
1167227015 19:48251921-48251943 GCAACCAAGCAGCAGGAGGATGG - Intronic
1167328401 19:48838653-48838675 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1167913649 19:52723366-52723388 GCTACTAGGAAGTCTGAGGAAGG - Intronic
925663045 2:6223011-6223033 GATAGCAGGCAGCAGCAGGAAGG - Intergenic
926081872 2:9994033-9994055 TCCACTAGGCAGCATGAGTAGGG - Intronic
926115389 2:10209985-10210007 GCTGCTGGGCAGCAGGAGCAGGG - Intronic
927264233 2:21126476-21126498 GCTACTCGGGAGCCTGAGGAAGG - Intronic
927567398 2:24124804-24124826 GCTACTAGGGAGTGGAAGGATGG - Intronic
927774592 2:25892529-25892551 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
927786176 2:25976647-25976669 GCTACTAGGGAGGATGAGGCAGG + Intronic
928045218 2:27924494-27924516 GCTACTAGGGAGGCTGAGGAAGG - Intronic
928230788 2:29497158-29497180 GCTACTAGGGAGGATGAGGCAGG + Intronic
928407868 2:31028614-31028636 CCTTCGAGGCAGCAGGAGGCGGG + Intronic
928411400 2:31057124-31057146 ACTACTAGACAGGAGAAGGAGGG + Intronic
928721833 2:34130216-34130238 GCTACTTGGGAGGCGGAGGAAGG - Intergenic
929183579 2:39069657-39069679 GCTACTAGGGAGGCGGAGGCAGG - Intronic
929527172 2:42715514-42715536 GCTACTCAGGAGGAGGAGGAGGG - Intronic
929683392 2:44013579-44013601 GCTACTAGGCAGGCTGAGGTGGG - Intergenic
929703595 2:44187859-44187881 GCTACTAGGGAGGATGAGGCAGG - Intronic
930055709 2:47250598-47250620 ACTAGCAGGCTGCAGGAGGATGG + Intergenic
930231788 2:48850658-48850680 GCTACTAGGCAGGCTGAGGCAGG - Intergenic
930339332 2:50092639-50092661 TGAACTAGGCAGCAGGAGTATGG + Intronic
930457764 2:51628332-51628354 GCTACTCGGGAGCCGGAGGCAGG - Intergenic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
930819741 2:55633528-55633550 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
931342771 2:61417851-61417873 GCTACTCGGGAGCCTGAGGAAGG - Intronic
931414008 2:62063284-62063306 GCTACTAGGGAGCCTGAGGTGGG + Intronic
931597498 2:63965362-63965384 GCTACTTGGGAGGATGAGGAAGG + Intronic
931778618 2:65561087-65561109 GCTACTTGGCAGCCTGAGGCAGG + Intergenic
931926932 2:67084005-67084027 GCTACTTGGAAGCAGTAGCACGG - Intergenic
932093314 2:68825661-68825683 GCTACTAGGGAGGCTGAGGAAGG + Intronic
932356457 2:71071982-71072004 AGGACCAGGCAGCAGGAGGAAGG + Intronic
932473860 2:71987567-71987589 GCTACTAGGGAGGTGGAGGCAGG - Intergenic
933014739 2:77111227-77111249 GCTACTCGGCAGCCTGAGGCAGG - Intronic
933301518 2:80546085-80546107 CTTACAAGGCAGCTGGAGGAGGG + Intronic
934081756 2:88474561-88474583 GCTACTTGGGAGGATGAGGAGGG - Intergenic
934114393 2:88771730-88771752 GCTACTAGGGAGCCTGAGGTAGG + Intergenic
934632245 2:95940128-95940150 GCTACTAGGGAGCCTGAGGCAGG - Intronic
934801258 2:97163153-97163175 GCTACTAGGGAGCCTGAGGCAGG + Intronic
936096512 2:109534330-109534352 ACTACTAGGATGCAGGTGGATGG - Intergenic
937575959 2:123422202-123422224 GCTACTAGGGAGGATGAGGCAGG + Intergenic
937872268 2:126794370-126794392 GCTGCTCCGCAGCAGGAGGCAGG - Intergenic
938271562 2:129976486-129976508 GCTACTCGGGAGGCGGAGGAGGG + Intergenic
938406971 2:131038227-131038249 GCTGCAAGGCTGCAGGAGGGAGG - Intronic
938406993 2:131038318-131038340 GCTGCAAGGCTGCAGGAGGGAGG - Intronic
938407004 2:131038349-131038371 GCTGCAAGGCTGCAGGAGGGAGG - Intronic
938407050 2:131038531-131038553 GCTGCAAGGCTGCAGGAGGGAGG - Intronic
938697279 2:133845593-133845615 GCTAATGGGAAGCAAGAGGAAGG + Intergenic
938711319 2:133978281-133978303 CCTACTGGGAAGCAGGAGGGAGG + Intergenic
941078455 2:161032970-161032992 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
941897710 2:170646157-170646179 GCTACTAGGGAGGCTGAGGAAGG + Intronic
941962627 2:171268954-171268976 GCTACTAGGAAGTCGGAGGAGGG - Intergenic
942022834 2:171883970-171883992 GCTACTAGGAAGGCTGAGGAAGG - Intronic
942217124 2:173732413-173732435 GCTACTTGGCAGCCTGAGGCAGG - Intergenic
942248396 2:174027393-174027415 GCTACTCGGGAGCATGAGGCAGG - Intergenic
942415784 2:175758083-175758105 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
942832883 2:180257551-180257573 GCTACTAGGGAGGCGGAGGCAGG - Intergenic
944407483 2:199401439-199401461 GCTACTAGGGAGCCTGAGGCAGG + Intronic
944708904 2:202318355-202318377 GCTACTAGGGAGGATGAGGCAGG - Intergenic
944845658 2:203665451-203665473 GCTACTAGGGAGGATGAGGCAGG - Intergenic
945302941 2:208231099-208231121 GCTACTAGGGAGGCTGAGGAGGG + Intergenic
945379169 2:209119203-209119225 GCTACTAGGCAGGCTGAGGCAGG - Intergenic
946248055 2:218398431-218398453 GCTACCCAGGAGCAGGAGGAGGG + Intronic
946511107 2:220357438-220357460 GCTACTAGGGAGCCTGAGGAAGG - Intergenic
947102953 2:226640934-226640956 GCTACTAGGGAGGTGGAGGCAGG - Intergenic
947625731 2:231617145-231617167 GCTACTAGGGAGCCTGAGGCAGG - Intergenic
948327190 2:237134306-237134328 GCAATTAGTCAGCAGGAGCAAGG + Intergenic
948517479 2:238512943-238512965 GCTACTAGGGAGGCGGAGGCAGG - Intergenic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
948766672 2:240225610-240225632 GCTTCTAGTCAGGAGAAGGAAGG + Intergenic
948887568 2:240891826-240891848 CCAAGTTGGCAGCAGGAGGAGGG - Intronic
948935211 2:241159416-241159438 GCTAAGAGCCAGCAGGAGGTTGG - Intronic
1168760099 20:344707-344729 GCTACTAGGGAGGATGAGGCAGG - Intergenic
1168762527 20:359095-359117 GCTACTGGGGAGCATGAGGTGGG - Intronic
1168850301 20:972174-972196 GCTACTAGGGAGGCTGAGGAGGG - Intronic
1169279216 20:4252899-4252921 GCTACTTGGCAGGCGGAGGCAGG + Intergenic
1169342045 20:4803944-4803966 GCTACTAGGCAGGCTGAGGCAGG + Intronic
1169365080 20:4985557-4985579 GCTACTAGGCAGGCTGAGGTGGG - Intronic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1169402763 20:5297074-5297096 GCTACTAGGAAGCCTGAGGCAGG + Intergenic
1169510462 20:6258567-6258589 GCAACTAGGGACAAGGAGGAAGG + Intergenic
1171094394 20:22317396-22317418 GCTACTAGGAAGCCTGAGGCAGG + Intergenic
1171395105 20:24827832-24827854 GCTACCAGGGTGCAGGTGGAGGG - Intergenic
1171970517 20:31562158-31562180 TCTACTAGGGAGTAGGGGGAGGG - Intronic
1172108717 20:32532627-32532649 GGTACCAGGCAGAAGGGGGATGG - Intronic
1172267054 20:33625373-33625395 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1173197324 20:40926446-40926468 GCTGGTGGGGAGCAGGAGGAGGG + Intergenic
1173240386 20:41290691-41290713 GCTACTAGTATGCAGTAGGAAGG + Intronic
1173766711 20:45617604-45617626 GCTACTCGGGAGGATGAGGAAGG - Intronic
1173874349 20:46360654-46360676 GCTACTAGGGAGCCTGAGGCAGG - Intronic
1173980808 20:47222422-47222444 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1174262432 20:49306295-49306317 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
1174430634 20:50466002-50466024 GCTACTAGGGAGGATGAGGTGGG + Intergenic
1174838666 20:53881144-53881166 GCTACTCAGAAGCAGGAGAATGG + Intergenic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175557355 20:59876257-59876279 GCTACTAGGCAGGCTGAGGCAGG + Intronic
1176914267 21:14605951-14605973 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1177922286 21:27167156-27167178 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1178442986 21:32613388-32613410 GCTACTAGGGAGCCTGAGGTGGG + Intergenic
1178467104 21:32858787-32858809 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1178984501 21:37291232-37291254 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1179482227 21:41685644-41685666 GCTAGGAGGCAGGAGGAGGCTGG - Intergenic
1180462868 22:15582860-15582882 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
1180687571 22:17681392-17681414 GCTACTTGGGAGCAGGAGAATGG + Intronic
1181645305 22:24227935-24227957 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1181675260 22:24447124-24447146 GCTACTTGGGAGGATGAGGAAGG + Intergenic
1181940261 22:26470339-26470361 GTCTCTGGGCAGCAGGAGGAGGG + Intronic
1182030056 22:27151682-27151704 GCTACTAAGCAGCCTGAGGGGGG - Intergenic
1182418978 22:30239490-30239512 CCAAATAGGCAGCGGGAGGAGGG + Intergenic
1182647415 22:31821557-31821579 GCTACAAGGCAGCGGGCAGAGGG + Exonic
1182772533 22:32805538-32805560 GCTGCTATCCAGCTGGAGGAGGG + Intronic
1183067163 22:35371208-35371230 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1183471336 22:38008431-38008453 GCTACTAGGGAGGCGGAGGCAGG + Intronic
1183915395 22:41114291-41114313 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1184223502 22:43115572-43115594 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1184743963 22:46445380-46445402 GCTACTAGGCAGGCTGAGGCAGG + Intronic
1185177457 22:49336532-49336554 GCTACTAGGCAGGCTGAGGCAGG - Intergenic
1185378025 22:50491370-50491392 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
949647048 3:6107495-6107517 GCTACAAAGATGCAGGAGGAAGG - Intergenic
950009106 3:9709876-9709898 GCTACTAGGGAGGATGAGGCAGG + Intronic
950050267 3:9983257-9983279 GCTACTAGGGAGCCTGAGGCAGG - Intronic
950210246 3:11117749-11117771 GCCCTCAGGCAGCAGGAGGAAGG + Intergenic
951207159 3:19936754-19936776 GCTACTAGGGAGGCTGAGGAAGG + Intronic
951224719 3:20107918-20107940 GCTACTTGGCAGCCTGAGGCAGG - Intronic
951532029 3:23706779-23706801 GCTACTCGGGAGCATGAGGCAGG + Intergenic
952069987 3:29623003-29623025 GCTACTAGGGAGGCTGAGGAAGG + Intronic
952109430 3:30105461-30105483 GCTACTTGGAAGAAGGAGGCAGG + Intergenic
952238918 3:31509708-31509730 GCTTCCAGGCAGCAGGGAGAAGG - Intergenic
952365157 3:32667695-32667717 GCTACTAGAGAGGAGGAGGTAGG + Intergenic
952411867 3:33056523-33056545 GCTACTAGGGAGGATGAGGTGGG - Intronic
952910318 3:38179140-38179162 GCTACTAGGGAGCGTGAGGTAGG - Intronic
953152921 3:40341476-40341498 GCTACTAGGGAGGATGAGGCAGG + Intergenic
953207374 3:40843234-40843256 GCTACTAGGGAGCATGAGGTAGG + Intergenic
953446847 3:42975774-42975796 GCTACTTGGTACCAGGAAGATGG + Intronic
953859960 3:46535736-46535758 GCTACTAGGGAGAATGGGGAAGG + Intronic
954190824 3:48959202-48959224 GCTACTAGGGAGGCGGAGGCAGG + Intronic
954737002 3:52715046-52715068 GCTACTGGGCAGAAGGGGGCGGG + Intronic
954819333 3:53312060-53312082 GCTACTTGGCAGGCTGAGGAAGG - Intronic
956826436 3:73001460-73001482 GCTACTTGGGAGGAGGAGGTAGG + Intronic
957222924 3:77407665-77407687 GCAACAAGCCAGCAGGAGGCTGG - Intronic
957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG + Intergenic
957426996 3:80051677-80051699 GCTCCTGGGCAGAAGGAGGCTGG + Intergenic
957565140 3:81876205-81876227 GCTACTAGGGAGGCGGAGGCAGG - Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
957905690 3:86552432-86552454 GCTACTTGGCAGGATGAGGCAGG - Intergenic
958810916 3:98859152-98859174 ACTGCAAGGCAGCAGGAGGCTGG + Intronic
959910747 3:111761071-111761093 GCTACTAGGGAGGCTGAGGAAGG + Intronic
960239731 3:115326253-115326275 GCTAGTAGCCAGCAGGAGTGTGG - Intergenic
960453556 3:117841458-117841480 GCTACCAGGAAGAAAGAGGAGGG - Intergenic
960593362 3:119386721-119386743 GATACAAGGCAGAAGGAGCAGGG + Intronic
960979175 3:123205574-123205596 GCTACTTGGCAGGATGAGGCAGG + Intronic
961041127 3:123679193-123679215 GCTACTAGGCAGGCTGAGGCAGG + Intronic
961379164 3:126486192-126486214 GCCTCTAGGCAGCAGGTGGGTGG - Intronic
962038140 3:131676168-131676190 GCTACTAGGAAGGAGGCTGAAGG - Intronic
962220352 3:133559688-133559710 GCTACTCGGGAGCCGGAGGCAGG + Intergenic
962234093 3:133693154-133693176 GCGACTAGGGATAAGGAGGAAGG - Intergenic
962798494 3:138869492-138869514 GCTACTAGGGAGCCTGAGGCAGG - Intergenic
962986389 3:140540042-140540064 GCAAATAAGCAGCAGTAGGAAGG - Intronic
963104698 3:141637034-141637056 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
963368080 3:144363987-144364009 GCTACTAGGAAGAGGGATGAAGG + Intergenic
963989206 3:151633823-151633845 GCTAATAGGCTCCAGGAGAATGG - Intergenic
964272845 3:154977295-154977317 GCTACTAGGCAGACTGAGGCAGG + Intergenic
964585251 3:158291087-158291109 GCTACTTGGGAGCCTGAGGATGG + Intronic
964706361 3:159622804-159622826 GCTACTAGGCAGGCAGAGGCAGG + Intronic
964821861 3:160779632-160779654 GCTACTAGGGAGGCGGAGGCAGG - Intronic
966302488 3:178495107-178495129 GCTCCTGGGCACCTGGAGGATGG - Intronic
966724498 3:183097504-183097526 GCTACTTGGGAGGATGAGGAGGG - Intronic
966849570 3:184156134-184156156 GCTCCTCGGCAGGAGGAGGATGG - Intronic
967131342 3:186473529-186473551 GCAGCTTGGCAGCAGCAGGAAGG - Intergenic
968338110 3:197930920-197930942 GCTACTAGGGAGGTGGAGGCAGG + Intronic
968959588 4:3736316-3736338 GCTTCTGGGCAGCAGGGGGTGGG - Intergenic
969122819 4:4922390-4922412 TCTACTAGCCAGGAGGAGGCTGG - Intergenic
969794472 4:9516145-9516167 GCTACTCGGGAGCTGGAGGCAGG - Intergenic
970424824 4:15936400-15936422 GCTGCTACTGAGCAGGAGGAGGG - Exonic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
971730147 4:30368757-30368779 GCTACTAGGCAGGCTGAGGCTGG + Intergenic
972392835 4:38629285-38629307 GCTACTGGTCAGCAGTAGGCTGG - Intergenic
972617403 4:40713097-40713119 GCTACTCGGCAGCCTGAGGCAGG - Intergenic
972620648 4:40745254-40745276 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
973106459 4:46344694-46344716 ACTACTACACAGAAGGAGGAGGG + Intronic
973318913 4:48790112-48790134 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
974120117 4:57627798-57627820 GCTACTAGGGAGGATGAGGCTGG + Intergenic
974936357 4:68413486-68413508 GCTACTAGGGAGGCGGAGGCAGG + Intergenic
975303486 4:72819990-72820012 GCTACTAGACAGGCGGAGGTAGG - Intergenic
975326257 4:73062166-73062188 GCTACTTGGGAGGAGGAGGCGGG - Intronic
975523227 4:75322348-75322370 GCTACTTGGGAGAAGGAGGCAGG + Intergenic
975556999 4:75674832-75674854 GCTACTAGGGAGCCTGAGGCAGG - Intronic
975978465 4:80126862-80126884 GCGACTAGAAAGGAGGAGGAAGG - Intergenic
976273402 4:83252213-83252235 TCTTCTAGGGAGCAGGGGGACGG + Intergenic
976422723 4:84864999-84865021 GCTACTAGGGAGGCTGAGGAGGG - Intronic
976481835 4:85555669-85555691 GCTGGGAGGCAGCAGGAGAAGGG + Intronic
976770525 4:88647338-88647360 GCTGCTAGTCAGTAGCAGGAAGG + Intronic
977346239 4:95820288-95820310 GCTACTAGGGAGGATGAGGCAGG + Intergenic
977694940 4:99954720-99954742 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
978278822 4:106985095-106985117 GCTACTAGGCAGGCTGAGGCAGG + Intronic
979010725 4:115365640-115365662 GGGACAAGGCAGCAGGAGGCTGG - Intergenic
979468580 4:121070554-121070576 GAAGCGAGGCAGCAGGAGGAGGG + Intronic
979923288 4:126527384-126527406 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
980771301 4:137377035-137377057 GCTACTTGGGAGGATGAGGAAGG + Intergenic
980885000 4:138752644-138752666 GCTACTGGGGTGGAGGAGGAAGG - Intergenic
981132478 4:141172912-141172934 GCTACTAGGGAGCCTGAGGCAGG + Intronic
981533579 4:145776347-145776369 GCTACTTGGGAGGAGGAGGTGGG + Intronic
982018818 4:151183101-151183123 GCTACTAGGAAGGATGAGGCAGG - Intronic
983037441 4:162885219-162885241 GCTACTTGGGAGGCGGAGGAAGG + Intergenic
983357750 4:166685538-166685560 GGTAAAAGGCAGTAGGAGGATGG - Intergenic
983630174 4:169842017-169842039 ACTCCTTGGCAGCAGCAGGATGG + Intergenic
984065805 4:175046520-175046542 GCAACTTGGCAGCAGGTGGAGGG - Intergenic
984077682 4:175204416-175204438 GCTACTCGGAAGCTGGAGGCAGG - Intergenic
984112148 4:175629892-175629914 GCTACTTGGGAGCCGGAGGCAGG - Intergenic
984137992 4:175965723-175965745 GCTACTAGGGAGGCTGAGGAAGG - Intronic
984228802 4:177068310-177068332 GCTATTAAACAGCAGGAAGAAGG + Intergenic
984255631 4:177387225-177387247 GCTACTCGGCAGGCTGAGGAAGG + Intergenic
984281688 4:177678360-177678382 GCTACTCGGGAGCCTGAGGAAGG - Intergenic
986117915 5:4798544-4798566 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
986174234 5:5338454-5338476 GCTACTTGGGAGGATGAGGAAGG - Intergenic
987051528 5:14150323-14150345 GCTACAAGGGGGCAGGAGGCAGG + Intronic
988011683 5:25495243-25495265 GCTACTAGGGAGGATGAGGCAGG + Intergenic
988302541 5:29449532-29449554 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
988518435 5:31924849-31924871 TCTACTAGGCAGAAGGAATAAGG - Intronic
989195386 5:38711654-38711676 GCTACTTGGGAGCAGGAGGCAGG - Intergenic
989625923 5:43429466-43429488 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
989786621 5:45340028-45340050 GCTACTAGGGAGCCTGAGGCAGG - Intronic
990567660 5:57045851-57045873 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
990570223 5:57071036-57071058 GCTTTTAGGCAGATGGAGGAAGG + Intergenic
990879555 5:60524116-60524138 GTTATTGGGCAGCAGGAGGTGGG - Intergenic
991060847 5:62374098-62374120 GCTACTAGGCAGGCTGAGGTGGG + Intronic
991603693 5:68379161-68379183 GCTACTTGGGAGAATGAGGAAGG + Intergenic
992477628 5:77118972-77118994 GATACTAGGGATCAGGAGTAAGG + Intergenic
993294288 5:86114747-86114769 GCTACTGGGGAGCATGAGGTAGG + Intergenic
994177591 5:96728586-96728608 GCTACTCGGGAGGCGGAGGAAGG - Intronic
994371292 5:98970520-98970542 GCTACTTGGGAGGTGGAGGAGGG + Intergenic
994401659 5:99288035-99288057 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
994779518 5:104071390-104071412 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
995245172 5:109927217-109927239 GCTACTAGGGAGGCGGAGGCAGG + Intergenic
997065351 5:130553352-130553374 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
997606642 5:135179612-135179634 TCTACCTCGCAGCAGGAGGAGGG + Intronic
997820951 5:137065114-137065136 GCTACTAGGGAGGATGAGGCAGG + Intronic
998007648 5:138667492-138667514 GCTACTAGGGAGGATGAGGCAGG + Intronic
998088176 5:139343827-139343849 GCTACTAGGGAGGCGGAGGCAGG - Intronic
998475402 5:142417078-142417100 GCTACTTGGGAGTATGAGGAAGG - Intergenic
998653740 5:144151374-144151396 GCTACTCGGCAGGCTGAGGAGGG + Intergenic
998750651 5:145318139-145318161 GCTACTAGGAAGCAAGGGAAGGG + Intergenic
998826719 5:146109026-146109048 GCTACTAGGAAGGCTGAGGAGGG + Intergenic
999153456 5:149441939-149441961 GCTCCTGTGCAGCTGGAGGAAGG + Intergenic
999210378 5:149882944-149882966 GCTACTAGGCAGGCTGAGGCAGG + Intronic
1000059906 5:157645548-157645570 GCTACTAGGGAGCCTGAGGTGGG + Intronic
1000682669 5:164205400-164205422 GCTACTAGGGAGCTGGTGCAGGG - Intergenic
1001028501 5:168244535-168244557 GCTGCTGGGCAGCCAGAGGAAGG - Exonic
1001117203 5:168949709-168949731 GCTACTAGGGAGGATGAGGTGGG - Intronic
1002660114 5:180786046-180786068 GCTACCAGGAAGCAGGAGAGGGG - Intergenic
1003246092 6:4383467-4383489 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1003700515 6:8459766-8459788 GCTACTTGGCAGGCTGAGGAAGG - Intergenic
1003894417 6:10593447-10593469 GCTACTTGGCAGCCTGAGGCAGG - Intronic
1004148688 6:13093981-13094003 GCTACTTGGGAGCCTGAGGAGGG - Intronic
1004180754 6:13378774-13378796 GTTCCTAGGCTGCAGGAGGTGGG - Intronic
1004638114 6:17487888-17487910 GCTACTAGGCAGGCTGAGGTGGG - Intronic
1004734634 6:18393007-18393029 GCTACTAGGGAGCCTGAGGCAGG + Intronic
1004786787 6:18976699-18976721 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1005045018 6:21633694-21633716 GCTACTAGGGAGGTGGAGGTTGG + Intergenic
1005611988 6:27535176-27535198 GCTACTAGGGAGCCTGAGGCAGG - Intergenic
1005645508 6:27834057-27834079 GCTACTAGGGAGCCTGAGGTAGG + Intergenic
1006095664 6:31655051-31655073 GCTACTAGGGAGGCTGAGGAGGG - Intronic
1006197473 6:32254821-32254843 GCTACTGGGGAGGAGGAAGATGG + Intergenic
1006656997 6:35604117-35604139 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1006781540 6:36635869-36635891 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1006854751 6:37125002-37125024 GCTACTAGGCAGGCTGAGGTGGG + Intergenic
1006945514 6:37781965-37781987 GCTACTTATCAGCAGGAGAAGGG + Intergenic
1007164215 6:39817165-39817187 GAAACTATGCAGCTGGAGGAAGG + Intronic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1007495299 6:42256017-42256039 GCTACTAGGAAGGCTGAGGAGGG + Intronic
1007605235 6:43113319-43113341 GCTACTAGGGAGCCTGAGGCAGG + Intronic
1007793021 6:44324490-44324512 GCTACTTGGGAGACGGAGGAGGG - Intronic
1008100899 6:47390498-47390520 GCTACTTGGGAGCATGAGGCAGG - Intergenic
1009463657 6:63944820-63944842 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1010465984 6:76166881-76166903 GCTTGGAGGCAGCAGGAGAAAGG - Intergenic
1010852062 6:80789552-80789574 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1011683732 6:89807196-89807218 GCTACTTGGCAGGATGAGGCAGG - Intronic
1011854707 6:91675368-91675390 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1012475228 6:99609345-99609367 GCTTCAAGACAGGAGGAGGAGGG - Intronic
1012889873 6:104885759-104885781 GCTCCGAGGCAGCAGGGGGCTGG - Intergenic
1013174941 6:107668956-107668978 GCTTCCAGGGAGCAGAAGGAGGG + Intergenic
1013240241 6:108238516-108238538 GCTACTAGGGAGCCTGAGGTAGG + Intronic
1013402849 6:109815525-109815547 GGTACCAAGCAGCATGAGGAGGG - Intronic
1014734615 6:125077796-125077818 GCAACTAGGCAAAAGTAGGAAGG - Intronic
1014945743 6:127495083-127495105 GCTACTAGGAAGGCGGAGGCAGG + Intronic
1015266143 6:131294090-131294112 GCTACTAGGCAGGCTGAGGGAGG - Intergenic
1015831786 6:137377706-137377728 GCTACTTGGAAGCCGGAGGCAGG + Intergenic
1015928270 6:138331686-138331708 GCCCTTAAGCAGCAGGAGGATGG + Intronic
1015941725 6:138459097-138459119 GCTACTCGGCAGGCTGAGGAAGG - Intronic
1016068713 6:139711504-139711526 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1017875374 6:158519942-158519964 GCTACTGTGGAACAGGAGGAAGG - Intergenic
1019104561 6:169657508-169657530 GCTACCAGGCAGAAGGTGAAAGG + Intronic
1019328102 7:449138-449160 GCTACTCGGCAGGCTGAGGAAGG + Intergenic
1019675064 7:2306237-2306259 GCTACTCGGGAGCCTGAGGAAGG - Intronic
1019774142 7:2902284-2902306 GCTACTAGGGAGGATGAGGCTGG + Intergenic
1020079112 7:5277090-5277112 GCTACTTGGAAGCATGAGGCAGG - Intronic
1020180031 7:5915101-5915123 GCTCCGTGACAGCAGGAGGAGGG + Intronic
1020302903 7:6809781-6809803 GCTCCGTGACAGCAGGAGGAGGG - Intronic
1020327714 7:6987972-6987994 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1020547164 7:9546768-9546790 GCTACTCGGGAGAAGGAGGCAGG + Intergenic
1022076636 7:26977784-26977806 GCTACTCGGCAGGCTGAGGAAGG - Intronic
1022080470 7:27015080-27015102 GCTACTAGGGAGGATGAGGTGGG + Intergenic
1022910773 7:34898164-34898186 GCTACTTGGCAGGATGAGGTGGG - Intergenic
1023027093 7:36060569-36060591 GCTACTCGGGAGGAGGAGGCAGG + Intergenic
1023156672 7:37258154-37258176 GCTACTCGGGAGCCTGAGGAAGG + Intronic
1023162159 7:37307999-37308021 GCTACTTGGCAGGATGAGGCAGG + Intronic
1023415121 7:39924924-39924946 GCTACTCGGCAGCCTGAGGCAGG + Intergenic
1023682359 7:42700698-42700720 TCTATTAGGGAGCAGGGGGACGG - Intergenic
1024072670 7:45799689-45799711 GCTACTAGGGAGGATGAGGTGGG - Intergenic
1024390134 7:48800301-48800323 GCTACTCGGGAGCCTGAGGAAGG + Intergenic
1024650667 7:51400490-51400512 GCTACTAGGGAGGATGAGGTGGG + Intergenic
1024726580 7:52203903-52203925 GCTACTAGGGAGGCTGAGGAGGG - Intergenic
1025054785 7:55756075-55756097 GCTACTAGGGAGGATGAGGTGGG + Intergenic
1025132859 7:56386300-56386322 GCTACTAGGGAGGATGAGGTGGG + Intergenic
1025199784 7:56955095-56955117 GCTACTTGGGAGCATGAGGCAGG + Intergenic
1025257564 7:57395399-57395421 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
1025276717 7:57588628-57588650 GCTACTAGGGAGGATGAGGCAGG - Intergenic
1025617656 7:63136737-63136759 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1025672161 7:63621836-63621858 GCTACTTGGGAGCATGAGGCAGG - Intergenic
1026239001 7:68555458-68555480 GCTACTAGGGAGCCTGAGGCTGG + Intergenic
1026680346 7:72461894-72461916 GCTACTAGGGAGGCGGAGGCAGG + Intergenic
1026684773 7:72500021-72500043 GCTACTAGGGAGGCGGAGGCAGG - Intergenic
1026831145 7:73610933-73610955 GCTACTAGGCAGGCTGAGGCAGG - Intronic
1027423732 7:78041561-78041583 GCTACTAGGGAGAATGAGGTGGG + Intronic
1027567230 7:79810786-79810808 GCTACTAAGGAGCCTGAGGAAGG + Intergenic
1027900667 7:84110265-84110287 AAAACTAGGGAGCAGGAGGAAGG - Intronic
1027913836 7:84288584-84288606 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1028965511 7:96797336-96797358 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1029050199 7:97678738-97678760 GCTACTAGGGAGGATGAGGTGGG - Intergenic
1029077239 7:97944722-97944744 GCTACTAGGGAGGTGGAGGCAGG + Intergenic
1029165850 7:98589769-98589791 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
1029206497 7:98872069-98872091 GCTACTTGGGAGCCTGAGGAAGG + Intergenic
1029469922 7:100747878-100747900 GCTACTAGGGAGCCTGAGGTGGG + Intronic
1029560231 7:101297959-101297981 GCTACTTGGGAGGCGGAGGAAGG + Intergenic
1029936154 7:104426366-104426388 GCTACTAGGGAGGATGAGGCAGG - Intronic
1030130219 7:106193599-106193621 GGTCCCAGGAAGCAGGAGGATGG + Intergenic
1030345909 7:108432788-108432810 GCTACTAGGAAGCATGAGACAGG + Intronic
1030754514 7:113271819-113271841 TCTTGTAGGCAGCAGGTGGATGG - Intergenic
1031177194 7:118368470-118368492 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1031964260 7:128016227-128016249 GCTACTAGGGAGGCTGAGGAGGG - Intronic
1032359296 7:131240067-131240089 GCTACTTGGCAGGCTGAGGAGGG + Intronic
1033497452 7:141913652-141913674 GCTACTAGGTAGCCTGAGGCAGG + Intronic
1033535248 7:142306371-142306393 GCTACTAGGAAGGCGGAGGCAGG - Intergenic
1034166124 7:149026537-149026559 GCTACTAGGGAGGTGGAGAAAGG + Intronic
1034237413 7:149583145-149583167 CCTCCCAGGCAGCAGGAAGATGG - Intergenic
1034359368 7:150480633-150480655 GCTACTCGGCAGCCCGAGGCAGG - Intergenic
1034837962 7:154370092-154370114 GCTACTAGGGAGGATGAGGCAGG - Intronic
1035213076 7:157343269-157343291 GCTACTCGGCAGCCTGAGGCAGG - Intronic
1035229704 7:157457604-157457626 GATGCGAGGCAGCAGGAGAAAGG - Intergenic
1035514636 8:222199-222221 GCTACTAGGGAGAATGAGGAAGG + Intergenic
1035829517 8:2679888-2679910 GCTACTCGGTAGCCTGAGGAAGG - Intergenic
1036143927 8:6235337-6235359 GCTACTTGGCAGGATGAGGCAGG - Intergenic
1036410143 8:8492363-8492385 GCTGCTAGCCTGCTGGAGGACGG - Intergenic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1038062866 8:23931475-23931497 GCTACTAGGGAGGCTGAGGATGG + Intergenic
1038085490 8:24192231-24192253 GTTTCAAGGCAGCAGGAGAAAGG - Intergenic
1038213977 8:25545016-25545038 GCTACTAGGGAGATTGAGGAGGG - Intergenic
1038427251 8:27471856-27471878 GCCCCTAGGCAGCTGCAGGATGG + Intronic
1038435595 8:27533697-27533719 GCTACTAGGGAGAATGAGGCAGG - Intronic
1038569351 8:28647214-28647236 GCTACTAGGGAGGATGAGGGAGG - Intronic
1038969990 8:32622512-32622534 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1039505225 8:38047102-38047124 GCTGCTTGGAAGCAGGAAGATGG + Intronic
1039560890 8:38511609-38511631 GCTACTAGGGAGGCTGAGGAAGG - Exonic
1039754620 8:40510576-40510598 GCTACTAGGAAGGCTGAGGAAGG - Intergenic
1039812892 8:41065418-41065440 GCTACTAGGGAGGCTGAGGAGGG + Intergenic
1040040437 8:42911337-42911359 GCTACTAGGGAGACTGAGGAAGG + Intronic
1040051930 8:43023562-43023584 GCTACTAGGGAGGATGAGGCAGG - Exonic
1040354146 8:46599734-46599756 GCTACTAGGCAGGCTGAGGTGGG + Intergenic
1040502319 8:48016007-48016029 GCTACTAGGGAGCCTGAGGCAGG - Intronic
1041106061 8:54445032-54445054 GCTACTTGGGAGCCTGAGGAAGG + Intergenic
1041584309 8:59498094-59498116 GCTACCAATCACCAGGAGGAGGG - Intergenic
1041655383 8:60344728-60344750 GCTACTCGGGAGGCGGAGGAAGG - Intergenic
1041852597 8:62409294-62409316 GCTACTTGGCAGGCTGAGGAAGG - Intronic
1042557253 8:70043872-70043894 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1042566348 8:70116073-70116095 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1043538432 8:81232081-81232103 GCTACTAGGGAGGCTGAGGATGG - Intergenic
1044177340 8:89144489-89144511 GCTACTAGGGAGCCTGAGGCAGG - Intergenic
1044649973 8:94483819-94483841 GCTACTAGGAAGGCTGAGGAAGG + Intergenic
1044697602 8:94938479-94938501 GCAACTAGGCAGCTTCAGGATGG + Intronic
1045321633 8:101086262-101086284 GCTACTAGGGAGCCTGAGGTGGG - Intergenic
1045917722 8:107492445-107492467 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1045948082 8:107819703-107819725 GCTAAGAGGCAGGAAGAGGAGGG - Intergenic
1046129659 8:109951494-109951516 ACTACTAGAGAGCAGAAGGAAGG - Intergenic
1046645624 8:116782611-116782633 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1047084212 8:121498381-121498403 GCTACTCGGGAGCAGGGGAATGG - Intergenic
1047362099 8:124178572-124178594 GCTACTTGGCAGGCTGAGGAAGG + Intergenic
1047380048 8:124353013-124353035 GCTACTAGGGAGGATGAGGCAGG + Intronic
1048328885 8:133458995-133459017 GCTACTAGGGAGGCTGAGGAGGG - Exonic
1048623894 8:136163747-136163769 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1048769153 8:137877018-137877040 GCTACTCGGCAGCCTGAGGCAGG + Intergenic
1049083424 8:140459387-140459409 GCTACTAGGCAGTCTGAGGCAGG + Intergenic
1049367721 8:142248802-142248824 GATACAGGGCAGCAGGAGGCTGG - Intronic
1049575445 8:143387721-143387743 TCTCCAAGTCAGCAGGAGGAAGG + Intergenic
1049905203 9:210126-210148 GCTACTAGGGAGGATGAGGCCGG - Intergenic
1049993005 9:1007646-1007668 GATACTAGGAAGAAGGAAGAAGG + Intergenic
1050501662 9:6304709-6304731 GCTACTAGGGAGACTGAGGAGGG - Intergenic
1050536398 9:6634415-6634437 GCTACTAGGGAGGCTGAGGAGGG + Intronic
1051399144 9:16660340-16660362 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1051778210 9:20659106-20659128 GCTACTTGGCAGGCTGAGGAAGG + Intronic
1051840457 9:21391951-21391973 GCTGCGAAGCAGGAGGAGGAAGG + Intergenic
1052265680 9:26569562-26569584 GCTACTAGGGAGGATGAGGCGGG + Intergenic
1052286960 9:26797139-26797161 GCTACTAGGGAGGCGGAGGCAGG - Intergenic
1052588545 9:30460529-30460551 GCTACTAGGCAGGCTGAGGCAGG + Intergenic
1053142079 9:35688739-35688761 GGTACTAGCCTGCAGGAGGAGGG - Intronic
1053236151 9:36456168-36456190 GCTACTAGGAAGGCTGAGGAAGG - Intronic
1054294392 9:63322681-63322703 GCTACTCGGCAGGATGAGGCAGG + Intergenic
1054944457 9:70781211-70781233 GCTACTTGGGAGGCGGAGGAAGG + Intronic
1055053298 9:72000838-72000860 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1055091708 9:72370060-72370082 GCTACTAGGGAGGCGGAGGCAGG - Intergenic
1055209901 9:73779225-73779247 TTCACCAGGCAGCAGGAGGAGGG - Intergenic
1055600270 9:77909316-77909338 TCTACTGGGCAGCTGGTGGATGG - Intronic
1056161208 9:83895938-83895960 GCTACTAGGGAGGTGGAGGCAGG + Intronic
1057286428 9:93758417-93758439 GCCCCTAGGCAGCATCAGGATGG - Intergenic
1057640565 9:96816229-96816251 GTTAGAAGGCAGCAGGAGAAAGG + Intergenic
1057884779 9:98822070-98822092 CAAACTAGGCAGGAGGAGGAGGG - Intronic
1058368802 9:104240446-104240468 TCTACTAAGCAGCAGCAGAAAGG + Intergenic
1059060959 9:111035331-111035353 GCTACTTGGGAGGCGGAGGAGGG - Intronic
1059203917 9:112445634-112445656 GCTACTAGGGAGGCTGAGGAAGG - Intronic
1059353411 9:113682025-113682047 CCTAGCAGGCAGCAGGAGAAAGG - Intergenic
1059855283 9:118389557-118389579 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1060439458 9:123625630-123625652 GCTACTAGGCAGGCAGAGGCAGG + Intronic
1060643099 9:125255558-125255580 GCTACTTGGGAGCATGAGGCAGG + Intergenic
1060688965 9:125639127-125639149 GCTACTGGGGAGCATGAGGCAGG + Intronic
1060913022 9:127365784-127365806 GCTACTAAGCAGCAGGGCCAGGG + Intronic
1061093099 9:128438262-128438284 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1061095479 9:128454654-128454676 GCTACTAGGGAGGAGGAGGCAGG - Intergenic
1061182183 9:129031073-129031095 GCTACTAGGGAGGATGAGGCAGG + Intergenic
1061241219 9:129373896-129373918 GCTACTTGGGAGGAGGTGGAAGG + Intergenic
1061517349 9:131097329-131097351 GCTACTCGGGAGGATGAGGAGGG - Intronic
1061644797 9:131992507-131992529 GCTACTCGGGAGCCTGAGGAGGG - Intronic
1061684009 9:132259801-132259823 GCTACTAGGGAGCCTGAGGCAGG + Intergenic
1061703240 9:132432464-132432486 GCTAGCAAGCAGCAGAAGGAGGG - Intronic
1062176455 9:135165922-135165944 GCTCCTAAGCACCAGGTGGAAGG - Intergenic
1062223386 9:135433276-135433298 GCTACTAGGGAGGCTGAGGAAGG + Intergenic
1185526647 X:785488-785510 GCTACTCGGGAGACGGAGGAAGG - Intergenic
1186012090 X:5145801-5145823 GCTACTAGGGAGGATGAGGTGGG - Intergenic
1186479898 X:9888553-9888575 GCTACTAGGGAGAATGAGGTGGG - Intronic
1187132192 X:16513695-16513717 GCTACTAGGTAGGATGAGGTGGG - Intergenic
1187441854 X:19327959-19327981 GCTAGAAGGGAGCCGGAGGAAGG - Intergenic
1187888674 X:23913290-23913312 GCTACTAGGGAGGCGGAGGCAGG - Intronic
1188136080 X:26496962-26496984 GCTATTCAGCAGCAGGAGAAGGG + Intergenic
1188325281 X:28794675-28794697 TCTTCTAGACAGCAAGAGGAAGG + Intronic
1189068517 X:37837648-37837670 GCTACTCGGCAGGCGGAGGCAGG - Intronic
1189356949 X:40317108-40317130 GCTACTTGGCAGGCTGAGGAGGG + Intergenic
1189802496 X:44704810-44704832 GCTACTAGGGAGAATGAGGCAGG + Intergenic
1190800153 X:53780735-53780757 GCTACTAGGGAGGATGAGGCAGG - Intergenic
1193696753 X:84717180-84717202 GTTACTACGCAACAGGATGAAGG + Intergenic
1193824454 X:86205670-86205692 GCTACTAGGGAGGCTGAGGAGGG - Intronic
1194059382 X:89178375-89178397 GCTACTAGGGAGGCTGAGGAAGG - Intergenic
1194837926 X:98704271-98704293 GCTACTTGGGAGCCTGAGGAAGG + Intergenic
1195047894 X:101070726-101070748 GCTACTTGGGAGGCGGAGGAGGG - Intergenic
1196016379 X:110944546-110944568 GCTGCTGGGCAGGAGGAGCAGGG - Intronic
1196060599 X:111403932-111403954 GCTACTAGGGAGGCTGAGGAAGG + Intronic
1196342339 X:114609901-114609923 ACTACAAAGAAGCAGGAGGATGG + Intronic
1196682186 X:118480752-118480774 GCTACTTGGGAGCCTGAGGAAGG - Intergenic
1196787588 X:119434551-119434573 GCTACTAGGAAGGCTGAGGAAGG + Intronic
1196801606 X:119548420-119548442 GCTACTAGGGAGGATGAGGCAGG + Intronic
1197149827 X:123207997-123208019 GCTTCTGAGCAGCAGGAGGAAGG - Intronic
1197462420 X:126758623-126758645 GCTACTAGGGAGGCGGAGGCAGG + Intergenic
1200084679 X:153598302-153598324 GCTACTCGGAAGCGTGAGGAAGG + Intronic
1201301584 Y:12509741-12509763 GCTACTTGGGAGCCTGAGGAAGG + Intergenic
1201313504 Y:12620570-12620592 GCTACTTGGCAATAGGAAGATGG + Intergenic
1201369150 Y:13241952-13241974 GCTACTAGGGAGACAGAGGAAGG + Intergenic