ID: 1156499337

View in Genome Browser
Species Human (GRCh38)
Location 18:37547262-37547284
Sequence CACCCAAGGCTGCTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156499337_1156499344 -6 Left 1156499337 18:37547262-37547284 CCAGGCTGGAGCAGCCTTGGGTG 0: 1
1: 0
2: 0
3: 29
4: 317
Right 1156499344 18:37547279-37547301 TGGGTGGACGGCTGAGGGCTGGG 0: 1
1: 0
2: 0
3: 38
4: 399
1156499337_1156499343 -7 Left 1156499337 18:37547262-37547284 CCAGGCTGGAGCAGCCTTGGGTG 0: 1
1: 0
2: 0
3: 29
4: 317
Right 1156499343 18:37547278-37547300 TTGGGTGGACGGCTGAGGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156499337 Original CRISPR CACCCAAGGCTGCTCCAGCC TGG (reversed) Intronic
900422121 1:2560193-2560215 CACCCCAGGTTGCTCCACCTCGG + Intronic
900546891 1:3234399-3234421 CTCCCCAGGCTGCCCCGGCCAGG + Intronic
900996041 1:6124231-6124253 CGCCCAAGGCTGGCCAAGCCAGG + Intronic
901299713 1:8190780-8190802 CACCCCACTCTACTCCAGCCTGG - Intergenic
901302717 1:8211252-8211274 CACCCGAGGCTGCTCCACCTGGG - Intergenic
902039576 1:13483070-13483092 GACCTAGGGCTGCACCAGCCTGG + Intronic
902458724 1:16554885-16554907 CAGCCAAGGCATCTCCAGCCGGG - Intergenic
902493433 1:16853031-16853053 CAGCCAAGGCATCTCCAGCCGGG + Intronic
902919938 1:19659706-19659728 CATTCCAGGCTGCGCCAGCCAGG - Intergenic
903124688 1:21239648-21239670 CCCCCAAGGCTGGTGCAGCTGGG - Intronic
903151913 1:21415644-21415666 CAGCCAAGGCATCTGCAGCCGGG - Intergenic
904167309 1:28565741-28565763 CACACAACTGTGCTCCAGCCTGG + Intronic
904465487 1:30704931-30704953 CACCCAAGCCTGCTGCTCCCAGG + Intergenic
905863765 1:41366147-41366169 CCCCCCAGCCTGCTCCAGCAGGG + Intronic
905965719 1:42093545-42093567 GAACCAAGGCTGCTCCAGCTGGG + Intergenic
906142094 1:43539943-43539965 TACCCAAGGAAGCTCCAACCTGG - Intronic
906432571 1:45767041-45767063 CACGCCAGGGCGCTCCAGCCTGG + Intergenic
907179111 1:52553731-52553753 CTCCCAAGGCTGCTCCCCCTGGG + Intergenic
907438098 1:54462311-54462333 CATCCAAGGATGCTCCACCAGGG - Intergenic
908500439 1:64738275-64738297 CACACCACGGTGCTCCAGCCTGG - Intergenic
908612822 1:65881358-65881380 ACCCCATGGCTGCCCCAGCCAGG - Intronic
908852317 1:68387935-68387957 CTCCCAAGGCTGCTCCTCTCCGG + Intergenic
909622315 1:77682619-77682641 AACCCAAGGCTCCGCCATCCAGG + Exonic
910422257 1:87079169-87079191 CACTCCAGCCTGGTCCAGCCTGG - Intronic
910866596 1:91793760-91793782 CACACAACTGTGCTCCAGCCTGG + Intronic
912496882 1:110097603-110097625 AACCCAAGGCCGTTCCACCCTGG + Intergenic
912882246 1:113427219-113427241 CACCCAGAGGTGGTCCAGCCTGG - Intronic
913606919 1:120475483-120475505 CAGCCAAGGCATCTCCAGCTGGG + Intergenic
913988425 1:143586123-143586145 CAGCCAAGGCATCTCCTGCCGGG - Intergenic
914209514 1:145564661-145564683 CGGCCAAGGCATCTCCAGCCAGG - Intergenic
914218815 1:145658819-145658841 CACCCCACTGTGCTCCAGCCTGG - Intronic
914368661 1:147003835-147003857 CGGCCAAGGCATCTCCAGCCAGG + Intergenic
915313910 1:155017587-155017609 CACCCTTCGCTGCGCCAGCCCGG - Exonic
917118351 1:171624488-171624510 GAGCCAAGATTGCTCCAGCCTGG - Intergenic
918475435 1:184919275-184919297 AATCCAAGGCTGCTTCAGGCAGG - Intronic
918580384 1:186120102-186120124 TGCCCAAGGCTGTACCAGCCGGG - Exonic
919740888 1:200981062-200981084 CACCCTTGGCTCCTCCAACCGGG + Exonic
920875062 1:209827280-209827302 CACTCCAGCCTACTCCAGCCTGG - Intergenic
921937307 1:220806951-220806973 CACCCAACGCTGTTGGAGCCAGG - Intronic
922782441 1:228263896-228263918 CACCAAGGGCTGCCCCAGGCAGG - Intronic
923431072 1:233920927-233920949 CAGCCAGGGCTGTTCCATCCAGG - Intronic
923921887 1:238575421-238575443 CACCCCATTGTGCTCCAGCCTGG - Intergenic
924739717 1:246787978-246788000 GACCCAAGGTGGCTCCAGACTGG + Intergenic
1062982478 10:1736991-1737013 CACCCCCGGCTTCTCCACCCCGG - Intronic
1063970801 10:11380046-11380068 CCCCCCAAGCTGCTCCTGCCAGG - Intergenic
1065627919 10:27650247-27650269 CACACCACTCTGCTCCAGCCTGG - Intergenic
1067069971 10:43124164-43124186 CAGCCCAGGCTGCCCCTGCCTGG - Intronic
1067432627 10:46253863-46253885 CACCTGAGGCTGCTCCAACCCGG - Intergenic
1067440634 10:46307601-46307623 CACCTGAGGCTGCTCCAACCCGG + Intronic
1069036527 10:63651478-63651500 TAATGAAGGCTGCTCCAGCCTGG + Intergenic
1069578327 10:69546210-69546232 CACCCAGGGCTTCTGCTGCCAGG + Intergenic
1070523442 10:77274920-77274942 CAGCCAAGGCTGCCCCATCTCGG - Intronic
1070745077 10:78928780-78928802 CACCCAAGGCTGGTCAACTCCGG + Intergenic
1073069305 10:100783115-100783137 CACCCAGGGCTGCGCCTGGCTGG + Intronic
1073286982 10:102395398-102395420 ATCCCAAGGTTGCTCCAGACCGG + Intronic
1073544111 10:104334770-104334792 CACCCCATGCTGCTCCTGCCTGG + Intronic
1074116409 10:110460306-110460328 CTCCCACGGCTGACCCAGCCAGG + Intergenic
1074573775 10:114649356-114649378 CACACCAGTGTGCTCCAGCCTGG + Intronic
1075547792 10:123368496-123368518 CACCCAGAGCTGCTGCAGCCTGG - Intergenic
1076030631 10:127154858-127154880 CAGCCAAGGCAACTCCAGCCTGG - Intronic
1077177291 11:1196641-1196663 CACCGAAGGCTGCTTCTGTCCGG + Intronic
1077192945 11:1263093-1263115 CACCACAGGCTTCTGCAGCCAGG - Intergenic
1077266569 11:1653686-1653708 CACACATGGGTGCTACAGCCAGG - Intergenic
1077446335 11:2592737-2592759 CGCCCAAGGCAGCAGCAGCCGGG - Intronic
1077487590 11:2846153-2846175 CACCCTAGGCTGCGCCGGGCGGG - Intronic
1081493460 11:43583848-43583870 CACCCCAGGCTACTCCTTCCGGG + Intronic
1083871003 11:65488477-65488499 CAGGGAAGGCTGCTCCAGGCAGG + Intergenic
1084121565 11:67071900-67071922 CTCCCAGGGCTGCACCTGCCAGG + Exonic
1084459216 11:69286893-69286915 CCCCCAGGGCTCCACCAGCCAGG - Intergenic
1085482841 11:76837020-76837042 CACGGGAGGCTGCTCCAGGCAGG - Intergenic
1085715129 11:78865698-78865720 CACACAAGTCTGCTTCAGCCAGG + Intronic
1085808314 11:79657276-79657298 CTCCCCAGGCAGCTCCAGCATGG - Intergenic
1087780314 11:102294726-102294748 CACACCAGTGTGCTCCAGCCTGG - Intergenic
1088510369 11:110567276-110567298 CACCAGATGGTGCTCCAGCCAGG - Intergenic
1089365479 11:117918596-117918618 CAGCCCAGGCATCTCCAGCCCGG - Exonic
1089784548 11:120898661-120898683 CACCCCAGGATGCTGCAGCTGGG - Intronic
1089923154 11:122229731-122229753 CACGGAAGCCTGCTCCAGCCTGG + Intergenic
1090028337 11:123186332-123186354 CAACTTAGGCTGCCCCAGCCTGG - Intronic
1090247631 11:125227981-125228003 AACCCAGGCTTGCTCCAGCCAGG - Intronic
1090337595 11:125983370-125983392 GACTCAAGACTGCTCCAGCATGG - Intronic
1091178968 11:133586247-133586269 CACCCAAGGGTACTCCAGTGGGG + Intergenic
1091320414 11:134645607-134645629 CTCCCTAGGCTGCTCCAGCGGGG - Intergenic
1091789224 12:3261879-3261901 CCCCCAAGGATGCTCTGGCCTGG + Intronic
1092486069 12:8903063-8903085 GAACCAAGATTGCTCCAGCCTGG - Intergenic
1092526332 12:9312383-9312405 CCCCCAGGGCTGATACAGCCAGG + Intergenic
1092540937 12:9419402-9419424 CCCCCAGGGCTGATACAGCCAGG - Intergenic
1094512104 12:31103083-31103105 CCCCCAGGGCTGATACAGCCAGG + Intronic
1095919306 12:47513597-47513619 CATCCGAGACTGCTTCAGCCTGG - Intergenic
1096621956 12:52870716-52870738 CTCCCAGGGCGGCACCAGCCTGG + Intergenic
1100288050 12:93186552-93186574 CACCCAAGGCTAAGCCAGCTGGG - Intergenic
1101813739 12:108129741-108129763 CCACCAAGGCTCCTCCTGCCGGG - Intronic
1103833877 12:123803399-123803421 CTCCCCATGGTGCTCCAGCCAGG + Intronic
1104870373 12:131990998-131991020 CACCCAAGGATCCTCCTGCATGG - Intronic
1104992574 12:132634445-132634467 CAGCGAAGGCTCCTCCAACCTGG + Intronic
1105403956 13:20118788-20118810 GACCCCGGGATGCTCCAGCCAGG + Intergenic
1106559422 13:30835553-30835575 CACCCAAGGACGCTCAAGACAGG - Intergenic
1106972937 13:35165726-35165748 CGCCCTACTCTGCTCCAGCCTGG - Intronic
1107183146 13:37485492-37485514 CACACAAGGCTGCTCCTGGCTGG - Intergenic
1107363376 13:39643489-39643511 CACTCCAGCCTGGTCCAGCCTGG + Intergenic
1108376901 13:49822426-49822448 CAACCAAGCCTGCCCAAGCCGGG + Intergenic
1114660204 14:24338955-24338977 GCCCCAGAGCTGCTCCAGCCAGG - Intronic
1116039104 14:39664039-39664061 AACCCTTGGCTCCTCCAGCCGGG - Intergenic
1118141213 14:63085447-63085469 CACTCCTGGCTGCTACAGCCAGG + Intronic
1118765461 14:68906649-68906671 CACCCATGGCTGCTGCAGGAAGG + Intronic
1119569840 14:75660833-75660855 CCCCCAGGACAGCTCCAGCCCGG + Exonic
1120809589 14:88790682-88790704 CAGTTAAGGCTGCTCCAGCTAGG + Intronic
1122207169 14:100153574-100153596 CACCCAAACCTGGCCCAGCCTGG + Intronic
1122880255 14:104687682-104687704 CCCCCAGGGCCGCTCCTGCCTGG - Intergenic
1123007111 14:105329258-105329280 CACACAGGGCAGCTGCAGCCAGG - Intronic
1123011977 14:105353645-105353667 GAGCCAAGACTGCACCAGCCTGG - Intronic
1123026309 14:105425899-105425921 CCCTCTAGGCTGCTCCCGCCTGG + Intronic
1123044416 14:105504246-105504268 CTCCCAGGGCTCCACCAGCCCGG - Intergenic
1125624966 15:41100870-41100892 CACCCCATTGTGCTCCAGCCTGG - Intronic
1125762191 15:42104224-42104246 CACCCATGGCAGCTTCAGGCAGG - Intergenic
1125863792 15:43023554-43023576 CACTCCAGCCTACTCCAGCCTGG + Intronic
1126694592 15:51315218-51315240 CACCCAGGCCTGCTGCAGTCCGG + Intronic
1126701043 15:51367784-51367806 CACCCAGGGCTGCTCTGGGCTGG - Intronic
1127938514 15:63668437-63668459 GACCCAAGGTCACTCCAGCCCGG + Intronic
1128311380 15:66633424-66633446 CTCTCAAGGCAGGTCCAGCCTGG + Intronic
1128349450 15:66879479-66879501 CACCAAATGATGCTCCAGGCAGG + Intergenic
1129029892 15:72610436-72610458 GGCCAAAGGCAGCTCCAGCCTGG + Intergenic
1129257018 15:74339401-74339423 CCCCCCAGGCTGCTGCAGCTAGG - Intronic
1129846219 15:78768827-78768849 CACCCCAGCCTGGGCCAGCCTGG - Intronic
1130255906 15:82325982-82326004 CACCCCAGCCTGGGCCAGCCTGG + Intergenic
1130599051 15:85264004-85264026 CACCCCAGCCTGGGCCAGCCTGG - Intergenic
1131205500 15:90442400-90442422 GAGCCAAGACTGCACCAGCCAGG + Intronic
1131397312 15:92097005-92097027 CACCCAAGGCAGCACAAGACAGG + Intronic
1131782026 15:95870112-95870134 CAGCGAAGGCTGTTCCAGCCAGG + Intergenic
1132610583 16:813896-813918 CACCCAACGCTGGCCCAGCCCGG + Intergenic
1132632814 16:928101-928123 CACCCAACGCTGGGACAGCCTGG + Intronic
1132681139 16:1142253-1142275 CAGCCATGGCTGCTGCAGCGTGG + Intergenic
1132806702 16:1778335-1778357 CTCTCAGGGCTGCCCCAGCCTGG - Intronic
1133971941 16:10574500-10574522 CACCCACTGCTCCTCCAGCAGGG + Intronic
1134433768 16:14236145-14236167 CACTCCAGCCTACTCCAGCCTGG + Intronic
1134441650 16:14302479-14302501 CACCCAGGGCTGCGCCTTCCCGG - Intergenic
1135597531 16:23755362-23755384 CACCCAGGTGTCCTCCAGCCCGG + Intronic
1136059285 16:27714016-27714038 GGCCCAAGGCTGCTGGAGCCTGG - Intronic
1136080873 16:27851919-27851941 CTCCCAAGGGGTCTCCAGCCTGG + Intronic
1136291363 16:29274118-29274140 CACACAGGGCTGCTCCAGTGGGG + Intergenic
1136470190 16:30474420-30474442 CACCACAGGCTCCTCCAGACGGG - Intronic
1137476128 16:48811276-48811298 CTCCCAAGGCAGCCTCAGCCGGG + Intergenic
1137672366 16:50286506-50286528 CCCCCATGCCTGCTTCAGCCAGG - Intronic
1137863296 16:51868389-51868411 TACCCAAGGCTGCTAAACCCTGG + Intergenic
1139852517 16:69959667-69959689 CACCCAGGGAGGCTCCTGCCCGG + Intronic
1139881488 16:70182575-70182597 CACCCAGGGAGGCTCCTGCCCGG + Intronic
1139914486 16:70419632-70419654 GACCCGAGGCTGCTGCACCCAGG - Intronic
1140198106 16:72872499-72872521 CACCCCACTGTGCTCCAGCCTGG - Intronic
1140277876 16:73527117-73527139 CATCTCAGGCAGCTCCAGCCTGG + Intergenic
1141036440 16:80630355-80630377 CACCCAGGGCTGCTCCACAGAGG + Intronic
1141171924 16:81696949-81696971 TACCCAAGGCAGCTAAAGCCTGG + Intronic
1141407748 16:83808423-83808445 CACCCCCGGGTGCCCCAGCCCGG + Intronic
1141948058 16:87323763-87323785 CAGCCAAGGCAGATGCAGCCAGG + Intronic
1142097237 16:88248037-88248059 CACACAGGGCTGCTCCAGTGGGG + Intergenic
1143097867 17:4488108-4488130 CGCTCAAGGCTGCCCCAGCCTGG + Exonic
1143582750 17:7836100-7836122 TTCCCAAGGCTTCTCCCGCCCGG + Intergenic
1143634763 17:8158227-8158249 CACCCCACTGTGCTCCAGCCTGG - Intronic
1143691994 17:8576023-8576045 CACACAACTGTGCTCCAGCCTGG - Intronic
1144839155 17:18174987-18175009 CACCCCAATCTGCTCCTGCCTGG + Intronic
1145234575 17:21199719-21199741 CACCCAGGGCTTGTGCAGCCTGG - Intronic
1145769968 17:27485869-27485891 CACCCAGGGCTGCTCCCCCGAGG + Intronic
1145879782 17:28344668-28344690 CACCCCATGCTGCTGCTGCCTGG + Exonic
1146399498 17:32492106-32492128 CACCCAAGGGTCCTGCAGCCAGG - Intergenic
1149576271 17:57715728-57715750 CCAACAAGGCTGCTGCAGCCAGG - Intergenic
1150579891 17:66463052-66463074 CACCCAGCACTGCTCCAGGCCGG - Intronic
1151693253 17:75700482-75700504 CACCCAAGGCTGCACAATCATGG + Intronic
1151764375 17:76124598-76124620 GCCCCAACTCTGCTCCAGCCAGG + Intergenic
1151926025 17:77197661-77197683 GACCCAAGACTGCACCAGCCTGG - Intronic
1153904561 18:9649837-9649859 GACCCAAGGGGGCTGCAGCCAGG - Intergenic
1154507566 18:15058109-15058131 CACGCCAGGGTACTCCAGCCAGG - Intergenic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG + Intronic
1159170351 18:64758044-64758066 CACACTAGGTTACTCCAGCCTGG + Intergenic
1159914133 18:74173579-74173601 CACCCAAGGCTGTGGCACCCCGG - Intergenic
1160299533 18:77667615-77667637 CACCCAAGGAGGGTCCTGCCAGG - Intergenic
1160591438 18:79947089-79947111 CATCTAAGAGTGCTCCAGCCTGG + Intronic
1160597062 18:79983042-79983064 CACGCCACTCTGCTCCAGCCTGG - Intronic
1160772089 19:836810-836832 CACGCAAGGCTGATGCAGCCCGG - Intergenic
1161004081 19:1925771-1925793 GACCCATGGGTGCTCCATCCTGG - Exonic
1161053884 19:2180273-2180295 CTCCCGACGCTGCTCCAGCCAGG - Intronic
1161862616 19:6809520-6809542 CTCCCACCTCTGCTCCAGCCAGG - Intronic
1162327862 19:10009464-10009486 CACCCAAGGCTCCAGCAGCTGGG + Intronic
1162822278 19:13230140-13230162 CACCCGAGACTCCTCCATCCTGG - Exonic
1162853725 19:13451893-13451915 CATCCAACCGTGCTCCAGCCTGG - Intronic
1163149375 19:15401942-15401964 CGCCCAAGGCTGCTCCTCACAGG + Intronic
1163337736 19:16684434-16684456 CACACAAGTGTACTCCAGCCTGG + Intronic
1163834873 19:19567161-19567183 CAACCAGGGCTGCTTCAACCAGG - Intronic
1163883300 19:19945694-19945716 CTCCCAAGGAGGCTCCTGCCAGG - Intergenic
1165024332 19:32948679-32948701 CACCCAATGCCACTCCACCCTGG + Intronic
1165025630 19:32959171-32959193 CACCAAAGGCACCCCCAGCCTGG + Intronic
1167563127 19:50238488-50238510 CACCGCACTCTGCTCCAGCCTGG - Intronic
1167936902 19:52916262-52916284 CATGCCAGGGTGCTCCAGCCTGG + Intergenic
1168400407 19:56082879-56082901 CAAACAAGTGTGCTCCAGCCTGG - Intergenic
1168412232 19:56147189-56147211 CACCCAGAGCTCCTCCAGCAGGG - Exonic
1202708810 1_KI270714v1_random:5230-5252 TAGCCAAGGCATCTCCAGCCAGG + Intergenic
925585769 2:5462540-5462562 CATCCAAGTCTCCTCCAGCATGG + Intergenic
925586717 2:5471890-5471912 CAGCAAAGGGAGCTCCAGCCTGG + Intergenic
925918596 2:8624373-8624395 CACCAAGGGCTGCTCTAGCAGGG + Intergenic
926698702 2:15788432-15788454 CCCCCATGGCTGCTCCTTCCTGG + Intergenic
927416990 2:22890216-22890238 CAGGCAGGGCTGCACCAGCCTGG - Intergenic
929185698 2:39091704-39091726 CCCCCCAGGCTTCTCCACCCAGG + Intronic
929459184 2:42089471-42089493 CACCCAGAGATGCTCCACCCTGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933258693 2:80108193-80108215 TACCCAAGGCTGCTCCCCTCTGG - Intronic
941395552 2:164968813-164968835 CACCCAATGCTGCTCCCGATCGG - Intergenic
942828568 2:180210717-180210739 AAGCCATGACTGCTCCAGCCTGG - Intergenic
943658686 2:190534860-190534882 CACCGAAAGCTCCTCCGGCCTGG - Intergenic
943995975 2:194765957-194765979 CTGCCAAGGCAGCTCCAGCTAGG - Intergenic
946302296 2:218831350-218831372 CCCCCAAGGCTGCTCCAGGAAGG + Exonic
947637537 2:231687717-231687739 CACCCATGCCTGTTCCAGGCAGG + Intergenic
948233577 2:236370258-236370280 CACCCCAGGCTGCACCTGCACGG - Intronic
948711759 2:239829529-239829551 CTCGCAAAGCTGCTCCAGTCCGG - Intergenic
948746139 2:240095626-240095648 CACCCAAGGCTCCTGCACCGGGG - Intergenic
948746181 2:240095761-240095783 CACCCAAGGTTCCTGCACCCAGG - Intergenic
1169143688 20:3239349-3239371 CGCGGGAGGCTGCTCCAGCCGGG + Intergenic
1169230882 20:3888473-3888495 TACCAAAGGCTGCCCAAGCCCGG - Intergenic
1172786872 20:37474391-37474413 CACCCAAGGCTGCTCCGACAAGG + Intergenic
1173188872 20:40861446-40861468 CACTCAAGTCAGCTCCAGTCTGG + Intergenic
1173257984 20:41408590-41408612 CAGCCCAGGGTGCTTCAGCCAGG + Intronic
1175667282 20:60871158-60871180 CACCCAGGGATTCTCCAGGCAGG + Intergenic
1176086482 20:63297610-63297632 CACCCAGGGAGGCCCCAGCCTGG - Intronic
1176790514 21:13313672-13313694 CACGCCAGGGTACTCCAGCCAGG + Intergenic
1178265337 21:31137766-31137788 CAGCCATTGCTGCTTCAGCCTGG + Intronic
1178403226 21:32305014-32305036 CACGCCAGTGTGCTCCAGCCTGG - Intronic
1178576274 21:33794836-33794858 CACACAGGGCTTCTCCAGCAGGG + Intronic
1179181943 21:39053263-39053285 CACCCAAAGGTCCTCAAGCCAGG + Intergenic
1179190929 21:39121222-39121244 CACCCTAGGCAGCTACAGCAGGG + Intergenic
1181513169 22:23397824-23397846 GACCCAAGGCCACCCCAGCCTGG - Intergenic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1182760420 22:32718108-32718130 CACCCCACCCTGCTCCAGCTGGG - Intronic
1183636220 22:39064533-39064555 CACGCAAGGGCACTCCAGCCAGG + Intronic
1183946570 22:41329645-41329667 CACCCTAGGCTTCTCCAGGAGGG - Intronic
1184249180 22:43250574-43250596 CCCCTGAGGCTGCTCCTGCCTGG - Intronic
1184470295 22:44692242-44692264 CACCCAGGGCTCCTCCTCCCGGG + Intronic
1184470422 22:44692563-44692585 CACCCAGGGCTCCTCCTCCCGGG + Intronic
1185100535 22:48838647-48838669 CACCCCAGGGCGCTCCAGTCTGG - Intronic
1185204781 22:49531632-49531654 CAGCCAGGGCTGCCCCTGCCTGG - Intronic
1185295246 22:50049854-50049876 CACCCAGGCCTCCTCCTGCCCGG - Intronic
949391100 3:3563431-3563453 CACTAAAGGCTGGCCCAGCCTGG - Intergenic
950041908 3:9925157-9925179 CACGCCACGGTGCTCCAGCCTGG - Intronic
950523983 3:13513043-13513065 CCCCCAAGGCTCTCCCAGCCAGG + Intergenic
950555630 3:13694221-13694243 CTCCCAAGACTGCTCCAGGAGGG - Intergenic
950796054 3:15511551-15511573 CAACCAATGCTGCTCCTGCAGGG + Intronic
957149168 3:76463107-76463129 TATCCAAGGCTGCTCCCGCTGGG + Intronic
957380772 3:79426412-79426434 CACACCAGTGTGCTCCAGCCTGG - Intronic
961152066 3:124647442-124647464 CTCACAATGCTGCTCCTGCCTGG + Intronic
961449887 3:126997928-126997950 CTCACAAGGCTGCCCCTGCCAGG - Intronic
961555355 3:127693262-127693284 CAACCAAGGCAGGTCAAGCCAGG - Intronic
961629136 3:128283515-128283537 AACCCTAGGCAGCTCCAGACTGG + Intronic
962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG + Intergenic
963100849 3:141602466-141602488 CACCCACTGCTGCTCCTGCTGGG + Intronic
966734826 3:183180145-183180167 TCCCTAAGGCTGCTCCAGCAGGG - Exonic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
968644492 4:1732772-1732794 CACCCACACCTGCTCCAGCATGG - Intronic
968650186 4:1757335-1757357 CCCCCAGGGCTGCTCCAGGCAGG + Intergenic
968816610 4:2824787-2824809 CCCCCAAGGCAGGTCCAGCCTGG - Intronic
969227738 4:5810129-5810151 CTCCCAAGCCTGCACAAGCCAGG - Intronic
969904936 4:10385169-10385191 CACTGAAGGCTGCCCCACCCTGG + Intergenic
969920162 4:10530831-10530853 CACCCCAGCCTGCTCCTTCCAGG + Intronic
972346104 4:38193618-38193640 CACCGAATTCTTCTCCAGCCTGG + Intergenic
974042155 4:56866639-56866661 CACACCACGCTACTCCAGCCTGG + Intergenic
976102262 4:81578305-81578327 CACCTAGGGCTCCTCCAGCCTGG + Intronic
976338105 4:83914024-83914046 CACGCCACTCTGCTCCAGCCTGG - Intergenic
977251339 4:94692722-94692744 CACCCATTGCTGCTCCAATCGGG + Intergenic
977564345 4:98566528-98566550 TTCCCATGGCTGCTCCAGCTGGG - Intronic
981280526 4:142953449-142953471 CACCCATGGCTTCTCCAGAATGG + Intergenic
982214073 4:153065086-153065108 AACCCAAGGGAGCTCCTGCCTGG - Intergenic
984891610 4:184498868-184498890 CTCCTAGGGCTGCCCCAGCCTGG + Intergenic
986219767 5:5757401-5757423 GACCTAAGGCAGCTTCAGCCAGG - Intergenic
990904433 5:60788737-60788759 CACTCCAGCCTGGTCCAGCCTGG + Intronic
992529180 5:77638874-77638896 CAGCCCTGGCAGCTCCAGCCCGG + Exonic
995381147 5:111534751-111534773 CACACAAGGCTGCTGTAGGCAGG + Intergenic
997209754 5:132070349-132070371 CACCCCCTGCTGGTCCAGCCAGG + Intergenic
997595920 5:135107467-135107489 CAAACAAGGTTGCGCCAGCCAGG - Intronic
1002065312 5:176648680-176648702 CAGCCAGGCCTGCTACAGCCAGG - Intronic
1002429412 5:179194377-179194399 CACCTAGGGCTGCTCTATCCGGG + Intronic
1003086716 6:3066075-3066097 GAGCCAAGATTGCTCCAGCCTGG - Intronic
1005626274 6:27665466-27665488 CAGCCTGGGCTACTCCAGCCTGG - Intergenic
1005660721 6:27996524-27996546 CACACCAGGGTACTCCAGCCTGG + Intergenic
1005882961 6:30074508-30074530 CACCCCTGGCCGCTCCTGCCTGG + Intronic
1005990836 6:30900759-30900781 CACACAACTGTGCTCCAGCCTGG + Intergenic
1006362411 6:33594063-33594085 CATTCCAGCCTGCTCCAGCCTGG - Intergenic
1006531912 6:34662862-34662884 AGCCCAAGACTGGTCCAGCCTGG + Intronic
1007111382 6:39315089-39315111 GAGCCAAGGCGGCTCCAGGCAGG - Exonic
1010794426 6:80103075-80103097 CACGCAACTGTGCTCCAGCCTGG - Intergenic
1013054774 6:106573011-106573033 CTGCCAGGGCAGCTCCAGCCTGG - Intronic
1013664968 6:112338492-112338514 CACCCAAGGCTGGCCCAGTTAGG + Intergenic
1018573343 6:165233372-165233394 CACCCAAGGCTTCTCCATGGTGG - Intergenic
1019547783 7:1586768-1586790 CTCCCAAGACTGCCTCAGCCTGG - Intergenic
1020375646 7:7482479-7482501 CGCCCAATTGTGCTCCAGCCTGG + Intronic
1021920107 7:25476266-25476288 CACCCAAGGCTACCTGAGCCTGG - Intergenic
1022301317 7:29105292-29105314 CACCCATGGCTGCCACAGTCTGG - Intronic
1023959491 7:44914440-44914462 CACACTAGGCTGCCCCAGACTGG + Intergenic
1024168970 7:46764652-46764674 CACCCAGAGCTGCTCTAGCAAGG - Intergenic
1025606178 7:63041493-63041515 CAGCCGGGGCTCCTCCAGCCTGG - Intergenic
1026680850 7:72465521-72465543 CACCCCTGACTGCTGCAGCCAGG + Intergenic
1027868349 7:83674978-83675000 CACCCATTGCTGCTCCAGATTGG - Intergenic
1027992609 7:85381434-85381456 TAGCGAAGGCAGCTCCAGCCGGG - Intergenic
1028775516 7:94671674-94671696 CACCCAAGGGTTCTCTAGCTAGG + Intergenic
1029124195 7:98285833-98285855 GCCCCAAAGCAGCTCCAGCCAGG - Intronic
1029957962 7:104659448-104659470 AATCCAAGGCTGCCCCAGCAGGG + Intronic
1030348214 7:108456329-108456351 CCCCTCTGGCTGCTCCAGCCAGG + Exonic
1030568978 7:111197417-111197439 CACGCCACGGTGCTCCAGCCTGG + Intronic
1033214474 7:139483541-139483563 CACCTGCGGCTGCTCCAGCGTGG + Exonic
1034396191 7:150826602-150826624 AACCCACGAATGCTCCAGCCAGG - Intronic
1034414892 7:150959237-150959259 CACCCTGGGCTGCTCAAGCCAGG + Intronic
1034457936 7:151181503-151181525 CACCCAAGTGTGTTCCTGCCAGG - Intronic
1035165816 7:156989116-156989138 CCACCAGGGCTGCTCCCGCCCGG + Intergenic
1035515340 8:228058-228080 CACGCCAGGATGCTCCTGCCAGG + Intergenic
1037430923 8:18812507-18812529 CACCCAAGCCAGCTCCTCCCTGG - Intronic
1037880857 8:22572757-22572779 CCCCCAGGGCTGCTCGAGGCAGG - Intronic
1038634671 8:29276080-29276102 AACCCAAGACAGCTGCAGCCAGG + Intergenic
1039181450 8:34871380-34871402 CACCAAAGACTGATACAGCCAGG - Intergenic
1039384773 8:37125606-37125628 CACCCCACTCTACTCCAGCCTGG - Intergenic
1039921151 8:41895631-41895653 CAGGCACGGGTGCTCCAGCCTGG - Intronic
1040006790 8:42627908-42627930 CCAGCATGGCTGCTCCAGCCAGG + Intergenic
1040302702 8:46196173-46196195 CACCCAGGGCTGTTCCACACAGG + Intergenic
1040307210 8:46218299-46218321 CCCCCAAGGCTGTCCCAGGCCGG - Intergenic
1040308410 8:46224076-46224098 CACCCAGGGCTGTCCCGGCCTGG + Intergenic
1040325466 8:46339342-46339364 CACCCAGGGCTGTCCCAGCGGGG + Intergenic
1040330906 8:46385322-46385344 CCCCCAAGGCTGCCCCGGGCTGG + Intergenic
1040529355 8:48253901-48253923 CACCTAAGGCTGCACCCACCTGG - Intergenic
1041857248 8:62471913-62471935 CACTCCAGCTTGCTCCAGCCTGG + Intronic
1042433227 8:68733018-68733040 CACCCCACTGTGCTCCAGCCTGG + Intronic
1045011045 8:97958607-97958629 AACCCAAAGCTACTTCAGCCCGG + Intronic
1045111885 8:98944430-98944452 CTCCCCAGGCTGCCCCAGGCCGG - Exonic
1047022993 8:120796218-120796240 TTCCCAAGGCATCTCCAGCCAGG + Intronic
1048439962 8:134452618-134452640 CAAACAAGGCTGCTTCTGCCAGG + Intergenic
1048949136 8:139478621-139478643 CACCAAAAGCTGCTCCAGGCAGG - Intergenic
1050648174 9:7744761-7744783 CACACCACTCTGCTCCAGCCTGG + Intergenic
1057195347 9:93113328-93113350 CAGCTATGGCTGCTCCAGCTGGG + Intergenic
1058447500 9:105066805-105066827 CACCACAGGGGGCTCCAGCCTGG + Intergenic
1058815605 9:108680291-108680313 CACCCAAGGCAGCCCAAGGCAGG + Intergenic
1059686265 9:116639630-116639652 CATCAAAGACTGCCCCAGCCAGG - Intronic
1060553303 9:124495762-124495784 CTCCCAGGGCTGGGCCAGCCGGG - Intronic
1060597274 9:124856082-124856104 CAACCAAGGCTGCCCCCACCTGG + Intronic
1060968491 9:127724678-127724700 CAGCCCAGCCGGCTCCAGCCCGG - Intronic
1062013485 9:134279805-134279827 CACTCAACCCAGCTCCAGCCAGG + Intergenic
1062438330 9:136556957-136556979 CACACAAGGCAGTCCCAGCCAGG + Intergenic
1062496409 9:136833557-136833579 CACCCTGGGCTGCCCCAGCTGGG + Intronic
1062551207 9:137087371-137087393 CGCCCACGGCTGCCCCAACCAGG - Intronic
1062730133 9:138104036-138104058 CTCCAAAGGCTGCTCCATCATGG - Intronic
1189309576 X:40010047-40010069 CACCCAGCGCTTCTCCAGCAGGG - Intergenic
1189908086 X:45782451-45782473 CTCCCAGAGATGCTCCAGCCAGG + Intergenic
1194551976 X:95311819-95311841 CACACAATGCTGCTGCTGCCAGG + Intergenic
1195412462 X:104582930-104582952 CACACCAGTGTGCTCCAGCCTGG - Intronic
1200071987 X:153533777-153533799 CAGCCATGGCTGCACCAGTCAGG + Intronic
1200761540 Y:7043480-7043502 CACCCGAGGGCACTCCAGCCTGG + Intronic