ID: 1156499436

View in Genome Browser
Species Human (GRCh38)
Location 18:37547849-37547871
Sequence CTGTGTGAGGGTATGTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156499430_1156499436 30 Left 1156499430 18:37547796-37547818 CCTTGTGGTTAATTAAGCTTTGT 0: 1
1: 0
2: 1
3: 12
4: 176
Right 1156499436 18:37547849-37547871 CTGTGTGAGGGTATGTATCTGGG 0: 1
1: 0
2: 1
3: 30
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156499436 Original CRISPR CTGTGTGAGGGTATGTATCT GGG Intronic
900293776 1:1938304-1938326 GTGTGTGAGTGCATGTATGTGGG - Intronic
901929050 1:12585091-12585113 CTGTGTGAATGTATGTGTCTGGG + Intronic
903864578 1:26388952-26388974 CTGTGTGGGGGTGTGGATGTGGG - Intergenic
904272687 1:29360964-29360986 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
904843031 1:33386148-33386170 CTTTGTAAGGGTATGCATTTTGG + Intronic
904991683 1:34598357-34598379 GTGTGTGTGTGTATGTATTTTGG - Intergenic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905353500 1:37364162-37364184 CTGTGTGTGTGTGTGTGTCTAGG - Intergenic
906077017 1:43059155-43059177 CTGTGTGACTGTCTGTATCTTGG + Intergenic
907154245 1:52318400-52318422 GTGTGTGTGTGTGTGTATCTTGG + Intronic
907451772 1:54550063-54550085 CTCTGTGAGGGTCCTTATCTGGG - Intronic
907958942 1:59260390-59260412 CTGTGTGTGCGTGTGTACCTAGG + Intergenic
909975499 1:82041999-82042021 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
910010680 1:82457839-82457861 CTTTGTGAGGGAATGCTTCTTGG + Intergenic
910582986 1:88848636-88848658 GTGTGTGTGTGTGTGTATCTGGG + Intergenic
911294413 1:96097128-96097150 ATGTGTGAGTGTTTGTATCTGGG - Intergenic
911881519 1:103245060-103245082 TGGTGTCAGGGTTTGTATCTTGG + Intergenic
911987673 1:104650588-104650610 GTGTGTGTGTGTATGCATCTGGG + Intergenic
913992982 1:143632226-143632248 CTGTGTGTAGGTCTGTTTCTGGG - Intergenic
915291224 1:154884939-154884961 CTGTGTGAGGATAGAGATCTAGG + Intergenic
915938238 1:160101316-160101338 CTCTGTGGGGGTGTGTTTCTGGG - Intergenic
916001596 1:160621677-160621699 CTGCGTGAGGGTGTGAGTCTTGG + Intronic
916314728 1:163436668-163436690 GTGTGTGAGTGTGTGTACCTTGG + Intergenic
918869081 1:189943489-189943511 CTGTGTGAAAGTATTTATCAAGG + Intergenic
918979586 1:191538397-191538419 GTGTGTGTGTGTGTGTATCTGGG + Intergenic
921156686 1:212444553-212444575 GTGTGTGTGTGTGTGTATCTGGG + Intronic
921973126 1:221172857-221172879 GTGTGTGTGTGTGTGTATCTGGG + Intergenic
1063249891 10:4263267-4263289 GTGTGTGAGGGTGTGTAGATTGG + Intergenic
1064917874 10:20481859-20481881 CTGTGTGTGGGTTTATGTCTGGG + Intergenic
1067831527 10:49613660-49613682 CTGTGTGGGGGTCTCTATCTGGG + Intronic
1068141526 10:53014555-53014577 GTGTGTGTCGGTATGTATGTCGG + Intergenic
1068221020 10:54045573-54045595 GTGTATGAGGGTTTGTTTCTGGG - Intronic
1069189782 10:65472111-65472133 GTGTGTGTGTGTGTGTATCTGGG + Intergenic
1069777511 10:70935580-70935602 GTGTATGAAGGTATGTATGTGGG - Intergenic
1070005318 10:72418665-72418687 CTGTGTGAGGTTCTGTATCAAGG - Intronic
1070523237 10:77273027-77273049 CTGCTTTAGGGAATGTATCTTGG - Intronic
1071016060 10:80998246-80998268 CTGTTTCAGGGTATGGTTCTTGG + Intergenic
1071981249 10:91006084-91006106 ATGTGTGAGTGTATGTGTATTGG - Intergenic
1072456389 10:95580043-95580065 CTGTGTCAGGGTCTGCTTCTGGG - Intergenic
1073042057 10:100614533-100614555 CTGTGTGAGGGTATTGTTATAGG + Intergenic
1073980150 10:109145003-109145025 CTGAGAGAGGGCATGTATCTAGG - Intergenic
1074654368 10:115567185-115567207 CTGTGAAATGGTATGTAGCTAGG + Intronic
1075082685 10:119394394-119394416 CTGTGTGTGGGCATGTGTGTGGG + Intronic
1075377266 10:121988757-121988779 CTGTGTTAGAGTAGGTAGCTAGG + Intergenic
1078190453 11:9089694-9089716 CAGTGTGAGGGTAAGTGCCTTGG - Exonic
1079133679 11:17763986-17764008 CTGTGTGGGGGTCTGTGTGTGGG - Intronic
1080961411 11:37164954-37164976 GTGTATGAGCGTATGTATGTTGG + Intergenic
1081039699 11:38195149-38195171 TTGGGTGAGTGTATGTATCGAGG - Intergenic
1083256252 11:61497806-61497828 ATGTGTGAGTGTATGTGTGTGGG + Intergenic
1084439245 11:69161939-69161961 CTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1085339931 11:75724450-75724472 CTGTGGGAGGGCCTGTGTCTAGG + Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087964029 11:104390347-104390369 GTGTGTGAGTGTGTGTATGTAGG + Intergenic
1088184609 11:107151682-107151704 CTGTTTGTGTGTATGTATTTAGG + Intergenic
1089080204 11:115769795-115769817 CTGTGTGGGGGAATGAATTTAGG - Intergenic
1090366406 11:126210510-126210532 GTGTGTGTGTGTATGTATGTTGG - Intronic
1090573395 11:128072420-128072442 GTGTGTGAGTGTGTGTATTTGGG - Intergenic
1092037318 12:5348061-5348083 TTGTGTGTGTGTGTGTATCTTGG - Intergenic
1092604164 12:10100945-10100967 CCCTGTGGGGGTATGTATCCTGG - Intronic
1092686497 12:11054148-11054170 CTATGTGAGGGTATTTGTCTAGG - Intronic
1092692156 12:11125171-11125193 TTATGTGAGGGTATTTGTCTAGG - Intronic
1092820199 12:12346544-12346566 CTTTGTGAGGGTCTATTTCTGGG - Intronic
1092838860 12:12518559-12518581 CTGTGTGAGGGACTTTACCTTGG - Intronic
1094410804 12:30167170-30167192 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1094801218 12:34038106-34038128 CAGTGTGTGGGTATGTGTCGGGG - Intergenic
1095333905 12:41003675-41003697 TTGGGAGAGGGTATGTATCCAGG + Intronic
1095883209 12:47161383-47161405 ATATGTGAGGGTATGTTTCTGGG + Intronic
1096324932 12:50651637-50651659 CTATGTGAGGGTATATTTCCGGG + Intronic
1096500312 12:52060642-52060664 CTGAGTGAGGGTATGTGGATGGG - Intergenic
1097145640 12:56937626-56937648 CTGGGTGAGGTGATGTGTCTTGG - Intergenic
1097526305 12:60740305-60740327 CTGTGTGTGGCTTTGTAACTTGG - Intergenic
1098652336 12:72989007-72989029 CTGTGTGTGCGTATGTTTTTTGG + Intergenic
1100936416 12:99673029-99673051 CTTTTTGAGGGTATGGATTTTGG - Intronic
1101558778 12:105835831-105835853 CTGTGTGAGGATATGTCCCAAGG + Intergenic
1102724279 12:115045248-115045270 CTGTGTGAGGGAAGGGATTTTGG + Intergenic
1104908217 12:132226793-132226815 ATGTGTGTGGGTGTGTATATGGG - Intronic
1106018881 13:25895758-25895780 TTGGGAGAGGGTATGTATCGAGG + Intronic
1106660137 13:31790894-31790916 TTGTCTGAGGGTGTGTGTCTGGG + Intronic
1108187768 13:47905551-47905573 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1110335163 13:74321311-74321333 ATATGTGTGGGTATGTATATGGG + Intergenic
1110921538 13:81093525-81093547 GTGTGTGTGTGTATGTATGTTGG + Intergenic
1110965081 13:81684640-81684662 GTGTGTGATGGAATGTATTTTGG - Intergenic
1111183085 13:84694222-84694244 CTGTGAGGGGGAATGGATCTAGG - Intergenic
1112291999 13:98152281-98152303 ATGTGTGAGAGTATGAAGCTTGG - Intronic
1113248702 13:108427782-108427804 ATGTGTGAGTGAGTGTATCTGGG + Intergenic
1113357915 13:109600989-109601011 CTGAGAGAGGGGATGTGTCTGGG - Intergenic
1113855889 13:113445275-113445297 CTCAGTGAGGTTATGTGTCTTGG + Intronic
1114538284 14:23436645-23436667 CTCTGAGAGGGTCTGTCTCTGGG - Intergenic
1117950261 14:61075821-61075843 GTGTGTGTGTGTATGTATTTGGG + Intronic
1118091948 14:62491337-62491359 ATGTGTGAGGGTTTATTTCTGGG + Intergenic
1118754522 14:68830019-68830041 ATATGTGAGGGTTTGTTTCTGGG - Intergenic
1119258525 14:73221251-73221273 CTGAGAGAGGGAATGAATCTTGG - Exonic
1122207205 14:100153756-100153778 CTGTGTGGGTCTGTGTATCTTGG - Intronic
1122450437 14:101801992-101802014 CTATGTGAGGGTTTGTTTCTGGG - Intronic
1122979977 14:105187026-105187048 GTGTGTGTGGGTATGTGTGTGGG + Intergenic
1123054592 14:105563136-105563158 GTGTGTGAGGGTGTGTATGAGGG + Intergenic
1123967484 15:25473488-25473510 CAGTGTGAGGTTATGTTGCTAGG + Intergenic
1124483724 15:30098584-30098606 GTGTGTGTGTGTATGTATATGGG + Intergenic
1124759852 15:32439992-32440014 GTGTGTGTGTGTATGTATATGGG - Intergenic
1127823810 15:62684954-62684976 TTGTGTGAATGTATATATCTAGG + Intronic
1128486538 15:68096241-68096263 ATGTGTGAGGGTTTGTTTCTGGG + Intronic
1129936249 15:79452632-79452654 GTGTGTGTGGGTGTGTGTCTGGG + Intronic
1129936274 15:79452767-79452789 CTGTGTGCGTGTCTGTGTCTAGG + Intronic
1131493237 15:92881127-92881149 CTGTGTAAGGGAATGTCTCTTGG + Intergenic
1131619413 15:94051365-94051387 GTGTGTGTGTGTATGTATTTGGG - Intergenic
1132225795 15:100140448-100140470 CTGTGTGTGTGTGTGTGTCTTGG - Intronic
1134331090 16:13251729-13251751 CTGTGTGCAGGTATTTATTTTGG - Intergenic
1135343828 16:21670906-21670928 CTGTGAGAGGGTCTTAATCTGGG + Intergenic
1135621254 16:23957865-23957887 CTGTGTGAGGTTATTGAGCTAGG - Intronic
1136026477 16:27472074-27472096 GTGTGTGAGTGTGTGTATCAGGG + Intronic
1137720317 16:50623862-50623884 GTGTGTAGGGGTATGTATGTAGG + Intronic
1137849113 16:51720940-51720962 CTGTGTGAAGATATTTTTCTTGG - Intergenic
1138920325 16:61520308-61520330 ATGTGTGTGGGTATATATATGGG - Intergenic
1140697432 16:77548878-77548900 GTGTGTGTGGGAATGTATATGGG - Intergenic
1142086473 16:88185976-88185998 ATGTGTGAGTGTGTGTGTCTGGG - Intergenic
1142204991 16:88778671-88778693 CTGTGTGCGGGTGAGGATCTGGG - Intronic
1142289937 16:89189254-89189276 CTGTGTGTGGGCATGTGTGTGGG - Intronic
1143168083 17:4909009-4909031 CTGTGTGTATGTGTGTATCTGGG - Intergenic
1143845633 17:9771198-9771220 CAGTGTGAGTGTGTGTATGTGGG + Intergenic
1144212192 17:13025054-13025076 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146238936 17:31196844-31196866 ATGTGTGAGGGTTTCTTTCTAGG + Intronic
1146492888 17:33294568-33294590 CTGTGTGGATGTATGTATGTGGG - Intronic
1146689050 17:34860553-34860575 CTGTCTCAGGATCTGTATCTGGG - Intergenic
1147042449 17:37729191-37729213 CTGAGTGTAGTTATGTATCTGGG - Intronic
1147141990 17:38465318-38465340 CTGTGTGTGTGTGTGTCTCTGGG + Intronic
1149313547 17:55419311-55419333 CTATGTGTGTGTAGGTATCTTGG + Intronic
1149374813 17:56033286-56033308 TTCTGTGGGGGAATGTATCTTGG - Intergenic
1149458610 17:56809624-56809646 GTGTGTGAGGGTGTGTGTGTGGG - Intronic
1149458732 17:56810429-56810451 GTGTATGAGGGTATGTATGAGGG - Intronic
1149684177 17:58526052-58526074 CTGTGAGAGTGTATGTATGTGGG - Intronic
1150003444 17:61455812-61455834 CTGTGTGAGGGGCTGTGTTTGGG + Intronic
1150009339 17:61490045-61490067 CTGTGTAAGGCTATGGAGCTTGG + Intergenic
1151212839 17:72557761-72557783 GAGTGTGTGGGTGTGTATCTTGG - Intergenic
1151497148 17:74465288-74465310 TTGTGTGAGTGTATGTGTGTGGG + Intergenic
1153499369 18:5732449-5732471 ATGTGTGAGCGTATGTGTTTGGG + Intergenic
1153579605 18:6558987-6559009 ATGTGTGTGGGTATGAATGTGGG + Intronic
1155705309 18:28803109-28803131 CTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1155783366 18:29868350-29868372 GTGTGTGGGTATATGTATCTAGG + Intergenic
1156277248 18:35595054-35595076 CAGTGTGAGGGTAAGTTTTTTGG + Intronic
1156384648 18:36594188-36594210 CTGTGTGAGGGAAGGCCTCTGGG + Intronic
1156499436 18:37547849-37547871 CTGTGTGAGGGTATGTATCTGGG + Intronic
1156523666 18:37745391-37745413 GTGTGTGAGTGTGTGTATTTAGG + Intergenic
1156695153 18:39757052-39757074 TTGGGAGAGTGTATGTATCTAGG - Intergenic
1157701055 18:49761768-49761790 GTGTGTGGGGGTATGTGTGTGGG - Intergenic
1159363748 18:67438657-67438679 CTGTGTGAGGACATCTAACTTGG - Intergenic
1161076631 19:2288957-2288979 GGGTGTGAGGGTGTGTGTCTCGG + Intronic
1162587483 19:11569421-11569443 GTGTGTGTGTGTGTGTATCTTGG - Intronic
1163642187 19:18468123-18468145 CTGTGTGGGGGTTTATGTCTGGG - Intronic
1163695981 19:18763757-18763779 GCGTGTGAGGGTATGGATGTGGG - Intronic
1164962144 19:32442833-32442855 CTAGGTGAGGGTAGGAATCTAGG - Intronic
1165345432 19:35245833-35245855 ATATGTGAGGGTTTGTTTCTCGG - Intergenic
1165526271 19:36357635-36357657 GTGTGGCAGGGTATGTTTCTAGG + Intronic
925304165 2:2837214-2837236 CTGAGGGAGGGTGTGAATCTTGG - Intergenic
925304225 2:2837439-2837461 CTGAGTGAGGGTGTGAGTCTGGG - Intergenic
925304303 2:2837800-2837822 CTGAGTGAGGGTGTGAGTCTGGG - Intergenic
925304308 2:2837828-2837850 CTGAGTGAGGGTGTGAGTCTGGG - Intergenic
925518951 2:4719313-4719335 GTGTGTGAGGATATTGATCTGGG + Intergenic
925536527 2:4924103-4924125 CTATGTGAGTGTATGAATGTAGG + Intergenic
925536539 2:4924297-4924319 CTGTGTGAGTGTATGTAGGTAGG + Intergenic
925538283 2:4939500-4939522 CTGTTTTAGGGCATGTGTCTGGG - Intergenic
925802060 2:7611114-7611136 CTGTGTGTGGGCATGCATGTGGG + Intergenic
926591708 2:14747229-14747251 CTGTATGAGAGTATGTATGTGGG - Intergenic
927339019 2:21959609-21959631 GTGTGTGTGTGTATGTATTTTGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929259236 2:39845962-39845984 GTGTGTGTGTGTATGTATGTGGG + Intergenic
930401870 2:50900325-50900347 CAGTGGAAGGGTAAGTATCTGGG + Intronic
932506584 2:72238603-72238625 GTGTGTGATGGTATCTCTCTTGG + Intronic
933310559 2:80656415-80656437 ATTTGTGAGGGTTTGTTTCTGGG - Intergenic
934236064 2:90233993-90234015 CTCAAAGAGGGTATGTATCTGGG + Intergenic
934625478 2:95846562-95846584 CTGTGTGTGGGTTTATTTCTGGG - Intronic
935734529 2:106096194-106096216 GTGTGTGTGTGTATGTATGTGGG + Intronic
936546729 2:113396274-113396296 CTGTGTGTGGGTTTATTTCTGGG + Intergenic
936746493 2:115582578-115582600 CTCTGTTAGAGTAGGTATCTAGG - Intronic
937171128 2:119870052-119870074 GTGTGTTAGGGTATGTTTGTTGG + Intronic
939178151 2:138774640-138774662 CTGTGAGTGTGTATGTGTCTTGG - Intronic
939304900 2:140399158-140399180 GTGTGTGTGTGTGTGTATCTTGG - Intronic
939685482 2:145193843-145193865 CCGTGTGAGTGTATGTGTGTGGG - Intergenic
939949215 2:148448380-148448402 CTGTGTCTGAATATGTATCTAGG - Intronic
940449835 2:153823453-153823475 TTGTGTGAGGGTTTGTATCTGGG - Intergenic
940616098 2:156050502-156050524 TTGGGAGAGTGTATGTATCTAGG - Intergenic
941519799 2:166526824-166526846 ATGTGTGAGGGTTTGTTTCTGGG + Intergenic
945499873 2:210558599-210558621 CTGTGAGAAGGTAGGTATGTAGG + Intronic
946707937 2:222477431-222477453 ATGTGTGAATGTATGTATATAGG + Intronic
946707940 2:222477559-222477581 ATGTGTGAGTGTATGTATATAGG + Intronic
947102823 2:226639419-226639441 CTGTGTGACCATATGTGTCTGGG - Intergenic
948256954 2:236575412-236575434 CTGTGTGTGTGTGTGTGTCTGGG + Intronic
948256969 2:236575549-236575571 CTGTGTGTGTGTGTGTGTCTGGG + Intronic
948330812 2:237163151-237163173 GTGTGTGTGGGTATCTTTCTTGG + Intergenic
1169347900 20:4843577-4843599 ATGTGTGAGGGTTTATTTCTGGG + Intergenic
1169940140 20:10928031-10928053 CTGTGGGAGGGAATTTTTCTGGG + Intergenic
1172936991 20:38627505-38627527 CTGTGTGTTGGTATGTGTGTTGG + Intronic
1173547404 20:43909452-43909474 GTGTGTGTGTGTATGTATGTAGG + Intergenic
1173850945 20:46217417-46217439 GTGTGTGTGTGAATGTATCTGGG - Intronic
1174056405 20:47801391-47801413 GTGTGTGAGAGTGTGTATGTTGG + Intergenic
1174148893 20:48472214-48472236 TTGTTTGAGGGTCTGTAGCTGGG - Intergenic
1175804348 20:61819172-61819194 CTGTCTGAGGGGGTCTATCTGGG - Intronic
1177694010 21:24548786-24548808 CTGTGTGTGTGTGTGCATCTTGG + Intergenic
1178395470 21:32238925-32238947 CAGTGTGAGGATTTGTTTCTTGG + Intergenic
1179707936 21:43193218-43193240 CTGTGTGTGTGTGTGTCTCTGGG - Intergenic
1180171783 21:46063124-46063146 CTGTGTCAGGGTTTGTTGCTGGG - Intergenic
1180721494 22:17912146-17912168 ATATGTTAGGGTATGTTTCTGGG + Intronic
1183062325 22:35344034-35344056 GTGTGTAAGGGTGTGTATGTAGG - Intronic
1183614860 22:38937806-38937828 GTGTGTGAGTGTGTGTATGTGGG + Intergenic
1184740319 22:46424524-46424546 CTGTGTCAGTGTTTGTACCTGGG - Intronic
1185203425 22:49522593-49522615 GTGTGTGGGGGTCTGTGTCTGGG - Intronic
949407452 3:3729467-3729489 CTGTGTGTGTGTATGTGTGTGGG - Intronic
951365140 3:21771909-21771931 CTGTATGAGGGTTTATTTCTGGG - Intronic
951835826 3:26982573-26982595 TTGTTTCAGGGTATGTTTCTGGG - Intergenic
952722245 3:36545435-36545457 CTGTGTCAGGTTCTGTTTCTGGG + Intronic
952834227 3:37590387-37590409 CTGTGTGAGGGTGTGCATGAGGG + Intronic
952928386 3:38339925-38339947 CTGTGTGAGAGAATGTTTCTGGG - Intergenic
952980967 3:38735552-38735574 GTGTATGTGGGTATGTAACTTGG + Intronic
953318589 3:41951526-41951548 ATGTGTGAGGGTTTATTTCTGGG - Intronic
953576033 3:44113941-44113963 CTGTGTGTTGGTATTTCTCTGGG - Intergenic
953758482 3:45667595-45667617 CTGTGTGTGTGTATGTGTTTAGG + Intronic
954145024 3:48630261-48630283 CTGGGTGGGGGTTTGTGTCTGGG - Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
954932021 3:54291998-54292020 ATTTGTGAGGGTTTGTTTCTGGG - Intronic
955571154 3:60308197-60308219 CTTTGTGAGGTTAAGTAACTTGG - Intronic
958556524 3:95685222-95685244 GTGTGTGTGTGTGTGTATCTTGG + Intergenic
959503159 3:107130251-107130273 CTGTGTGAGGCTAGGTGTATTGG + Intergenic
959639736 3:108619268-108619290 CTGTGTGTGTGTATGTGTGTGGG + Intronic
960672103 3:120164339-120164361 CTGTCTTAGGGTCTGTATTTTGG - Intergenic
961006584 3:123409797-123409819 GTGAGTGAGGGAATGTCTCTGGG - Intronic
961440198 3:126948226-126948248 CTGTGAGAGGATAAGTTTCTGGG - Intronic
962835304 3:139184378-139184400 GTGTGTGAGGGAATATATGTGGG + Intronic
963622740 3:147632854-147632876 GTGTGTGTGTGTATGTATATAGG + Intergenic
963637218 3:147813442-147813464 GTGTGTGTGGGTGTGTGTCTGGG - Intergenic
963844635 3:150142742-150142764 CTGTTTAAGGGTATGAATATTGG + Intergenic
963965699 3:151367851-151367873 GTATTTGAGGGTATGTATATTGG + Intronic
964505379 3:157393135-157393157 AAGTGTGAGGGTATGTTTATGGG + Intronic
964907092 3:161730284-161730306 CTGTGTGAGTGTCTGTTTCTAGG + Intergenic
965002086 3:162967291-162967313 GTGTGAGTGTGTATGTATCTAGG - Intergenic
965855784 3:173086256-173086278 TTGGGTGGGTGTATGTATCTAGG + Intronic
966936415 3:184712342-184712364 ATTTGTGAGTGTGTGTATCTGGG + Intergenic
967090993 3:186134682-186134704 CTGTGTCAGTGTATGTGTATGGG + Intronic
967158519 3:186714995-186715017 CTGTGTGTGTGTATGCATATGGG - Intergenic
969061512 4:4439055-4439077 ATGTGTGTGGGTATATATGTGGG - Intronic
971637331 4:29078086-29078108 GTGTTTGTGGGTATGTATTTTGG - Intergenic
971866169 4:32175571-32175593 ATGTATGAGGGAATGTATATAGG - Intergenic
972046282 4:34668471-34668493 TTGTGTGTGAGTATGTATGTGGG + Intergenic
974715372 4:65662699-65662721 GTGTGTGAGAGTGTGTATGTGGG + Intronic
975059847 4:69984459-69984481 CTGGGGGAGGGTAGGTAGCTGGG - Intergenic
975293021 4:72699474-72699496 GTGTGTGTGTGTATGTATGTTGG - Intergenic
975498134 4:75056880-75056902 CTGTGTCGGGGTTTGAATCTCGG + Intergenic
976165423 4:82249303-82249325 GTGTGTGAGTATATTTATCTTGG - Intergenic
977039804 4:92002076-92002098 CAGTGAGAGGGAATGAATCTGGG - Intergenic
977661879 4:99597996-99598018 CTGTGTGTGTGTGTGTAACTTGG - Intronic
978100528 4:104834841-104834863 GTATGTGAGTGTATGTGTCTAGG - Intergenic
978412662 4:108442137-108442159 CTGTTTGAGCCTTTGTATCTTGG + Intergenic
978519607 4:109602518-109602540 CTGTGTGTGGATTTGTTTCTGGG + Intronic
979535420 4:121814425-121814447 TTGTGTGTGTGTATGTATGTGGG + Intronic
979616760 4:122751620-122751642 CTGTGTGTGGATTTGTTTCTGGG - Intergenic
979722664 4:123920142-123920164 TGGGGTGAGGGTATGTATCTGGG + Intergenic
979922250 4:126513222-126513244 GTGTGTGAAGATCTGTATCTTGG + Intergenic
980247212 4:130262692-130262714 ATTTGTGAGGGTTTATATCTGGG + Intergenic
981817413 4:148847006-148847028 GTGTGTGTGTGTATGTATCTTGG + Intergenic
982554986 4:156849757-156849779 CTGTGCATGGGTATGTATCCAGG + Intronic
983246770 4:165296525-165296547 CTATATAAGGGTATGGATCTGGG + Intronic
984166597 4:176309917-176309939 ATGTGTTAGGCTATGCATCTGGG + Intergenic
987243650 5:16026668-16026690 CTGTATGGGGGTCTGTGTCTGGG + Intergenic
987276966 5:16372901-16372923 CTCTGTGAGGGTATGAATTTGGG + Intergenic
988163792 5:27556387-27556409 ATGTGTATGTGTATGTATCTGGG + Intergenic
988700740 5:33672128-33672150 ATGTGTGTGTGTATGTATGTGGG - Intronic
988976942 5:36525084-36525106 CTGTGTGTGGGTATGTGTGGGGG - Intergenic
989310730 5:40014301-40014323 CTGTGTGTGTGTATGTGTGTGGG - Intergenic
993025050 5:82635770-82635792 CTGCTTGAGGGTATGTGGCTGGG - Intergenic
995168968 5:109083836-109083858 CTGTGTGCAGGTATCCATCTAGG + Intronic
995448638 5:112275564-112275586 CTGTGTGTGTGTATGTGTCGAGG - Intronic
996228430 5:121031164-121031186 CTGTGTGAGAGCATGTCTTTGGG - Intergenic
996249480 5:121311322-121311344 CTATGTGTGTGTATGTATGTGGG + Intergenic
997765831 5:136502018-136502040 CTCTGTGAGGGTGTGTGTTTGGG + Intergenic
997976968 5:138446389-138446411 CTGTGTGAGTGTGTCTTTCTGGG + Exonic
999530802 5:152461599-152461621 GTGTGTGTGTGTATGTATATAGG + Intergenic
1000292258 5:159881474-159881496 CTGTGAGGGGGTATGTCTTTGGG - Intergenic
1001953319 5:175831100-175831122 CTGTGTGTGTGTGTGTGTCTCGG + Intronic
1002058799 5:176613943-176613965 GTGAGTGTGTGTATGTATCTCGG + Intergenic
1002768809 6:269497-269519 ATGTGTGAGGGTTTGTTTCTGGG + Intergenic
1003723898 6:8737095-8737117 CAGTTTGAGGGTATGTGTCGGGG - Intergenic
1004740334 6:18454120-18454142 CTGTGTGAGGTTATGATGCTTGG - Intronic
1005573702 6:27172158-27172180 GTGTGTGTGTGTATGTATATAGG - Intergenic
1005842636 6:29753610-29753632 ATGTGTCAGGGTGTGTCTCTTGG + Intergenic
1006182956 6:32164872-32164894 CGGTGTGAAGGTATATAGCTAGG + Intronic
1006183071 6:32165590-32165612 GGGTGTGAGGGTATATAGCTAGG - Intronic
1007097253 6:39221111-39221133 TTGTCTGAGGCTATGTAGCTAGG - Intronic
1011209472 6:84939411-84939433 CTGGGAGAGTGTATGTGTCTGGG - Intergenic
1012519806 6:100107680-100107702 GTGTGTGTGTGTGTGTATCTGGG + Intergenic
1013895363 6:115081588-115081610 GTGTGTGGGTGTATGTATGTAGG + Intergenic
1014293933 6:119594708-119594730 GTATGTGAGTGTATGTATTTAGG - Intergenic
1014372334 6:120626477-120626499 CTGTTTCAGGGTTTGTAGCTGGG - Intergenic
1015688833 6:135897280-135897302 GTGTGTGTGGGTATGTGTGTAGG + Intronic
1017769022 6:157630776-157630798 CTGTGTAAGGGTATGTGTGTGGG - Intronic
1018980650 6:168599245-168599267 GTGTGTGTGGGTATGTGTGTGGG - Intronic
1021239244 7:18180216-18180238 GTGTGTGTGTGTATGTGTCTTGG - Intronic
1022853235 7:34288231-34288253 ATTTGTGAGGGTTTGTTTCTAGG - Intergenic
1023586001 7:41730274-41730296 CTGTGTGAGGATATGATACTGGG + Intergenic
1024045341 7:45581884-45581906 GAGTGTGAGTGTATGCATCTGGG - Intronic
1027026649 7:74857419-74857441 ATGTGTGAGGGTTTATATCTGGG - Intergenic
1027061106 7:75086695-75086717 ATGTGTGAGGGTTTATATCTGGG + Intergenic
1027395909 7:77753958-77753980 ATGTGTGTGGGTCTGTTTCTGGG + Intronic
1027675653 7:81154602-81154624 CTGTTTTAGGGTAAGGATCTTGG - Intergenic
1028040138 7:86041519-86041541 ATTTGTTTGGGTATGTATCTGGG - Intergenic
1030232732 7:107225032-107225054 CTGTGTGTGTGTATGTATGAGGG + Intronic
1030308588 7:108045939-108045961 ATGTGTGTGTGTGTGTATCTTGG + Intronic
1030986436 7:116246700-116246722 GTGTATGTGGGTGTGTATCTGGG - Intronic
1031506426 7:122590303-122590325 ATGTGTGAGGGTTGGTTTCTGGG - Intronic
1031768805 7:125815790-125815812 CTGTTTGAAGGTATGAATGTGGG + Intergenic
1031854299 7:126903555-126903577 GTGTGTGTGTGTATGTATTTAGG - Intronic
1032086753 7:128887998-128888020 CTGTGTGTGGGTGTGTATGTGGG - Intronic
1033082212 7:138309006-138309028 ATGTGTGTGTGTAAGTATCTGGG - Intergenic
1033117376 7:138637529-138637551 GTGTGTGTGTGTATGTATGTAGG - Intronic
1034161535 7:148997402-148997424 CTGTGTGCTGGTTTGTTTCTTGG + Intergenic
1035030880 7:155858385-155858407 CTGTGTGAGTGTAAATATGTGGG + Intergenic
1035047624 7:155979665-155979687 CTGTTTGAGGGACTGTATGTGGG + Intergenic
1035771673 8:2152541-2152563 ATGTGTGCGGGTGTGTTTCTGGG + Intronic
1035824819 8:2633139-2633161 CTGTTTTAGGGTAAGAATCTTGG - Intergenic
1036412508 8:8515398-8515420 CTGCCTGAGGGCATGCATCTTGG - Intergenic
1037284472 8:17283660-17283682 ATGTGTGAGGGTTTATTTCTGGG + Intronic
1037740565 8:21605732-21605754 GGGTGTGAGTGTATGTATGTGGG - Intergenic
1037828106 8:22171819-22171841 CTAGGTGAGGGTGTGTCTCTGGG + Intronic
1039231589 8:35454598-35454620 CTGTGGGAAGGTATATATATGGG - Intronic
1039826422 8:41177919-41177941 ATGTGTGAGGGTAAGTGTCTTGG + Intergenic
1041206431 8:55503010-55503032 CTATGTGGGGGTATATTTCTGGG + Intronic
1042143253 8:65700828-65700850 CTGTTTTAGGGTAAGGATCTTGG - Intronic
1042523520 8:69740513-69740535 CTGTGTGTGTGTTTGTATGTGGG + Intronic
1042840784 8:73121350-73121372 GTGTGTGAGGGCATGAATGTGGG + Intronic
1043073624 8:75668137-75668159 GTGTGTGTGTGTATGTATATAGG + Intergenic
1043570258 8:81594999-81595021 CTGTTTTAGGGTAAGGATCTTGG - Intergenic
1044009057 8:86968943-86968965 CTGTTTGAGGGTAGAGATCTTGG + Intronic
1044181153 8:89196813-89196835 GTGTGTGAGGGTAAATAACTAGG - Intergenic
1044382136 8:91546677-91546699 CTTTGTGATATTATGTATCTTGG + Intergenic
1046273692 8:111928821-111928843 CTGTGTAAGTGTATTTATCCTGG - Intergenic
1047117404 8:121859266-121859288 GTGTGTGATTGTATGTGTCTCGG - Intergenic
1047464819 8:125102532-125102554 CTGTGTGGTGGTATTTATCTGGG + Intronic
1048321652 8:133404947-133404969 GTGTGTGGGGGTATTTATGTGGG - Intergenic
1048452391 8:134544939-134544961 CTCTGTGGGTGTATGTATCTTGG + Intronic
1048691262 8:136966862-136966884 GTGTGTGTGGGTGTGCATCTGGG - Intergenic
1049335461 8:142082227-142082249 GTGTGGGGGGGTGTGTATCTGGG - Intergenic
1049409904 8:142468274-142468296 CGGTGTGAATGTATGTATCCAGG + Intronic
1052445973 9:28561845-28561867 CTGTGTAAAGGTATGTCTGTAGG - Intronic
1053547729 9:39041489-39041511 CTGTGTGTGTGTATGTGTGTAGG - Intergenic
1056695269 9:88844578-88844600 GTGTGTGAGGATCTGTTTCTTGG + Intergenic
1056753931 9:89370957-89370979 CTGGGGTAGGGTGTGTATCTGGG + Intronic
1056778969 9:89535105-89535127 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778971 9:89535129-89535151 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778980 9:89535249-89535271 CTGTGTGTGTGTATGTGTATAGG + Intergenic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1057251392 9:93506000-93506022 CCGTGTGTGGGTCTGTTTCTGGG + Intronic
1061887561 9:133600199-133600221 CTGTGTGAGTGTGTGTGTGTGGG + Intergenic
1185728759 X:2444492-2444514 GTGTCTGAGGGTATGTGTTTGGG + Intronic
1188676712 X:32950509-32950531 TTGTGTGATGGTATATTTCTTGG + Intronic
1189054394 X:37684577-37684599 TTGTGGCAGTGTATGTATCTTGG + Intronic
1189631256 X:42956099-42956121 ATGTGTGTGTGTATGTGTCTTGG + Intergenic
1190756096 X:53403440-53403462 CTATGTGAGTTTATGTAGCTAGG - Intronic
1190955486 X:55188825-55188847 CTGTCTTAGGGTATGTCTGTGGG + Intronic
1198110808 X:133501327-133501349 GTGTGTGTGGGTATATATGTAGG + Intergenic
1198778943 X:140213903-140213925 GTGTGTGTGTGTATGTATCCAGG - Intergenic
1199325235 X:146491030-146491052 GTGTGTGTGTGTGTGTATCTGGG - Intergenic
1199548501 X:149032843-149032865 CTGTGTGTGTGTATATGTCTAGG + Intergenic
1200580482 Y:4943946-4943968 TTATGTGAGGGTTTGTTTCTGGG - Intergenic