ID: 1156501350

View in Genome Browser
Species Human (GRCh38)
Location 18:37561185-37561207
Sequence CTACTTTACCGGCAGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156501350_1156501358 27 Left 1156501350 18:37561185-37561207 CCCCCAGGCTGCCGGTAAAGTAG No data
Right 1156501358 18:37561235-37561257 TCAAAGCAGAGTGGTTACCCAGG No data
1156501350_1156501357 18 Left 1156501350 18:37561185-37561207 CCCCCAGGCTGCCGGTAAAGTAG No data
Right 1156501357 18:37561226-37561248 GAGAAAATCTCAAAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156501350 Original CRISPR CTACTTTACCGGCAGCCTGG GGG (reversed) Intronic