ID: 1156501350 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:37561185-37561207 |
Sequence | CTACTTTACCGGCAGCCTGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1156501350_1156501358 | 27 | Left | 1156501350 | 18:37561185-37561207 | CCCCCAGGCTGCCGGTAAAGTAG | No data | ||
Right | 1156501358 | 18:37561235-37561257 | TCAAAGCAGAGTGGTTACCCAGG | No data | ||||
1156501350_1156501357 | 18 | Left | 1156501350 | 18:37561185-37561207 | CCCCCAGGCTGCCGGTAAAGTAG | No data | ||
Right | 1156501357 | 18:37561226-37561248 | GAGAAAATCTCAAAGCAGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1156501350 | Original CRISPR | CTACTTTACCGGCAGCCTGG GGG (reversed) | Intronic | ||