ID: 1156502402

View in Genome Browser
Species Human (GRCh38)
Location 18:37567759-37567781
Sequence TGGGGTTGGCCTGGGTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156502402_1156502411 14 Left 1156502402 18:37567759-37567781 CCTGCAAACCCAGGCCAACCCCA No data
Right 1156502411 18:37567796-37567818 AATACGGAGCTCTCCAGCGCCGG No data
1156502402_1156502414 25 Left 1156502402 18:37567759-37567781 CCTGCAAACCCAGGCCAACCCCA No data
Right 1156502414 18:37567807-37567829 CTCCAGCGCCGGAGGAGGCCCGG No data
1156502402_1156502412 17 Left 1156502402 18:37567759-37567781 CCTGCAAACCCAGGCCAACCCCA No data
Right 1156502412 18:37567799-37567821 ACGGAGCTCTCCAGCGCCGGAGG No data
1156502402_1156502416 28 Left 1156502402 18:37567759-37567781 CCTGCAAACCCAGGCCAACCCCA No data
Right 1156502416 18:37567810-37567832 CAGCGCCGGAGGAGGCCCGGAGG No data
1156502402_1156502413 20 Left 1156502402 18:37567759-37567781 CCTGCAAACCCAGGCCAACCCCA No data
Right 1156502413 18:37567802-37567824 GAGCTCTCCAGCGCCGGAGGAGG No data
1156502402_1156502410 -2 Left 1156502402 18:37567759-37567781 CCTGCAAACCCAGGCCAACCCCA No data
Right 1156502410 18:37567780-37567802 CATTTGGTACAAGCACAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156502402 Original CRISPR TGGGGTTGGCCTGGGTTTGC AGG (reversed) Intergenic
No off target data available for this crispr