ID: 1156502409

View in Genome Browser
Species Human (GRCh38)
Location 18:37567779-37567801
Sequence CGTATTGTGCTTGTACCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156502409_1156502418 15 Left 1156502409 18:37567779-37567801 CCATTTGGTACAAGCACAATACG No data
Right 1156502418 18:37567817-37567839 GGAGGAGGCCCGGAGGCCCGAGG No data
1156502409_1156502421 29 Left 1156502409 18:37567779-37567801 CCATTTGGTACAAGCACAATACG No data
Right 1156502421 18:37567831-37567853 GGCCCGAGGTTCGCAGCCCCAGG No data
1156502409_1156502413 0 Left 1156502409 18:37567779-37567801 CCATTTGGTACAAGCACAATACG No data
Right 1156502413 18:37567802-37567824 GAGCTCTCCAGCGCCGGAGGAGG No data
1156502409_1156502416 8 Left 1156502409 18:37567779-37567801 CCATTTGGTACAAGCACAATACG No data
Right 1156502416 18:37567810-37567832 CAGCGCCGGAGGAGGCCCGGAGG No data
1156502409_1156502411 -6 Left 1156502409 18:37567779-37567801 CCATTTGGTACAAGCACAATACG No data
Right 1156502411 18:37567796-37567818 AATACGGAGCTCTCCAGCGCCGG No data
1156502409_1156502412 -3 Left 1156502409 18:37567779-37567801 CCATTTGGTACAAGCACAATACG No data
Right 1156502412 18:37567799-37567821 ACGGAGCTCTCCAGCGCCGGAGG No data
1156502409_1156502414 5 Left 1156502409 18:37567779-37567801 CCATTTGGTACAAGCACAATACG No data
Right 1156502414 18:37567807-37567829 CTCCAGCGCCGGAGGAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156502409 Original CRISPR CGTATTGTGCTTGTACCAAA TGG (reversed) Intergenic
No off target data available for this crispr