ID: 1156502414

View in Genome Browser
Species Human (GRCh38)
Location 18:37567807-37567829
Sequence CTCCAGCGCCGGAGGAGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156502409_1156502414 5 Left 1156502409 18:37567779-37567801 CCATTTGGTACAAGCACAATACG No data
Right 1156502414 18:37567807-37567829 CTCCAGCGCCGGAGGAGGCCCGG No data
1156502405_1156502414 16 Left 1156502405 18:37567768-37567790 CCAGGCCAACCCCATTTGGTACA No data
Right 1156502414 18:37567807-37567829 CTCCAGCGCCGGAGGAGGCCCGG No data
1156502404_1156502414 17 Left 1156502404 18:37567767-37567789 CCCAGGCCAACCCCATTTGGTAC No data
Right 1156502414 18:37567807-37567829 CTCCAGCGCCGGAGGAGGCCCGG No data
1156502402_1156502414 25 Left 1156502402 18:37567759-37567781 CCTGCAAACCCAGGCCAACCCCA No data
Right 1156502414 18:37567807-37567829 CTCCAGCGCCGGAGGAGGCCCGG No data
1156502408_1156502414 6 Left 1156502408 18:37567778-37567800 CCCATTTGGTACAAGCACAATAC No data
Right 1156502414 18:37567807-37567829 CTCCAGCGCCGGAGGAGGCCCGG No data
1156502407_1156502414 7 Left 1156502407 18:37567777-37567799 CCCCATTTGGTACAAGCACAATA No data
Right 1156502414 18:37567807-37567829 CTCCAGCGCCGGAGGAGGCCCGG No data
1156502406_1156502414 11 Left 1156502406 18:37567773-37567795 CCAACCCCATTTGGTACAAGCAC No data
Right 1156502414 18:37567807-37567829 CTCCAGCGCCGGAGGAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156502414 Original CRISPR CTCCAGCGCCGGAGGAGGCC CGG Intergenic
No off target data available for this crispr