ID: 1156502421

View in Genome Browser
Species Human (GRCh38)
Location 18:37567831-37567853
Sequence GGCCCGAGGTTCGCAGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156502417_1156502421 -7 Left 1156502417 18:37567815-37567837 CCGGAGGAGGCCCGGAGGCCCGA No data
Right 1156502421 18:37567831-37567853 GGCCCGAGGTTCGCAGCCCCAGG No data
1156502408_1156502421 30 Left 1156502408 18:37567778-37567800 CCCATTTGGTACAAGCACAATAC No data
Right 1156502421 18:37567831-37567853 GGCCCGAGGTTCGCAGCCCCAGG No data
1156502409_1156502421 29 Left 1156502409 18:37567779-37567801 CCATTTGGTACAAGCACAATACG No data
Right 1156502421 18:37567831-37567853 GGCCCGAGGTTCGCAGCCCCAGG No data
1156502415_1156502421 -1 Left 1156502415 18:37567809-37567831 CCAGCGCCGGAGGAGGCCCGGAG No data
Right 1156502421 18:37567831-37567853 GGCCCGAGGTTCGCAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156502421 Original CRISPR GGCCCGAGGTTCGCAGCCCC AGG Intergenic
No off target data available for this crispr