ID: 1156504160

View in Genome Browser
Species Human (GRCh38)
Location 18:37578292-37578314
Sequence GAGAGTGGGTCTAGGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156504160_1156504164 -7 Left 1156504160 18:37578292-37578314 CCTTTCTGCCTAGACCCACTCTC No data
Right 1156504164 18:37578308-37578330 CACTCTCCTTTTACTCCTCTAGG No data
1156504160_1156504171 29 Left 1156504160 18:37578292-37578314 CCTTTCTGCCTAGACCCACTCTC No data
Right 1156504171 18:37578344-37578366 TGGTCCAGAGCCACCCAAACAGG No data
1156504160_1156504167 6 Left 1156504160 18:37578292-37578314 CCTTTCTGCCTAGACCCACTCTC No data
Right 1156504167 18:37578321-37578343 CTCCTCTAGGTAGTGGCCACAGG No data
1156504160_1156504166 -1 Left 1156504160 18:37578292-37578314 CCTTTCTGCCTAGACCCACTCTC No data
Right 1156504166 18:37578314-37578336 CCTTTTACTCCTCTAGGTAGTGG No data
1156504160_1156504169 9 Left 1156504160 18:37578292-37578314 CCTTTCTGCCTAGACCCACTCTC No data
Right 1156504169 18:37578324-37578346 CTCTAGGTAGTGGCCACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156504160 Original CRISPR GAGAGTGGGTCTAGGCAGAA AGG (reversed) Intergenic
No off target data available for this crispr