ID: 1156504161

View in Genome Browser
Species Human (GRCh38)
Location 18:37578300-37578322
Sequence AGTAAAAGGAGAGTGGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156504161_1156504167 -2 Left 1156504161 18:37578300-37578322 CCTAGACCCACTCTCCTTTTACT No data
Right 1156504167 18:37578321-37578343 CTCCTCTAGGTAGTGGCCACAGG No data
1156504161_1156504171 21 Left 1156504161 18:37578300-37578322 CCTAGACCCACTCTCCTTTTACT No data
Right 1156504171 18:37578344-37578366 TGGTCCAGAGCCACCCAAACAGG No data
1156504161_1156504172 24 Left 1156504161 18:37578300-37578322 CCTAGACCCACTCTCCTTTTACT No data
Right 1156504172 18:37578347-37578369 TCCAGAGCCACCCAAACAGGAGG No data
1156504161_1156504169 1 Left 1156504161 18:37578300-37578322 CCTAGACCCACTCTCCTTTTACT No data
Right 1156504169 18:37578324-37578346 CTCTAGGTAGTGGCCACAGGTGG No data
1156504161_1156504166 -9 Left 1156504161 18:37578300-37578322 CCTAGACCCACTCTCCTTTTACT No data
Right 1156504166 18:37578314-37578336 CCTTTTACTCCTCTAGGTAGTGG No data
1156504161_1156504174 27 Left 1156504161 18:37578300-37578322 CCTAGACCCACTCTCCTTTTACT No data
Right 1156504174 18:37578350-37578372 AGAGCCACCCAAACAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156504161 Original CRISPR AGTAAAAGGAGAGTGGGTCT AGG (reversed) Intergenic
No off target data available for this crispr