ID: 1156504162

View in Genome Browser
Species Human (GRCh38)
Location 18:37578306-37578328
Sequence TAGAGGAGTAAAAGGAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156504162_1156504167 -8 Left 1156504162 18:37578306-37578328 CCCACTCTCCTTTTACTCCTCTA No data
Right 1156504167 18:37578321-37578343 CTCCTCTAGGTAGTGGCCACAGG No data
1156504162_1156504171 15 Left 1156504162 18:37578306-37578328 CCCACTCTCCTTTTACTCCTCTA No data
Right 1156504171 18:37578344-37578366 TGGTCCAGAGCCACCCAAACAGG No data
1156504162_1156504174 21 Left 1156504162 18:37578306-37578328 CCCACTCTCCTTTTACTCCTCTA No data
Right 1156504174 18:37578350-37578372 AGAGCCACCCAAACAGGAGGTGG No data
1156504162_1156504172 18 Left 1156504162 18:37578306-37578328 CCCACTCTCCTTTTACTCCTCTA No data
Right 1156504172 18:37578347-37578369 TCCAGAGCCACCCAAACAGGAGG No data
1156504162_1156504169 -5 Left 1156504162 18:37578306-37578328 CCCACTCTCCTTTTACTCCTCTA No data
Right 1156504169 18:37578324-37578346 CTCTAGGTAGTGGCCACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156504162 Original CRISPR TAGAGGAGTAAAAGGAGAGT GGG (reversed) Intergenic
No off target data available for this crispr