ID: 1156504165

View in Genome Browser
Species Human (GRCh38)
Location 18:37578314-37578336
Sequence CCACTACCTAGAGGAGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156504165_1156504174 13 Left 1156504165 18:37578314-37578336 CCTTTTACTCCTCTAGGTAGTGG No data
Right 1156504174 18:37578350-37578372 AGAGCCACCCAAACAGGAGGTGG No data
1156504165_1156504172 10 Left 1156504165 18:37578314-37578336 CCTTTTACTCCTCTAGGTAGTGG No data
Right 1156504172 18:37578347-37578369 TCCAGAGCCACCCAAACAGGAGG No data
1156504165_1156504171 7 Left 1156504165 18:37578314-37578336 CCTTTTACTCCTCTAGGTAGTGG No data
Right 1156504171 18:37578344-37578366 TGGTCCAGAGCCACCCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156504165 Original CRISPR CCACTACCTAGAGGAGTAAA AGG (reversed) Intergenic