ID: 1156504171

View in Genome Browser
Species Human (GRCh38)
Location 18:37578344-37578366
Sequence TGGTCCAGAGCCACCCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156504161_1156504171 21 Left 1156504161 18:37578300-37578322 CCTAGACCCACTCTCCTTTTACT No data
Right 1156504171 18:37578344-37578366 TGGTCCAGAGCCACCCAAACAGG No data
1156504168_1156504171 -2 Left 1156504168 18:37578323-37578345 CCTCTAGGTAGTGGCCACAGGTG No data
Right 1156504171 18:37578344-37578366 TGGTCCAGAGCCACCCAAACAGG No data
1156504163_1156504171 14 Left 1156504163 18:37578307-37578329 CCACTCTCCTTTTACTCCTCTAG No data
Right 1156504171 18:37578344-37578366 TGGTCCAGAGCCACCCAAACAGG No data
1156504160_1156504171 29 Left 1156504160 18:37578292-37578314 CCTTTCTGCCTAGACCCACTCTC No data
Right 1156504171 18:37578344-37578366 TGGTCCAGAGCCACCCAAACAGG No data
1156504165_1156504171 7 Left 1156504165 18:37578314-37578336 CCTTTTACTCCTCTAGGTAGTGG No data
Right 1156504171 18:37578344-37578366 TGGTCCAGAGCCACCCAAACAGG No data
1156504162_1156504171 15 Left 1156504162 18:37578306-37578328 CCCACTCTCCTTTTACTCCTCTA No data
Right 1156504171 18:37578344-37578366 TGGTCCAGAGCCACCCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156504171 Original CRISPR TGGTCCAGAGCCACCCAAAC AGG Intergenic
No off target data available for this crispr