ID: 1156504172

View in Genome Browser
Species Human (GRCh38)
Location 18:37578347-37578369
Sequence TCCAGAGCCACCCAAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156504162_1156504172 18 Left 1156504162 18:37578306-37578328 CCCACTCTCCTTTTACTCCTCTA No data
Right 1156504172 18:37578347-37578369 TCCAGAGCCACCCAAACAGGAGG No data
1156504165_1156504172 10 Left 1156504165 18:37578314-37578336 CCTTTTACTCCTCTAGGTAGTGG No data
Right 1156504172 18:37578347-37578369 TCCAGAGCCACCCAAACAGGAGG No data
1156504161_1156504172 24 Left 1156504161 18:37578300-37578322 CCTAGACCCACTCTCCTTTTACT No data
Right 1156504172 18:37578347-37578369 TCCAGAGCCACCCAAACAGGAGG No data
1156504168_1156504172 1 Left 1156504168 18:37578323-37578345 CCTCTAGGTAGTGGCCACAGGTG No data
Right 1156504172 18:37578347-37578369 TCCAGAGCCACCCAAACAGGAGG No data
1156504163_1156504172 17 Left 1156504163 18:37578307-37578329 CCACTCTCCTTTTACTCCTCTAG No data
Right 1156504172 18:37578347-37578369 TCCAGAGCCACCCAAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156504172 Original CRISPR TCCAGAGCCACCCAAACAGG AGG Intergenic
No off target data available for this crispr