ID: 1156506738

View in Genome Browser
Species Human (GRCh38)
Location 18:37600651-37600673
Sequence CTACTAGGCAAATTAGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156506738_1156506746 19 Left 1156506738 18:37600651-37600673 CCAATCCCTAATTTGCCTAGTAG No data
Right 1156506746 18:37600693-37600715 GCTCCTCCCTCTCCAAGTGGAGG No data
1156506738_1156506745 16 Left 1156506738 18:37600651-37600673 CCAATCCCTAATTTGCCTAGTAG No data
Right 1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG No data
1156506738_1156506747 20 Left 1156506738 18:37600651-37600673 CCAATCCCTAATTTGCCTAGTAG No data
Right 1156506747 18:37600694-37600716 CTCCTCCCTCTCCAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156506738 Original CRISPR CTACTAGGCAAATTAGGGAT TGG (reversed) Intergenic
No off target data available for this crispr