ID: 1156506739

View in Genome Browser
Species Human (GRCh38)
Location 18:37600656-37600678
Sequence AAGAACTACTAGGCAAATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156506739_1156506746 14 Left 1156506739 18:37600656-37600678 CCCTAATTTGCCTAGTAGTTCTT No data
Right 1156506746 18:37600693-37600715 GCTCCTCCCTCTCCAAGTGGAGG No data
1156506739_1156506745 11 Left 1156506739 18:37600656-37600678 CCCTAATTTGCCTAGTAGTTCTT No data
Right 1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG No data
1156506739_1156506747 15 Left 1156506739 18:37600656-37600678 CCCTAATTTGCCTAGTAGTTCTT No data
Right 1156506747 18:37600694-37600716 CTCCTCCCTCTCCAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156506739 Original CRISPR AAGAACTACTAGGCAAATTA GGG (reversed) Intergenic
No off target data available for this crispr