ID: 1156506745

View in Genome Browser
Species Human (GRCh38)
Location 18:37600690-37600712
Sequence CATGCTCCTCCCTCTCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156506739_1156506745 11 Left 1156506739 18:37600656-37600678 CCCTAATTTGCCTAGTAGTTCTT No data
Right 1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG No data
1156506744_1156506745 1 Left 1156506744 18:37600666-37600688 CCTAGTAGTTCTTTGGGGAGAAC No data
Right 1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG No data
1156506740_1156506745 10 Left 1156506740 18:37600657-37600679 CCTAATTTGCCTAGTAGTTCTTT No data
Right 1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG No data
1156506738_1156506745 16 Left 1156506738 18:37600651-37600673 CCAATCCCTAATTTGCCTAGTAG No data
Right 1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156506745 Original CRISPR CATGCTCCTCCCTCTCCAAG TGG Intergenic
No off target data available for this crispr