ID: 1156508204

View in Genome Browser
Species Human (GRCh38)
Location 18:37612553-37612575
Sequence CCTTTTAGTTACCCAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156508204_1156508211 7 Left 1156508204 18:37612553-37612575 CCTGACTTTGGGTAACTAAAAGG No data
Right 1156508211 18:37612583-37612605 GTGTGCAGTGTGGTAAATTGGGG No data
1156508204_1156508209 5 Left 1156508204 18:37612553-37612575 CCTGACTTTGGGTAACTAAAAGG No data
Right 1156508209 18:37612581-37612603 GTGTGTGCAGTGTGGTAAATTGG No data
1156508204_1156508210 6 Left 1156508204 18:37612553-37612575 CCTGACTTTGGGTAACTAAAAGG No data
Right 1156508210 18:37612582-37612604 TGTGTGCAGTGTGGTAAATTGGG No data
1156508204_1156508212 8 Left 1156508204 18:37612553-37612575 CCTGACTTTGGGTAACTAAAAGG No data
Right 1156508212 18:37612584-37612606 TGTGCAGTGTGGTAAATTGGGGG No data
1156508204_1156508208 -3 Left 1156508204 18:37612553-37612575 CCTGACTTTGGGTAACTAAAAGG No data
Right 1156508208 18:37612573-37612595 AGGAAAGGGTGTGTGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156508204 Original CRISPR CCTTTTAGTTACCCAAAGTC AGG (reversed) Intergenic
No off target data available for this crispr