ID: 1156508220

View in Genome Browser
Species Human (GRCh38)
Location 18:37612640-37612662
Sequence CAGGGAGAGCAGAGACTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156508214_1156508220 1 Left 1156508214 18:37612616-37612638 CCCTGAGTATAGCAGAGGTCCTG No data
Right 1156508220 18:37612640-37612662 CAGGGAGAGCAGAGACTTGCTGG No data
1156508215_1156508220 0 Left 1156508215 18:37612617-37612639 CCTGAGTATAGCAGAGGTCCTGG No data
Right 1156508220 18:37612640-37612662 CAGGGAGAGCAGAGACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156508220 Original CRISPR CAGGGAGAGCAGAGACTTGC TGG Intergenic
No off target data available for this crispr