ID: 1156509946

View in Genome Browser
Species Human (GRCh38)
Location 18:37627905-37627927
Sequence CACAGAGTGGGGAGTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156509936_1156509946 27 Left 1156509936 18:37627855-37627877 CCTAAGCTCTTTCTCTTCTACCA No data
Right 1156509946 18:37627905-37627927 CACAGAGTGGGGAGTAGAGTGGG No data
1156509940_1156509946 7 Left 1156509940 18:37627875-37627897 CCATAGGGATGCTGAGCAGGTGA No data
Right 1156509946 18:37627905-37627927 CACAGAGTGGGGAGTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156509946 Original CRISPR CACAGAGTGGGGAGTAGAGT GGG Intergenic
No off target data available for this crispr