ID: 1156512996

View in Genome Browser
Species Human (GRCh38)
Location 18:37657004-37657026
Sequence CTGTGTGTATCAAAGAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156512996_1156512997 -1 Left 1156512996 18:37657004-37657026 CCAACTTTCTTTGATACACACAG No data
Right 1156512997 18:37657026-37657048 GTGCCTTCTCTATTCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156512996 Original CRISPR CTGTGTGTATCAAAGAAAGT TGG (reversed) Intergenic
No off target data available for this crispr