ID: 1156515219

View in Genome Browser
Species Human (GRCh38)
Location 18:37673622-37673644
Sequence ATCTCCTGGTGGAGCTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156515213_1156515219 -10 Left 1156515213 18:37673609-37673631 CCAACCAAAGACTATCTCCTGGT No data
Right 1156515219 18:37673622-37673644 ATCTCCTGGTGGAGCTGTGGGGG No data
1156515211_1156515219 7 Left 1156515211 18:37673592-37673614 CCTCAGGAAAGAAACTACCAACC No data
Right 1156515219 18:37673622-37673644 ATCTCCTGGTGGAGCTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156515219 Original CRISPR ATCTCCTGGTGGAGCTGTGG GGG Intergenic
No off target data available for this crispr