ID: 1156516842

View in Genome Browser
Species Human (GRCh38)
Location 18:37687421-37687443
Sequence CCTGCTCTCCAGAAGCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156516842_1156516855 28 Left 1156516842 18:37687421-37687443 CCCTACAGCTTCTGGAGAGCAGG No data
Right 1156516855 18:37687472-37687494 GCCTTGTGCAGTACTGGGGCAGG No data
1156516842_1156516854 24 Left 1156516842 18:37687421-37687443 CCCTACAGCTTCTGGAGAGCAGG No data
Right 1156516854 18:37687468-37687490 CTGTGCCTTGTGCAGTACTGGGG No data
1156516842_1156516853 23 Left 1156516842 18:37687421-37687443 CCCTACAGCTTCTGGAGAGCAGG No data
Right 1156516853 18:37687467-37687489 CCTGTGCCTTGTGCAGTACTGGG No data
1156516842_1156516851 22 Left 1156516842 18:37687421-37687443 CCCTACAGCTTCTGGAGAGCAGG No data
Right 1156516851 18:37687466-37687488 CCCTGTGCCTTGTGCAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156516842 Original CRISPR CCTGCTCTCCAGAAGCTGTA GGG (reversed) Intergenic
No off target data available for this crispr