ID: 1156516847

View in Genome Browser
Species Human (GRCh38)
Location 18:37687451-37687473
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156516847_1156516855 -2 Left 1156516847 18:37687451-37687473 CCTAATCTCCAGATCCCCTGTGC No data
Right 1156516855 18:37687472-37687494 GCCTTGTGCAGTACTGGGGCAGG No data
1156516847_1156516851 -8 Left 1156516847 18:37687451-37687473 CCTAATCTCCAGATCCCCTGTGC No data
Right 1156516851 18:37687466-37687488 CCCTGTGCCTTGTGCAGTACTGG No data
1156516847_1156516854 -6 Left 1156516847 18:37687451-37687473 CCTAATCTCCAGATCCCCTGTGC No data
Right 1156516854 18:37687468-37687490 CTGTGCCTTGTGCAGTACTGGGG No data
1156516847_1156516853 -7 Left 1156516847 18:37687451-37687473 CCTAATCTCCAGATCCCCTGTGC No data
Right 1156516853 18:37687467-37687489 CCTGTGCCTTGTGCAGTACTGGG No data
1156516847_1156516859 27 Left 1156516847 18:37687451-37687473 CCTAATCTCCAGATCCCCTGTGC No data
Right 1156516859 18:37687501-37687523 TGATATTTGTGATGTGAATTGGG No data
1156516847_1156516858 26 Left 1156516847 18:37687451-37687473 CCTAATCTCCAGATCCCCTGTGC No data
Right 1156516858 18:37687500-37687522 TTGATATTTGTGATGTGAATTGG No data
1156516847_1156516857 1 Left 1156516847 18:37687451-37687473 CCTAATCTCCAGATCCCCTGTGC No data
Right 1156516857 18:37687475-37687497 TTGTGCAGTACTGGGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156516847 Original CRISPR GCACAGGGGATCTGGAGATT AGG (reversed) Intergenic
No off target data available for this crispr