ID: 1156516853

View in Genome Browser
Species Human (GRCh38)
Location 18:37687467-37687489
Sequence CCTGTGCCTTGTGCAGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156516846_1156516853 -6 Left 1156516846 18:37687450-37687472 CCCTAATCTCCAGATCCCCTGTG No data
Right 1156516853 18:37687467-37687489 CCTGTGCCTTGTGCAGTACTGGG No data
1156516842_1156516853 23 Left 1156516842 18:37687421-37687443 CCCTACAGCTTCTGGAGAGCAGG No data
Right 1156516853 18:37687467-37687489 CCTGTGCCTTGTGCAGTACTGGG No data
1156516844_1156516853 22 Left 1156516844 18:37687422-37687444 CCTACAGCTTCTGGAGAGCAGGG No data
Right 1156516853 18:37687467-37687489 CCTGTGCCTTGTGCAGTACTGGG No data
1156516847_1156516853 -7 Left 1156516847 18:37687451-37687473 CCTAATCTCCAGATCCCCTGTGC No data
Right 1156516853 18:37687467-37687489 CCTGTGCCTTGTGCAGTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156516853 Original CRISPR CCTGTGCCTTGTGCAGTACT GGG Intergenic
No off target data available for this crispr