ID: 1156516855

View in Genome Browser
Species Human (GRCh38)
Location 18:37687472-37687494
Sequence GCCTTGTGCAGTACTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156516846_1156516855 -1 Left 1156516846 18:37687450-37687472 CCCTAATCTCCAGATCCCCTGTG No data
Right 1156516855 18:37687472-37687494 GCCTTGTGCAGTACTGGGGCAGG No data
1156516842_1156516855 28 Left 1156516842 18:37687421-37687443 CCCTACAGCTTCTGGAGAGCAGG No data
Right 1156516855 18:37687472-37687494 GCCTTGTGCAGTACTGGGGCAGG No data
1156516847_1156516855 -2 Left 1156516847 18:37687451-37687473 CCTAATCTCCAGATCCCCTGTGC No data
Right 1156516855 18:37687472-37687494 GCCTTGTGCAGTACTGGGGCAGG No data
1156516844_1156516855 27 Left 1156516844 18:37687422-37687444 CCTACAGCTTCTGGAGAGCAGGG No data
Right 1156516855 18:37687472-37687494 GCCTTGTGCAGTACTGGGGCAGG No data
1156516848_1156516855 -10 Left 1156516848 18:37687459-37687481 CCAGATCCCCTGTGCCTTGTGCA No data
Right 1156516855 18:37687472-37687494 GCCTTGTGCAGTACTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156516855 Original CRISPR GCCTTGTGCAGTACTGGGGC AGG Intergenic
No off target data available for this crispr