ID: 1156516858

View in Genome Browser
Species Human (GRCh38)
Location 18:37687500-37687522
Sequence TTGATATTTGTGATGTGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156516849_1156516858 12 Left 1156516849 18:37687465-37687487 CCCCTGTGCCTTGTGCAGTACTG No data
Right 1156516858 18:37687500-37687522 TTGATATTTGTGATGTGAATTGG No data
1156516846_1156516858 27 Left 1156516846 18:37687450-37687472 CCCTAATCTCCAGATCCCCTGTG No data
Right 1156516858 18:37687500-37687522 TTGATATTTGTGATGTGAATTGG No data
1156516848_1156516858 18 Left 1156516848 18:37687459-37687481 CCAGATCCCCTGTGCCTTGTGCA No data
Right 1156516858 18:37687500-37687522 TTGATATTTGTGATGTGAATTGG No data
1156516852_1156516858 10 Left 1156516852 18:37687467-37687489 CCTGTGCCTTGTGCAGTACTGGG No data
Right 1156516858 18:37687500-37687522 TTGATATTTGTGATGTGAATTGG No data
1156516847_1156516858 26 Left 1156516847 18:37687451-37687473 CCTAATCTCCAGATCCCCTGTGC No data
Right 1156516858 18:37687500-37687522 TTGATATTTGTGATGTGAATTGG No data
1156516850_1156516858 11 Left 1156516850 18:37687466-37687488 CCCTGTGCCTTGTGCAGTACTGG No data
Right 1156516858 18:37687500-37687522 TTGATATTTGTGATGTGAATTGG No data
1156516856_1156516858 4 Left 1156516856 18:37687473-37687495 CCTTGTGCAGTACTGGGGCAGGA No data
Right 1156516858 18:37687500-37687522 TTGATATTTGTGATGTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156516858 Original CRISPR TTGATATTTGTGATGTGAAT TGG Intergenic
No off target data available for this crispr