ID: 1156517183

View in Genome Browser
Species Human (GRCh38)
Location 18:37690311-37690333
Sequence TTCAGGGGCAGTAACACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1251
Summary {0: 23, 1: 114, 2: 233, 3: 362, 4: 519}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156517183_1156517196 15 Left 1156517183 18:37690311-37690333 CCATGTGTGTTACTGCCCCTGAA 0: 23
1: 114
2: 233
3: 362
4: 519
Right 1156517196 18:37690349-37690371 CAAGATGTGGAGGGGGAAGACGG No data
1156517183_1156517195 8 Left 1156517183 18:37690311-37690333 CCATGTGTGTTACTGCCCCTGAA 0: 23
1: 114
2: 233
3: 362
4: 519
Right 1156517195 18:37690342-37690364 AGTAGGACAAGATGTGGAGGGGG 0: 12
1: 230
2: 429
3: 429
4: 727
1156517183_1156517193 6 Left 1156517183 18:37690311-37690333 CCATGTGTGTTACTGCCCCTGAA 0: 23
1: 114
2: 233
3: 362
4: 519
Right 1156517193 18:37690340-37690362 CCAGTAGGACAAGATGTGGAGGG No data
1156517183_1156517189 2 Left 1156517183 18:37690311-37690333 CCATGTGTGTTACTGCCCCTGAA 0: 23
1: 114
2: 233
3: 362
4: 519
Right 1156517189 18:37690336-37690358 CCTCCCAGTAGGACAAGATGTGG No data
1156517183_1156517191 5 Left 1156517183 18:37690311-37690333 CCATGTGTGTTACTGCCCCTGAA 0: 23
1: 114
2: 233
3: 362
4: 519
Right 1156517191 18:37690339-37690361 CCCAGTAGGACAAGATGTGGAGG No data
1156517183_1156517184 -9 Left 1156517183 18:37690311-37690333 CCATGTGTGTTACTGCCCCTGAA 0: 23
1: 114
2: 233
3: 362
4: 519
Right 1156517184 18:37690325-37690347 GCCCCTGAAGACCTCCCAGTAGG 0: 13
1: 224
2: 418
3: 491
4: 518
1156517183_1156517194 7 Left 1156517183 18:37690311-37690333 CCATGTGTGTTACTGCCCCTGAA 0: 23
1: 114
2: 233
3: 362
4: 519
Right 1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156517183 Original CRISPR TTCAGGGGCAGTAACACACA TGG (reversed) Intergenic
900103245 1:971667-971689 CTCACGGGCAGGCACACACAAGG - Intronic
901365131 1:8740784-8740806 TCCAGGGTCAATAACATACATGG + Intronic
902573506 1:17361962-17361984 TTCATGGGCAGTTTCACAGAGGG + Intronic
902861280 1:19248077-19248099 TTCAGGAGCAGTAACACCCATGG - Intronic
903076746 1:20775201-20775223 TTCAGGGGCAGCAACACACATGG - Intronic
904146207 1:28394108-28394130 TTCAGGGGTACTAACAGGCATGG - Intronic
904491453 1:30862467-30862489 TTCAGGGGCAATAGCATGCACGG - Intergenic
904610619 1:31724324-31724346 TTCAGGGACAGCATCACACAGGG + Intergenic
904722257 1:32519099-32519121 TTCAGGGGCAATAACACGCGTGG + Intronic
905829251 1:41051497-41051519 TTCAGGGACAATAACATGCATGG - Intronic
905837999 1:41146083-41146105 TTCAGGGACAGTTACATGCATGG - Intronic
906029439 1:42706116-42706138 TTCAGGGGCAGTAACTTGAATGG + Intergenic
906368090 1:45227911-45227933 TTCAATGGCAGCAACTCACATGG + Intronic
906394281 1:45447476-45447498 TTCAGGGACAATAACACACATGG + Intronic
906547494 1:46630844-46630866 TTCAGGGGCAATAACACACATGG + Intergenic
906796950 1:48704694-48704716 TTCAGGGGCAATAACAGGCATGG + Intronic
906920310 1:50057050-50057072 TTCAAGGGCAATAACAAACATGG - Intronic
906968166 1:50480884-50480906 CTTTGGGGCAGTAACACACACGG - Intronic
907117505 1:51982085-51982107 TTCAGGGGCAATAATAGGCATGG - Intronic
907424446 1:54370625-54370647 TCCTGGGGCAGTGACAGACAAGG - Intronic
907500186 1:54873542-54873564 TTCAGGGGCAATAACACACATGG - Intronic
907624857 1:56020049-56020071 CTTCGGGGCAATAACACACATGG + Intergenic
908617264 1:65936173-65936195 TTCAGGAGCAGTAACACACATGG + Intronic
908680554 1:66656240-66656262 TGCAGGGGCAATAACACACATGG + Intronic
908839866 1:68268337-68268359 TTCAGGGTCAATAATACACCTGG - Intergenic
908925861 1:69254189-69254211 ATCAGGAACAATAACACACATGG - Intergenic
908934235 1:69355512-69355534 TTCAGTGGCAATAACACACATGG + Intergenic
909004388 1:70257752-70257774 TTAAGGGGCAATAACATGCATGG - Intergenic
909277540 1:73707646-73707668 TTTAGGGGCATTAATACACATGG + Intergenic
909400545 1:75224461-75224483 TTCAGGGACAATAAAAAACATGG - Intronic
909418653 1:75436989-75437011 TTCAGGGGCAATAACACACATGG + Intronic
909610291 1:77544672-77544694 TTCAGGGGCAGTAACATGCATGG + Intronic
909782868 1:79569488-79569510 TTCAGGGGCAATAACATGCATGG + Intergenic
909830791 1:80187128-80187150 TTCAGGGGCAATAACATGTATGG - Intergenic
909872093 1:80753812-80753834 CTCAGGGGCAATAACATACATGG + Intergenic
909886917 1:80953153-80953175 TTCCGGGACAGTAACACACATGG + Intergenic
910346546 1:86245391-86245413 TTCAGGGGCAGTAACATGCATGG + Intergenic
910595560 1:88976697-88976719 TTCAGGGACAATAACATGCATGG - Intronic
910667129 1:89737926-89737948 TTCAGGGGCAGTAACACACATGG + Intronic
911061891 1:93756216-93756238 ACCAAGGGCACTAACACACAAGG - Intronic
911085020 1:93969135-93969157 TCCAGGGGCAATCACACTCATGG - Intergenic
911195599 1:94991985-94992007 TTCAGGGCCACTAACACGCATGG + Intronic
911211232 1:95139993-95140015 TTCAGGGATAATAACACACATGG + Intronic
911316940 1:96367250-96367272 TTCAGGGGCAATAACATGCATGG - Intergenic
911539285 1:99139131-99139153 TTCAGGGGCAATAACTTGCATGG - Intergenic
911544118 1:99196036-99196058 TTCAGGGGCAATAATATGCATGG - Intergenic
911940682 1:104043674-104043696 TTCAGGACCAGTAAAAGACAGGG - Intergenic
912909477 1:113743360-113743382 TTCAGGGGCAATAACACACAGGG + Intronic
912913290 1:113785262-113785284 TTCAGGGGCAATAACACTCACGG + Intronic
913025644 1:114836284-114836306 TTCAAGGGCAGTAATACACGTGG + Intergenic
913136466 1:115894364-115894386 TTCAGGGGCAATAATATGCATGG - Intergenic
913163653 1:116166875-116166897 TTAAGGGCCAGTCACACACTGGG - Intergenic
913194844 1:116447309-116447331 TTCAGGGGCAATAACAGGCCTGG - Intergenic
913617288 1:120574073-120574095 TTCAGGGACAATAACACACATGG - Intergenic
914572987 1:148936846-148936868 TTCAGGGACAATAACACACATGG + Intronic
914778024 1:150756231-150756253 TTCAGGGGCAACAACACGTATGG + Intronic
915029368 1:152863435-152863457 TTCAGGGACAATAACATGCATGG - Intergenic
915251793 1:154595356-154595378 TTCAGGGGCAATAACATGCATGG - Intronic
915374662 1:155382610-155382632 TTCAGGGGCAGTAACACTCATGG - Intronic
915506965 1:156363767-156363789 TTCAGGGACAGTAACACACATGG + Intronic
915621345 1:157087131-157087153 TTCAGGGGCAATAACATGCAAGG - Intergenic
915621551 1:157089060-157089082 TTCAGGGGCCATAACATGCATGG - Intergenic
915896679 1:159816705-159816727 TTCAGAGGCAATAACACACATGG - Intergenic
916404068 1:164480013-164480035 TTCAGGGGCAATAACATACATGG - Intergenic
916410156 1:164539251-164539273 TCCAGGGGCAATAATACACATGG - Intergenic
916483439 1:165235898-165235920 GCCAGGCGCAGAAACACACACGG - Intronic
916713156 1:167429950-167429972 TTCAGGGGCTTTAACAGTCATGG + Intergenic
917081065 1:171257534-171257556 GCCAGGGGCAGGATCACACAGGG + Intronic
917169927 1:172160565-172160587 TTCGGTGGCAGTAACATGCATGG + Intronic
917260530 1:173162465-173162487 TTCAGGGGCAATAGCACACATGG + Intergenic
917449946 1:175139516-175139538 TTCAGGAGCAATAGCACACATGG + Intronic
917552703 1:176051668-176051690 TTCAGTGCCAGTAACACACATGG - Intronic
917588161 1:176449445-176449467 TTCAGGGGCAATAACACACATGG + Intergenic
918031472 1:180816954-180816976 CTTCGGGGCAATAACACACAGGG - Intronic
918134169 1:181656263-181656285 TTCAGGAGCAATAACACACAGGG - Intronic
918174097 1:182028201-182028223 TTCAGGGGCAATAACACACCCGG + Intergenic
918505106 1:185245372-185245394 CTCAGAGATAGTAACACACATGG + Intronic
918767376 1:188504046-188504068 TTAAGGGGCACAAACACAAATGG - Intergenic
918817990 1:189214830-189214852 TTCAGGGGCAATAACAAGCATGG - Intergenic
918907652 1:190519010-190519032 TTCAAGAGCAATAACACCCATGG - Intergenic
918934531 1:190903837-190903859 TTCAGGGACAGTAAAATACATGG - Intergenic
918937933 1:190948544-190948566 TTCAGGAGTAATAATACACATGG - Intergenic
918957524 1:191229281-191229303 ATCAGGGACAGTAACACATATGG + Intergenic
919040881 1:192386855-192386877 TTCTGGGGCAATAAGACGCATGG + Intergenic
919144478 1:193616266-193616288 TTCAGGGACAATAACACTCTTGG - Intergenic
919295471 1:195693887-195693909 TTCAGGGACAATAACATGCATGG + Intergenic
920324468 1:205151828-205151850 TTCGGGGACAATAATACACATGG + Intronic
920717164 1:208350911-208350933 TTCAGGGGCAAAAACAGGCATGG - Intergenic
921399829 1:214709159-214709181 TTCAGGGGCAGCAACACACATGG + Intergenic
921643639 1:217586496-217586518 TTCAGGGGCAATAACACACATGG + Intronic
921663288 1:217834413-217834435 TCTTGGGGCAATAACACACATGG - Intronic
921722181 1:218484999-218485021 TTCAGGGGCAATAACACGCATGG - Intergenic
921770461 1:219032316-219032338 TTCAGGGGCAATAACACATACGG - Intergenic
922034555 1:221835761-221835783 TTCAGGGGCACTGACACAACAGG - Intergenic
922122731 1:222688946-222688968 TTCCAGGGCAGTAACACACATGG - Intronic
922480103 1:225934315-225934337 TTCAGGGGCAATAACATATACGG + Intergenic
923128169 1:231050586-231050608 TTCAGGGGCGATAACACACATGG + Intergenic
923312638 1:232750042-232750064 TTCAGGGACAATGACACGCATGG - Intergenic
923405862 1:233659307-233659329 TTCAGGGGCAGTAACACGCATGG + Intronic
923417910 1:233782757-233782779 TTCAGGGACAATGACACTCATGG + Intergenic
923642980 1:235784491-235784513 TGCAGGGGCAGTAAAGCATAGGG + Intronic
924166909 1:241293466-241293488 TTCAGAGGCAGTAATAGGCATGG - Intronic
924435314 1:244034805-244034827 CTTCGGGGCAGTAACACACGTGG - Intergenic
924889151 1:248254974-248254996 CTCACGGGCAGGGACACACATGG + Intergenic
1062869248 10:885190-885212 ACCAGGAGCAGTAACACACAGGG + Intronic
1063107918 10:3009760-3009782 TTCAGGGCATGTTACACACACGG - Intergenic
1064530190 10:16300675-16300697 TTCAGGGGCAGTAACACACATGG + Intergenic
1064602896 10:17011389-17011411 TTTAAGGGCCGTAACACTCATGG - Intronic
1065063569 10:21934092-21934114 TTCAGGGTCAGTAACATGCATGG - Intronic
1065631112 10:27682018-27682040 TTCAGGGGCAATAACACGCATGG - Intronic
1065781489 10:29172441-29172463 TTCTGGGGCAATAACACACATGG + Intergenic
1067126781 10:43524268-43524290 TTCATTGGCAGATACACACAGGG + Intergenic
1067250812 10:44585590-44585612 TTCAGGGGAAATAACACTCATGG + Intergenic
1067826204 10:49575180-49575202 TTCCGGGGTAGTAACACACCTGG + Intergenic
1068065437 10:52124927-52124949 TTCAGGGGCAATAACACACATGG + Intronic
1068092768 10:52453370-52453392 ATCGGGGGCAACAACACACACGG - Intergenic
1068418177 10:56753079-56753101 TTCAAGGACAGTATCATACATGG - Intergenic
1068439712 10:57035927-57035949 TTCAGGGACAATAACATGCATGG + Intergenic
1068466178 10:57395743-57395765 TTCAAGGACAAAAACACACATGG + Intergenic
1068784545 10:60957056-60957078 TTCTGGGGCAATAACATATATGG + Intronic
1068795318 10:61072929-61072951 TTCAGGGACAATAACACTCATGG + Intergenic
1069051103 10:63795592-63795614 TCCAGGGACAATAATACACAGGG + Intergenic
1069118729 10:64540813-64540835 TTCAGGGACACTAACACTCACGG - Intergenic
1069125707 10:64629731-64629753 TTCAGGGGCAATAACAGGCATGG - Intergenic
1069153187 10:64991874-64991896 TCCAGGGGCAGTAACACGCATGG - Intergenic
1069357456 10:67603458-67603480 TTCAGGGGCAATAACACGCATGG - Intronic
1069653794 10:70072387-70072409 TTTAGGGACAATAACACGCACGG + Intronic
1070712413 10:78692317-78692339 ATCTGGGGCGGCAACACACAAGG + Intergenic
1070868447 10:79725650-79725672 TTCAGGAGCAGTAACATGCATGG - Intergenic
1071155654 10:82685923-82685945 TTCAGGGACAATAACACACATGG + Intronic
1071212356 10:83358517-83358539 TTCAGGGGCAACAACAAGCATGG + Intergenic
1071339606 10:84632261-84632283 TTCAGGGGCAGTAACACACTTGG - Intergenic
1071407566 10:85353154-85353176 TTCAGGGGCAATAACAAGCATGG - Intergenic
1071461250 10:85898704-85898726 TTCAGGGGCAATAGCATGCATGG + Intronic
1071540972 10:86483651-86483673 TTCAAGGGCACTAACATACGTGG - Intronic
1071635362 10:87247856-87247878 TTCAGGAGCAGTAACATGCATGG - Intergenic
1071659885 10:87490131-87490153 TTCAGGAGCAGTAACATGCATGG + Intergenic
1071693340 10:87845786-87845808 TTCAGAGTTAGTAACATACACGG + Intergenic
1071701471 10:87942669-87942691 TTAAGGGGCAATAACATCCATGG - Intronic
1072061346 10:91814123-91814145 TTTAGGGGCAATAACATACAGGG - Intronic
1072289867 10:93954085-93954107 TTCAGGGACAGGAACATGCATGG - Intronic
1072325149 10:94290567-94290589 TTCAGGGACAATAACAAGCATGG + Intronic
1072644051 10:97238086-97238108 TTCAGAGGCAATATCACTCATGG - Intronic
1072739805 10:97902548-97902570 TTCAGAGGCAGAAACACACCTGG - Intronic
1073796806 10:106997306-106997328 TTCAGAGGCAGTGACAGTCAGGG - Intronic
1074660866 10:115655948-115655970 TTTAGGGGCAGCAGCACATATGG - Intronic
1074733267 10:116400134-116400156 TTCAGGGGCAATAACATTCACGG + Intergenic
1074749256 10:116568175-116568197 CTCAGGGGAAATGACACACAAGG + Intergenic
1074873579 10:117596614-117596636 GACAAGGTCAGTAACACACATGG + Intergenic
1075163568 10:120045865-120045887 TTCAGGGGCAATAACAGGTATGG + Intergenic
1075296595 10:121282042-121282064 TTCAGGTGGAGTAACACGCATGG - Intergenic
1075498106 10:122945505-122945527 TTCAGGGACAGTAATACCCATGG - Intronic
1075530375 10:123224196-123224218 TTCAGGTGCAATAACATGCATGG - Intergenic
1076165934 10:128282829-128282851 TTCAGGGGCAATAACACGCATGG + Intergenic
1076181997 10:128416745-128416767 TTGAGGGGCAATAAGAGACATGG - Intergenic
1076569190 10:131421127-131421149 TGCAGGGGCAGTGCCCCACATGG - Intergenic
1076705314 10:132298205-132298227 TTCAGGGGAGGGACCACACAGGG - Intronic
1078031433 11:7755426-7755448 TTCAGGGGCAATAACATGCATGG - Intergenic
1078125008 11:8552716-8552738 TTCAGGGGCAATAACAAGCACGG + Intronic
1078281867 11:9910558-9910580 TTCAGGGGCAGTAACACACATGG - Intronic
1078329096 11:10404182-10404204 TTCAGGGGCAGTAACATGCATGG - Intronic
1078343464 11:10520475-10520497 TTCAGGGGCAGTAACATGCACGG + Intronic
1078644524 11:13127815-13127837 TTCAGGGGCTGTAACACACATGG - Intergenic
1078777325 11:14405622-14405644 TTCAGGGTCAATAACACAAATGG - Intergenic
1079061744 11:17254896-17254918 TTCAAGGGCAATAACATGCACGG + Intronic
1079118908 11:17663343-17663365 TTCAGGGGCAACAATACACATGG + Intergenic
1079141313 11:17811808-17811830 TTGAGGAACAGTAACAGACAGGG + Intronic
1079199455 11:18363114-18363136 TTCAGGGGCAGTAATGCACATGG + Intronic
1079352873 11:19707521-19707543 TTCAGGGGCAAAAACACATATGG + Intronic
1079514174 11:21247547-21247569 TTCAGGGGCAATAGCACGCATGG + Intronic
1079749544 11:24179920-24179942 TTCAGGGCCAATAACATACGTGG - Intergenic
1080282457 11:30573537-30573559 TTCAGGAGCAGTAACAGGCATGG - Intronic
1080436187 11:32247142-32247164 TTCAGGGGCAATAATCCTCATGG + Intergenic
1080689090 11:34540942-34540964 TTCAGGGGCAGAAGCAGAGAGGG - Intergenic
1081071887 11:38620965-38620987 TTCAGGGACAATAATCCACATGG + Intergenic
1082682441 11:56192621-56192643 TGGAGGGGCAATAACATACATGG - Intergenic
1082858547 11:57831332-57831354 TTCAGGGGCAATAACGTGCATGG + Intergenic
1082892113 11:58150905-58150927 TTCAGGGGCAATAACATACACGG - Intronic
1083072904 11:60005137-60005159 TTCGTGGGCAATAACACACAAGG - Intergenic
1083400041 11:62417185-62417207 TTCAGGGGCCAGAGCACACAAGG - Intronic
1083514128 11:63240781-63240803 TTCTGGAGCAGTAACATGCATGG + Intronic
1084293211 11:68190510-68190532 TTCAGGGGCAGTAGCATGCATGG - Intronic
1084753181 11:71217593-71217615 TTCAGGGGCAGTAACATGCGTGG - Intronic
1085005677 11:73087078-73087100 TTCAGGGGCAGTAACATGCATGG - Intronic
1085142492 11:74159404-74159426 CTTAGGGTCAGTCACACACATGG - Intronic
1085306585 11:75489686-75489708 TTGAGAGGCAGTAAATCACAGGG + Intronic
1085555472 11:77416454-77416476 TTTAGGGGCAATAACATGCATGG + Intronic
1085677362 11:78536393-78536415 TTCAGGGGCAGTAACACACATGG - Intronic
1085871463 11:80355148-80355170 CTTAGGGGCAGTTACATACATGG + Intergenic
1086305495 11:85476745-85476767 TTCAGGGACAATAACATACATGG + Intronic
1086643543 11:89190288-89190310 TTCAGGGGCAATAGTACACATGG - Intronic
1086799881 11:91159768-91159790 TTCAGGGGCAATAACACACATGG + Intergenic
1087088907 11:94247903-94247925 TTCAGAGGCAGTAACATGCATGG + Intergenic
1087156767 11:94912328-94912350 TTCAGGGGCAGTACCATGCATGG + Intergenic
1087258462 11:95983136-95983158 TTCAGGAACAATAACACACATGG - Intronic
1087502230 11:98972167-98972189 TTCAGGGGCAATAACACACGTGG + Intergenic
1087666062 11:101049223-101049245 TCAGGGGGCAGTAACACACACGG + Intronic
1087819694 11:102697956-102697978 TTCAGGGGCAATAACAGGCATGG + Intronic
1088041264 11:105385235-105385257 TTCAGGGGCAATAACACACATGG + Intergenic
1088056231 11:105582980-105583002 TTTAGGGGCAATAACATGCATGG - Intergenic
1088086865 11:105991645-105991667 TTCAGGGGCAACAACAGGCATGG + Intergenic
1088096786 11:106109644-106109666 TTCAGGGGCAATAACATACAAGG + Intergenic
1088100220 11:106146450-106146472 GTCTGGGACAATAACACACAAGG + Intergenic
1088118676 11:106341700-106341722 TTCAGGGGCAATAACACACACGG - Intergenic
1088241725 11:107780149-107780171 TTTAGGTGCACTACCACACATGG - Intergenic
1088336502 11:108710542-108710564 TTCAGGGGCAGTAACATGCATGG + Intronic
1088383871 11:109227822-109227844 TTCAGAGGCAATAACATGCATGG + Intergenic
1088453332 11:110006142-110006164 TTCAGGGGCAATAACATGCATGG + Intergenic
1088462646 11:110098107-110098129 TTCAGGGGCGGTAACAGGCACGG - Intronic
1088744050 11:112790137-112790159 TTCAGGGGCAGTAATATGTATGG + Intergenic
1088960500 11:114658952-114658974 TTCTGGGACATTGACACACAAGG + Intergenic
1088993983 11:114980009-114980031 TTCAGGGGCAGTAACACACAGGG - Intergenic
1089379153 11:118015333-118015355 GGCAGGGGCAGAGACACACAAGG + Intergenic
1089826906 11:121285993-121286015 TTCAGAGGCAGTAACATACATGG + Intergenic
1089877631 11:121741032-121741054 TACAGAGGCAGTGAAACACAGGG - Intergenic
1089995372 11:122902015-122902037 TTCAGGGGCAGTAACACATACGG + Intronic
1090041216 11:123293716-123293738 TTTAGGGGCAATAACATGCATGG + Intergenic
1090147745 11:124344360-124344382 TTTAGAGGCAATAACACACATGG + Intergenic
1090185651 11:124737718-124737740 GGCAGGAGCAGTAACACATATGG - Intergenic
1090220435 11:125017706-125017728 TTCAGAGGCAATAACACTCATGG - Intronic
1090516715 11:127436410-127436432 TTCAGGGACAGTAACGCCCATGG + Intergenic
1090536966 11:127653390-127653412 TTCAGGGGCAATAAGAAGCATGG - Intergenic
1090537358 11:127658007-127658029 TTCAGTTACAGTTACACACAGGG - Intergenic
1090841345 11:130490198-130490220 TTCAGGGACAGTAACAGGCATGG - Intergenic
1091063714 11:132489264-132489286 TTCAGGGGCAGTAACACACATGG + Intronic
1091097013 11:132833395-132833417 TTCAGGGGCAATAACACGCATGG + Intronic
1091108820 11:132946206-132946228 TTCAGGAGCAATAACATGCACGG + Intronic
1091170915 11:133518957-133518979 TTCAGGGACTGTCACCCACAGGG - Intronic
1091364173 11:135003783-135003805 TTCAGGGGCAGTAACAGGCATGG + Intergenic
1091700664 12:2658718-2658740 TTCAGGGGCACTAACATGCATGG - Intronic
1091953977 12:4620983-4621005 TTCAGGGTAAGTAACACTCATGG - Intronic
1091984583 12:4898456-4898478 TTCAAGGGCAGTACCACTCACGG + Intergenic
1092039285 12:5369464-5369486 TGCAGGGGCAGGTGCACACACGG - Intergenic
1092110293 12:5956367-5956389 TTCAGGGGAAATAACACTCATGG - Intronic
1092555282 12:9553381-9553403 TTCAGGGGCAGTAGCACGCATGG + Intergenic
1093058856 12:14582097-14582119 TTTAGGGGCAATAACAGGCATGG + Intergenic
1093407887 12:18827574-18827596 TTCAGGGGCAATAACACATGTGG + Intergenic
1093439055 12:19171934-19171956 TTCAGGGGCAGTAACACTCATGG + Intronic
1093519198 12:20028139-20028161 TTCAGGGGAAGAAAAACTCAAGG - Intergenic
1093680864 12:22001152-22001174 TTCAGAGGCAATAACATGCATGG + Intergenic
1093793013 12:23277256-23277278 TTCAGGAGCAATAACATGCATGG - Intergenic
1093956394 12:25224289-25224311 TTCAGGGGCAGTAACACACGTGG - Intronic
1094232189 12:28119443-28119465 TTCAGAGGCAATAACATTCATGG - Intergenic
1094416268 12:30218795-30218817 TTCAGGGGCAATAACATGTATGG - Intergenic
1094442668 12:30496337-30496359 TTTAGGGGCAATAACACACATGG - Intergenic
1094446610 12:30537833-30537855 TTCAGGGACAATAACATGCATGG + Intergenic
1094455482 12:30627934-30627956 TTAAGGGGCAGTAACATGTATGG - Intergenic
1094459343 12:30677575-30677597 TTCAGGGGCAATAACATGCATGG - Intronic
1094516818 12:31137299-31137321 TTCTGGGGCAATAACATGCATGG - Intergenic
1094611309 12:31998093-31998115 ACCAAGGGCAGTAACACGCATGG + Intergenic
1094617651 12:32050446-32050468 TTCAGGGACAATAACATGCATGG - Intergenic
1094737212 12:33248570-33248592 TTCAGGGGCAACAACACACACGG + Intergenic
1095149625 12:38777123-38777145 TTCAGGGGCAGTACCATGCATGG - Intronic
1095197486 12:39338108-39338130 TTCCGGAGCATTAACACACATGG - Intronic
1095223992 12:39656668-39656690 TTCAGGGGCAGTGATTCACAGGG - Intronic
1096342659 12:50815218-50815240 TTTAGGGGCAATAACACACAGGG - Intronic
1096417560 12:51426742-51426764 TTCTGGGGTTATAACACACAGGG + Intronic
1097003243 12:55896275-55896297 TTCTGGGGCAATAACACACATGG + Intergenic
1097272500 12:57785361-57785383 TTCAGGGGCAGTAACGGGCATGG + Intronic
1097422480 12:59397414-59397436 TTCAGGAGCAGTAATACTCATGG - Intergenic
1097490721 12:60267141-60267163 TTCAGGGGCAAAAACACTCACGG + Intergenic
1097649421 12:62278210-62278232 TTCATGGGCAGTAATATTCATGG + Intronic
1097790456 12:63809997-63810019 TTCAGGGGCAATAATAGGCATGG - Intergenic
1098017143 12:66117711-66117733 TTCAGGGGCAATAACAGGCATGG - Exonic
1098049280 12:66436477-66436499 TTAAAAGGCAGTAACAAACAAGG + Intronic
1098108694 12:67098425-67098447 TTCAGGGGCAGTAACATGCATGG - Intergenic
1098321149 12:69244817-69244839 TTCAGGGGCAGTATGATGCATGG + Intronic
1098515377 12:71369673-71369695 TTCAGAGACAGTAACAGGCATGG - Intronic
1098745122 12:74227090-74227112 TTGAGGAGCAATAACACATATGG - Intergenic
1098773479 12:74584051-74584073 TGCAGGGGCAATAACAAGCATGG + Intergenic
1098779328 12:74665149-74665171 TTCGGGATCAGTAACACACGTGG + Intergenic
1098800278 12:74948809-74948831 TTCGGGGGCAGTAATACTCATGG + Intergenic
1098880451 12:75911991-75912013 TTCATGGGCAATAACACACATGG - Intergenic
1099330939 12:81285945-81285967 CATTGGGGCAGTAACACACATGG - Intronic
1099488547 12:83257817-83257839 TTAAGTGAAAGTAACACACAAGG - Intergenic
1099559720 12:84155976-84155998 TTCAGGGGCAATAACAAGCATGG - Intergenic
1099670261 12:85682387-85682409 TTCAGGGGCAATAACATACATGG + Intergenic
1100012862 12:89974506-89974528 TTTAGGGGCAGTAACACACATGG + Intergenic
1100064435 12:90624499-90624521 GTCAGGGGCAATAATAAACATGG - Intergenic
1100314281 12:93429657-93429679 TTCAGGGGCAGTAACACACATGG - Intronic
1100692630 12:97054795-97054817 TTCAGGGGCAATAAAACACATGG - Intergenic
1100807879 12:98306587-98306609 TTCAGGGGCAATAACACGCATGG + Intergenic
1101050799 12:100861967-100861989 TTCAGGGGCAATAACATGCATGG + Intronic
1101177564 12:102171046-102171068 TTCAGGAGCAGTAATACCCCTGG + Intronic
1101354153 12:103961045-103961067 TTCAAGGGCAATAACCCACAGGG - Intronic
1101555367 12:105803771-105803793 TTCAGGGGCAATAACATGCACGG - Intergenic
1101563095 12:105878747-105878769 TTCAGGGGCAGTAATACACATGG + Intergenic
1101619081 12:106365978-106366000 TTCATGGACAGTAACACACATGG + Intronic
1101784196 12:107867977-107867999 TTCAAGGGCAATAACATGCATGG + Intergenic
1101989405 12:109472408-109472430 TTCAGGGACAGTAACACGCATGG + Intronic
1102052442 12:109872504-109872526 CTCATGGGCTGTTACACACATGG + Intronic
1102311945 12:111852128-111852150 TTCAGTGCCAGTATCACAGAAGG - Intronic
1102918001 12:116769422-116769444 TTCAGGGGCAATAACACCCATGG - Intronic
1103178668 12:118888171-118888193 TTCAGGGGGAATAACATGCATGG + Intergenic
1103229593 12:119317760-119317782 TTCAGGGGCAATGACATGCAGGG + Intergenic
1104204364 12:126623003-126623025 TTCACAGACAGTAACACACACGG + Intergenic
1104917044 12:132271128-132271150 TGCTGCCGCAGTAACACACACGG - Intronic
1105683769 13:22756609-22756631 TTCAGGGGCAACAACACACACGG - Intergenic
1106213862 13:27676578-27676600 TGCAGGGGTAATAACACACACGG - Intergenic
1106406116 13:29475511-29475533 TTCAGGGGCAGTAACATCCATGG - Intronic
1106417835 13:29560269-29560291 TTCAGGGGCAGGAACACACAAGG + Intronic
1106957718 13:34960085-34960107 TTCAGGGGCAACAACACCCATGG - Intronic
1107294755 13:38897138-38897160 TTCAGGGGCAATGACACCCATGG + Intergenic
1107321920 13:39198992-39199014 TGCAGGGGCAATAACATGCATGG - Intergenic
1107334315 13:39337751-39337773 TTCAGGAGCATTAACATGCATGG - Intergenic
1107445048 13:40462937-40462959 TTCAGGGGCAGTAAGATACATGG + Intergenic
1107630823 13:42341500-42341522 CCCATGGGCAGTAACACCCAGGG + Intergenic
1108232306 13:48360012-48360034 TTCAGGGGAAGTATTACAAATGG + Exonic
1108323918 13:49311556-49311578 TGCAGGGGCCATAACACCCATGG - Intronic
1108384855 13:49889851-49889873 TTCAGGGGCAATAACAGGCATGG - Intergenic
1108387066 13:49908864-49908886 TTCAGGGGCGATAACAGGCATGG - Intergenic
1108453726 13:50592251-50592273 TTCAGGGGCAATAACACACACGG + Intronic
1108531036 13:51327423-51327445 TTCAGGGGCCATAACATGCATGG - Intergenic
1108543910 13:51471887-51471909 TTCAGAGGCAATAACAGGCATGG - Intergenic
1108767854 13:53655708-53655730 TTCAGGGGCCATAACACTCATGG + Intergenic
1108812435 13:54244660-54244682 TTCAGGGGCAATAACATGCATGG + Intergenic
1108825158 13:54404593-54404615 TTCAGGGGTATTAACACACATGG + Intergenic
1109126778 13:58527874-58527896 TTCAGGGGCAATAACAGGCATGG - Intergenic
1109385258 13:61621941-61621963 TTCAGGGGCAATAACACACATGG + Intergenic
1109431538 13:62242298-62242320 TTTAGGGGCAATAACATGCATGG + Intergenic
1109454173 13:62561882-62561904 TTCAGGGGCAAAAACACACAAGG - Intergenic
1109472097 13:62821439-62821461 TTCAGGGGCAATAACATGCATGG - Intergenic
1109505938 13:63303645-63303667 TTCAGGAGCAAGAACACGCATGG - Intergenic
1109860769 13:68195268-68195290 TTCAAGGGCAATAACATGCATGG + Intergenic
1110166722 13:72451131-72451153 TTCAGGGGCAATAACATACATGG - Intergenic
1110386495 13:74917920-74917942 CACAGGGGCATTAACACAAAAGG + Intergenic
1110758436 13:79203146-79203168 TTCAGGGGCAACAACACTCATGG - Intergenic
1110786058 13:79527846-79527868 GTCAAGGGCAATAACACACATGG - Intronic
1110933134 13:81248580-81248602 TTCAAGGGTAATAACACCCATGG + Intergenic
1111053504 13:82917482-82917504 TTCAGGGGAAATAACATACATGG - Intergenic
1111269068 13:85856124-85856146 TTCAGGGGCAATAACATACATGG + Intergenic
1111336017 13:86824679-86824701 TTCCAAGGCAGTAACATACATGG + Intergenic
1111349136 13:87003053-87003075 TTCAGGGGCAATAACACACATGG - Intergenic
1111370967 13:87316043-87316065 TTCAGGGGCAATATCAAACATGG - Intergenic
1111391029 13:87595016-87595038 TTTAGGGACAATAACGCACAAGG - Intergenic
1111421404 13:88016435-88016457 TTCAGGGACAATAACACACATGG - Intergenic
1111426899 13:88096593-88096615 TTCAGGGGCAATAACACACATGG + Intergenic
1111762599 13:92484231-92484253 TTCAAGGTCAGTAACACTCATGG + Intronic
1112657180 13:101463440-101463462 TTCAGGGACAGGAACACAAAAGG - Intronic
1112942487 13:104881238-104881260 TTCAGGGTCAGAAACACACATGG + Intergenic
1113125477 13:106973853-106973875 TTCAGGGGCAGTAACACACGTGG - Intergenic
1113137058 13:107102843-107102865 TTCAGGGGCAATAGCACACATGG - Intergenic
1113153637 13:107292618-107292640 TTCAGAGGCAATAACAGGCATGG + Intronic
1113529398 13:111010277-111010299 TTCAGGGGCAATGACATGCATGG - Intergenic
1113694438 13:112333894-112333916 TTCAGGGGCAGTGACACACACGG - Intergenic
1114856862 14:26457802-26457824 TTTGGGGGCACTAATACACATGG - Intronic
1114879250 14:26763275-26763297 TTCAGGGGCAATAACATCCATGG + Intergenic
1114923786 14:27367107-27367129 TTCAGAGGCAATGACACACATGG - Intergenic
1114951345 14:27758159-27758181 TTCAGGGGCAATAGCATGCATGG - Intergenic
1115210409 14:30962029-30962051 TTCAAGGGCAGTAACACACATGG - Intronic
1115254996 14:31390941-31390963 TTCAAGGGCAGTGACACGCATGG - Intronic
1115930676 14:38489469-38489491 TTCAAGGGCAATAACGCACATGG + Intergenic
1116105626 14:40500381-40500403 TTCAGGGGCAATAACACAGATGG - Intergenic
1116318794 14:43433177-43433199 TTCAAAGACAATAACACACATGG + Intergenic
1116425915 14:44791101-44791123 TTCAGGGACAATAACATGCATGG - Intergenic
1116590526 14:46765592-46765614 TTTAGGGGCAATAACAGACATGG + Intergenic
1117113542 14:52485102-52485124 TTCAGGGACAGTAACAAGCATGG - Intronic
1117149353 14:52869817-52869839 TTCAGGGGGAGTAACAAGCATGG - Intronic
1117197719 14:53357235-53357257 TTCAAGGGCAATAAAACACATGG - Intergenic
1117235195 14:53766996-53767018 TTCAAGGGCAATAACACACATGG + Intergenic
1117558881 14:56915340-56915362 TTCAGGGGCAATAACACGCATGG + Intergenic
1117794026 14:59373118-59373140 TTCAGGAGCAATAACCCGCATGG + Intergenic
1117863330 14:60116790-60116812 TTCAGGGGCAATAACATACATGG - Intronic
1117873801 14:60228888-60228910 TTCAGGGGCAATAACATGCACGG + Intergenic
1118307168 14:64664574-64664596 TTTAGGGGCAATAACATGCATGG + Intergenic
1118802073 14:69199742-69199764 TTCAGGGGCAATAACAGGCATGG + Intronic
1119016540 14:71062246-71062268 TTCAGAAGCAATGACACACATGG - Intronic
1119314648 14:73682768-73682790 TTCAGGGGCAGTAACACACATGG + Intronic
1119374229 14:74176076-74176098 TTCAGAGGCAGTAACACACATGG + Intronic
1119403060 14:74377552-74377574 TCTAAGGGCAGTAACACATATGG - Intergenic
1119589052 14:75867896-75867918 TTCAGGGGCAGGAAGACAGCAGG - Intronic
1119695214 14:76707884-76707906 TTCAGGGGCAATAACACACATGG + Intergenic
1120065446 14:80035171-80035193 TTCAGGGGCATTAACATGCATGG - Intergenic
1120199551 14:81521876-81521898 TTCAGGGCCATTAACAGGCATGG - Intronic
1120267629 14:82271641-82271663 TTCAGGGACAATAACACACATGG - Intergenic
1120293363 14:82606117-82606139 TTTAGGGGCAATAATACGCATGG + Intergenic
1120712984 14:87812170-87812192 TTCAGGGGCAGTAACACACATGG + Intergenic
1120785734 14:88533951-88533973 TTCAGGGGCGGTAACATGCATGG - Intronic
1121750678 14:96352473-96352495 TTCAGGAACAGTAACATGCATGG - Intronic
1122147548 14:99700874-99700896 TTCAGGGGCAATAACAGGCATGG - Intronic
1122237687 14:100341466-100341488 GTCAGGGGCAGTGACTCAGAGGG + Intronic
1122378066 14:101280727-101280749 TTCAGGGACAGTGAAACAAATGG + Intergenic
1122559920 14:102605808-102605830 TTCAGAGGCAATAAGACCCATGG - Intronic
1123820901 15:24029404-24029426 TTCGGGGGCAGTAACAGGCATGG - Intergenic
1123966221 15:25461422-25461444 TTCAGGGGCAATAACATGCTGGG - Intergenic
1124163553 15:27296938-27296960 TTCAGGGGCAATAGCACACATGG - Intronic
1124449186 15:29770002-29770024 TTCAGGGGCAGTAACACGCATGG - Intronic
1124506912 15:30285388-30285410 TTCAGGGGCAGTAACACGCATGG - Intergenic
1124545005 15:30618589-30618611 TTCAGGTGCAATAACACACAAGG + Intergenic
1124665904 15:31592481-31592503 TTCAGGGGCAGTGACATGCATGG + Intronic
1124736645 15:32253273-32253295 TTCAGGGGCAGTAACACGCATGG + Intergenic
1124778526 15:32607990-32608012 TTCAGGTGCAATAACACAGAAGG + Intergenic
1125322603 15:38504561-38504583 TTTAGGGGCAATAACATGCATGG + Intronic
1125444164 15:39735942-39735964 TTCAAGGGCAGTAACACGCATGG + Intronic
1125456315 15:39862935-39862957 TTCAGGGGCAATAACAGGCAAGG - Intronic
1125990674 15:44104051-44104073 TTCAGGGGAAATAACACACATGG - Intronic
1126045718 15:44637888-44637910 TTCAGAGGCAGTAACATGCATGG - Intronic
1126184461 15:45818408-45818430 TTCAGGAGACCTAACACACAAGG - Intergenic
1126207771 15:46065036-46065058 TTCAGGGGCAATAACACTTATGG + Intergenic
1126274854 15:46865446-46865468 TCCAGGGGCAGTATAGCACAGGG - Intergenic
1126494424 15:49274869-49274891 TTCAGGGGCAATAACATGGATGG + Intronic
1126702020 15:51376852-51376874 TCCAGGGGCAATAACATGCATGG + Intronic
1127191447 15:56535215-56535237 TTCAGGGACATTAACATTCATGG - Intergenic
1127380519 15:58427225-58427247 GTAAGGGGCAGGAAAACACAAGG - Intronic
1127690954 15:61397028-61397050 TTCAAGGACAACAACACACATGG - Intergenic
1127897992 15:63319580-63319602 TTCAGGGACAATAACATGCACGG - Intergenic
1127979754 15:64025949-64025971 TCCAGGGCCACTCACACACAGGG + Intronic
1128297354 15:66535166-66535188 TCCAGGGGCAAGAACACACATGG + Intronic
1128493176 15:68171237-68171259 TTCAGTGGCAGTAACAGACATGG + Intronic
1128850972 15:70955328-70955350 TTCAGGGGCTTTAACATCCATGG - Intronic
1129043689 15:72713434-72713456 TTCAGTGGCAATAACATACATGG + Intronic
1129620463 15:77139217-77139239 TTCAGGGGCAGTAACACACATGG + Intronic
1129961097 15:79685302-79685324 TTCAGGGGCAATAACATGCATGG + Intergenic
1130021759 15:80237455-80237477 TTCAGGGGCAGTAACACACATGG - Intergenic
1130146009 15:81274019-81274041 TTCAGGGGCTGGAAGTCACAGGG + Intronic
1130909636 15:88262247-88262269 TGCAGAGGCAGTGACTCACAAGG + Intergenic
1131354970 15:91737194-91737216 TTCAAAGGCAGTAACAAAAATGG + Intergenic
1131681148 15:94725195-94725217 TTCATGGTCAGTGATACACAGGG + Intergenic
1132033146 15:98455403-98455425 TCCAGGGGCAGTAACATGCGTGG - Intronic
1132059452 15:98679805-98679827 TACAGGGGCAGTAACCCAGGCGG - Intronic
1132126502 15:99231378-99231400 TTCAGTGGCAGTAACATGCATGG - Intronic
1132669305 16:1096164-1096186 TGCTGGGACAGTAACACAGACGG - Exonic
1132839276 16:1970930-1970952 TTCAGAGCCAGTAGCACAAATGG + Intergenic
1134077269 16:11300593-11300615 TTCAGGGGCAGTGCCCCTCACGG + Intronic
1134504870 16:14796884-14796906 TTCAGGGGTACTGACTCACACGG + Intronic
1134575703 16:15332025-15332047 TTCAGGGGTACTGACTCACACGG - Intergenic
1136018148 16:27419329-27419351 TTCAGTGGCAAAAACACACATGG + Intronic
1136528919 16:30853397-30853419 TTCAGAGGCAATAACACGCATGG + Intronic
1136991004 16:35151373-35151395 TCCAGGGGCCTTAACACACTGGG - Intergenic
1137419773 16:48322461-48322483 TTCAGAGGCAGTAACATGCATGG + Intronic
1138356863 16:56388819-56388841 TTCAGGGGCAGTAACACGCATGG + Intronic
1139104172 16:63806202-63806224 TTCAGGGGCAATAACAAGCATGG - Intergenic
1139200058 16:64965504-64965526 TTCAGGGGTAGTAACACACATGG + Intronic
1139216008 16:65124037-65124059 TTCAGGGCCAGGGACCCACAGGG - Intronic
1140274931 16:73500182-73500204 TTCAGGGGCAATAACACGCATGG - Intergenic
1140655305 16:77133701-77133723 TTCACGGTCAGTCACACACTGGG + Intergenic
1141257871 16:82419904-82419926 TTCAGGAGCAATAACAGGCATGG - Intergenic
1142243412 16:88957344-88957366 TTCAGGGCCAGTAGCAGACATGG + Intronic
1142936783 17:3341150-3341172 CTCATGGGCAGAGACACACATGG - Intergenic
1143300554 17:5907129-5907151 TTCAGGGCCAGTAACACACATGG + Intronic
1143339375 17:6197967-6197989 TTCAGGGGTAATAACATGCATGG - Intergenic
1143666602 17:8365732-8365754 GTAAGGGGCAGTAACACCCCTGG - Intergenic
1144117777 17:12116725-12116747 CTCAGGGGCAGTAACACGCAGGG + Intronic
1144312095 17:14023371-14023393 TTCAGGGGCAGTAACAGGCATGG - Intergenic
1144332665 17:14237948-14237970 TTCAGGGGCAGTAACAGGCATGG + Intergenic
1144370103 17:14582193-14582215 TTCAGGGGCAGTAATGTGCATGG - Intergenic
1144450461 17:15373212-15373234 CTCAGGGGCACTAACACACAGGG + Intergenic
1144682340 17:17204322-17204344 CCCAGGGGCAGTGACACTCAGGG - Intronic
1145085529 17:19935744-19935766 TTCAGGGGCAGTAACACGCATGG + Intronic
1145808278 17:27750071-27750093 GACAGGGACAGTAACACAGAAGG - Intergenic
1146078043 17:29751002-29751024 TTCAAGGGCAATAACATATATGG + Intronic
1146702979 17:34978278-34978300 TTCAGGGGCAATGTCACACGTGG + Intronic
1147683133 17:42267362-42267384 TTCAGGGGCAGTAACACATATGG - Intronic
1147993882 17:44350982-44351004 TCCAGGCTCAGTAGCACACAGGG - Intronic
1148252052 17:46091075-46091097 TTCAGGGCCAACAACACACACGG - Intronic
1148368748 17:47077382-47077404 TTCAGGGGCAACAACACACACGG - Intergenic
1148920525 17:51027923-51027945 TTCAGGAGCAATGACACACATGG - Intronic
1149127010 17:53246938-53246960 TTCAGGGGCAGTAACATCTGTGG - Intergenic
1149426745 17:56562199-56562221 TTCAGGGGCAATAACACACATGG - Intergenic
1149629044 17:58105635-58105657 TTCAGGGGCAATAACACACATGG - Intergenic
1149866442 17:60153797-60153819 TTCAGGTGCAGCAACTCCCAGGG + Intronic
1150011033 17:61503879-61503901 CTCAGGGGCAATAACACACAGGG + Intergenic
1150271757 17:63871349-63871371 TTCAGGGGATGCAACACAGAGGG - Intergenic
1150277436 17:63908934-63908956 TTCAGGGGATGCAACACAGAAGG - Intergenic
1150607162 17:66703384-66703406 TTCAGGGGCAGTAATACACATGG + Intronic
1150683094 17:67298894-67298916 TTCAGGGGCAATAACATGCATGG - Intergenic
1151059053 17:71069905-71069927 TTCAGGGGCAACAGCACACAAGG + Intergenic
1151141962 17:72001964-72001986 TTCAGGGGCAATAATATGCATGG + Intergenic
1153084005 18:1262226-1262248 TTCAGGGGTAGTAAGATGCATGG + Intergenic
1153127084 18:1807083-1807105 TTTAGGGGCAGTAACAGGCATGG + Intergenic
1153198630 18:2627227-2627249 TTCAGGGGCAATAACCTACATGG - Intergenic
1153728538 18:7982419-7982441 TCAGGGGGCAGTAACACTCATGG + Intronic
1153937889 18:9947068-9947090 TTCAGGGACAGTAACACTCATGG + Intronic
1154018434 18:10641031-10641053 GGAAGGGGCAGAAACACACATGG + Intergenic
1154109704 18:11556222-11556244 TTCAGGGGCAATAACATGCATGG + Intergenic
1154153211 18:11923678-11923700 TTCAGGGACAGTAACACACATGG - Intergenic
1154172933 18:12063807-12063829 TGCAGGAGGAGTCACACACATGG + Intergenic
1154186439 18:12188544-12188566 GGAAGGGGCAGAAACACACATGG - Intergenic
1155439686 18:25849191-25849213 TTCAGAGGGAATAGCACACATGG - Intergenic
1155623836 18:27812071-27812093 TTCAGGGGAAATAACATACATGG + Intergenic
1155632915 18:27915949-27915971 TTCAGGGGCAAGAACACATATGG - Intergenic
1155663985 18:28284833-28284855 TTCAGGGGCAGTAACATGCCTGG + Intergenic
1155694080 18:28662770-28662792 TTCAGGGGCAAGAACATGCATGG + Intergenic
1155822908 18:30400742-30400764 TTCAGGGGCAATAACACACATGG - Intergenic
1156249758 18:35341586-35341608 TTCAGGAGCAGTAACATACATGG - Intronic
1156256945 18:35407850-35407872 TTCAGGAGCAAAAACACAGAAGG + Intergenic
1156517183 18:37690311-37690333 TTCAGGGGCAGTAACACACATGG - Intergenic
1156615075 18:38773157-38773179 TTCAGGGGCAATAACATACATGG + Intergenic
1156665814 18:39405709-39405731 TTCTGGTGCAGGAACATACATGG + Intergenic
1156826530 18:41436205-41436227 TCCAGGGGCAGTACTAGACATGG - Intergenic
1156920588 18:42517647-42517669 TTCAGAGGTAGTAACACGCATGG - Intergenic
1157052358 18:44181299-44181321 TTCAGGGGCAATAACAGGCATGG + Intergenic
1157129115 18:44986754-44986776 TTCAGGGGCAATAACACGTATGG + Intronic
1157314764 18:46578349-46578371 TTCAGGGACAGAAACACTGAAGG + Intronic
1157890863 18:51416374-51416396 TTCAGGGGCAATAGCACGCATGG + Intergenic
1158111597 18:53946010-53946032 TTCAGGGGCAGCAACAGATATGG + Intergenic
1159793095 18:72808633-72808655 TTATGTGGCTGTAACACACAAGG - Intronic
1159870267 18:73753486-73753508 TTCAGGGGCAGTAACATGCATGG - Intergenic
1160248206 18:77177906-77177928 TTCAGGGGCGATAACACACATGG + Intergenic
1160368041 18:78346099-78346121 TTCAGGGGCAGTACCATGCATGG + Intergenic
1162243371 19:9377462-9377484 TTCAGGGGCAATAACATGCACGG - Intronic
1162715646 19:12630643-12630665 TTCAGGGGCAGTCCTGCACATGG - Exonic
1163081640 19:14948137-14948159 TTCAGGGGCAATACCACGCACGG - Intergenic
1163846851 19:19642979-19643001 GCCTGGGGCAGAAACACACATGG + Intronic
1164675712 19:30099468-30099490 TTCAGGGGCAGTAATACGCATGG - Intergenic
1165019369 19:32910801-32910823 TTCAGGGTCAGTAACGTACATGG + Intronic
1165200906 19:34144091-34144113 TTCAGGGACAATAACACTCATGG + Intergenic
1165699161 19:37924316-37924338 TTCGGGGGCAGTAACACACGTGG + Intronic
1165974726 19:39665789-39665811 TACAGGGGCAGAACTACACAAGG - Intergenic
1167653977 19:50751339-50751361 TTCAGGGGCAATAACACCCTTGG - Intergenic
1168399168 19:56074095-56074117 TTCAGGGGCAGTGACATACATGG + Intergenic
1168565884 19:57422893-57422915 TTCTGGGACAGTAACACACATGG + Intronic
925019790 2:559169-559191 TTCAGAGGCAGTTACTCACGAGG + Intergenic
925029535 2:638742-638764 CTCAGGGGCAGTAACACACATGG + Intergenic
925619976 2:5782544-5782566 TTTAGGTGCGGTAACACCCATGG - Intergenic
925630072 2:5882912-5882934 TTCAGGGGCAGTAACAGGCATGG - Intergenic
925669832 2:6299778-6299800 TTCAGGGGCAATAACGTGCATGG - Intergenic
925677859 2:6385229-6385251 TTCACCAGCAGTAAGACACATGG + Intergenic
925915831 2:8605097-8605119 TTCAGGGGCAGAAACACACATGG - Intergenic
925959325 2:9001095-9001117 TTCAGGGGCAATAACATGCACGG + Intronic
926303875 2:11623465-11623487 TTCAGGGGCAGCAACACTCATGG - Intronic
926390604 2:12387446-12387468 TTCAGGGGCAATCACACACATGG + Intergenic
928144519 2:28760024-28760046 TTCAGGGGCAGTAACATGCATGG - Intronic
928221982 2:29411222-29411244 TTCAGGGGCAATAACATGAATGG + Intronic
928736883 2:34301366-34301388 TTCAGGGGCAGTGGCATGCATGG + Intergenic
928874496 2:36021692-36021714 TTCAGGGGCAGTAGCAAGTATGG - Intergenic
928933236 2:36647131-36647153 TTCAAGGGCAATAGCACCCATGG - Intergenic
928956157 2:36870837-36870859 TTCAGGGGCAGTCACAGTCATGG - Intronic
928981858 2:37144457-37144479 TTCAGGAGCAATAACATACATGG - Intronic
929050994 2:37836764-37836786 TTCATGGCCAGTAAAACTCATGG + Intergenic
929219263 2:39446725-39446747 TTTAGGGACAATAACACACATGG - Intergenic
929240085 2:39645242-39645264 TTCAGGGGCAGTAACAAGCATGG + Intergenic
929514325 2:42592723-42592745 TTCAGGAACAGTAACACACACGG + Intronic
929621839 2:43363012-43363034 TTCAGAGGCAATAACACGCATGG + Intronic
930144570 2:47988553-47988575 TTCAGGGGCAATAACACACATGG - Intergenic
930483203 2:51975793-51975815 TTGGGGGTCAGTAAAACACATGG + Intergenic
930535447 2:52640211-52640233 TTCGGGGGCAATAACATGCATGG - Intergenic
930652787 2:53979149-53979171 TTCAAGGGCAATAACACGCATGG - Intronic
930892800 2:56410749-56410771 TTCAGGAGCAGTAACACCCAGGG + Intergenic
931024742 2:58097985-58098007 TTCAGGGGCAATAACATGCATGG - Intronic
931193309 2:60026412-60026434 TTCAGGGACAATAACACCCGTGG + Intergenic
931553224 2:63470227-63470249 TTGAGTGGCAGCAACACAGATGG - Intronic
931949592 2:67347646-67347668 TCCAGGGGCAGTAACATGCATGG + Intergenic
932585733 2:73027158-73027180 TTCAGGGACAGTAACACGCCGGG - Intronic
933131652 2:78680187-78680209 GTCAGGGGCAATAACACACATGG - Intergenic
933374098 2:81456983-81457005 TTCAGAGGCAATAACATAAATGG - Intergenic
933976838 2:87518777-87518799 TTCAGGGCCGATCACACACATGG - Intergenic
934029619 2:88031183-88031205 TTCAGGGGCAGTAACATGCATGG - Intronic
934486007 2:94711542-94711564 TTCAGGGGCAATAACATGCATGG + Intergenic
934544357 2:95202534-95202556 TTCAAGGGCAATAACAGGCACGG - Intergenic
935391483 2:102557965-102557987 TTCAGGGGCTGTTGGACACAGGG - Intergenic
935423599 2:102896105-102896127 TTCAGGGGCAATAACATGCATGG - Intergenic
935441351 2:103100435-103100457 TTCAGGGGCAATATCACCCAAGG + Intergenic
935716243 2:105941601-105941623 TTGAGGGACAGTAACACGCATGG + Intergenic
935818671 2:106871742-106871764 TTCAGGGGCAGTAACACGCATGG + Intronic
936143543 2:109962690-109962712 TTCAGGGGCCATAACACTTATGG + Intergenic
936180226 2:110260653-110260675 TTCAGGGGCCATAACACTTATGG + Intergenic
936201145 2:110408776-110408798 TTCAGGGGCCATAACACTTATGG - Intronic
936316978 2:111432027-111432049 TTCAGGGCCGATCACACACATGG + Intergenic
936326622 2:111510827-111510849 TGCAAGGGCGATAACACACATGG - Intergenic
936579554 2:113685966-113685988 TTCAGGGTCAGTAACATGGACGG - Intergenic
937121522 2:119442672-119442694 TTGAGGGGCAGAAACACTCAGGG + Intronic
937282669 2:120731038-120731060 TACAGGGACAGTTACACAAAGGG - Intergenic
937725592 2:125161453-125161475 TTCAGGGACAATAACACACATGG - Intergenic
937824225 2:126347745-126347767 TTCAGGGGCAATAGCATGCATGG + Intergenic
937890152 2:126932399-126932421 TTCAGAAGCAATAACTCACACGG + Intergenic
938886865 2:135658942-135658964 TTCAGAGGCAGTAACACACGTGG + Intronic
939037656 2:137151451-137151473 TTTAGGGGCAATAACACACATGG + Intronic
939330220 2:140749630-140749652 TTCAGGGGCAATAACACACATGG + Intronic
939694596 2:145308929-145308951 TTCAGGGGCAATAACACGCAGGG - Intergenic
939866428 2:147478090-147478112 TTCAGCGGCAATAACATGCATGG + Intergenic
939929834 2:148219277-148219299 CTCAGGGGCAGTAACCCACACGG + Intronic
940023008 2:149175856-149175878 TTCAGGGGCAATAACATGCATGG + Intronic
940038602 2:149335230-149335252 TTCAGGGGCAATAACACGCATGG - Intronic
940066072 2:149631332-149631354 TTCAAGGGCAATAACAAGCATGG + Intergenic
940113165 2:150177654-150177676 TTCAGGGACAATAGCATACACGG - Intergenic
940227868 2:151419101-151419123 TTCAGGGGCAGTAACATGCATGG + Intronic
940283646 2:152012194-152012216 CTCAGGGGCAGTAACCCACATGG - Intronic
940697579 2:156998731-156998753 TTCAGGGGCAGTAACACTCAAGG + Intergenic
941875842 2:170432242-170432264 CTATGGGGCAATAACACACAGGG - Intronic
942151444 2:173079789-173079811 TTCAGGGGCAGTAATGTATATGG + Intronic
942264824 2:174212822-174212844 TTCAGGGGCAATAACACCCATGG + Intronic
942266920 2:174237307-174237329 TTCAGGGGCAATAACACACATGG + Intronic
942493502 2:176513725-176513747 TTCAGGGGCAGTAACACCCATGG + Intergenic
942819159 2:180090576-180090598 TTCAGGGACAATAATACACTTGG - Intergenic
942913350 2:181272740-181272762 TTCAGGAGCAATAACATGCATGG - Intergenic
942920575 2:181368486-181368508 TTCAGGGGCAAAAACAGGCATGG - Intergenic
943217317 2:185055103-185055125 TTCAGGGGCAATAACACACACGG - Intergenic
943346188 2:186739617-186739639 TTCAGGGGCAGCAGCATGCATGG + Intronic
943404051 2:187457046-187457068 TTCAGGGGCAATAATACGCATGG + Intergenic
943618882 2:190125004-190125026 TTGAGGGGCAGTAACACACATGG + Intronic
943741974 2:191419647-191419669 TTCAGGGGTAATAATACACATGG - Intronic
944009889 2:194962032-194962054 TTCAGGGGCAATAGCATGCATGG - Intergenic
944879439 2:203996564-203996586 TTCAGGGGCAATAACACTCATGG + Intergenic
945197243 2:207248417-207248439 TTCAGGGGCAATAACACGCATGG - Intergenic
945292538 2:208140048-208140070 TTCACGGGCAAAAACACACATGG + Intergenic
945433076 2:209787941-209787963 TTCAGGGGCAATAACACACATGG - Intronic
945906017 2:215594178-215594200 TTCAGGGGCAATAACATGCATGG - Intergenic
946816405 2:223582957-223582979 TTCAGGGGCAATAACATGCATGG - Intergenic
946983025 2:225239278-225239300 TTCAAGGGCAGTAACAACCCAGG + Intergenic
947550789 2:231044796-231044818 TTCAGGGACAATAACACACATGG + Intronic
948724635 2:239926706-239926728 TTCAGGAGCAGTAGCACACATGG - Intronic
948735347 2:240000273-240000295 TTCACGGGCAGTAACACGCGTGG - Intronic
1168917756 20:1505268-1505290 TACAGGGACAGGAACACAAAGGG + Intergenic
1168982250 20:2015908-2015930 TTCAGGGGCAATAACACGTGTGG - Intergenic
1169057879 20:2638584-2638606 TTCAGGGGCAATAACACACATGG - Intronic
1170120333 20:12904741-12904763 TTCAGGGGCAATAATACTCACGG - Intergenic
1170334838 20:15257899-15257921 TTCAGGGGCAATAACACGCAGGG - Intronic
1170515460 20:17125133-17125155 TTTAGGGGCAATAACAGGCATGG + Intergenic
1170751902 20:19156277-19156299 TTCAGGGGCAATAACAGGCATGG + Intergenic
1170881489 20:20300372-20300394 TTCAGAGGCAATAACACACGTGG - Intronic
1171039859 20:21751136-21751158 TTTTGGGGCAATAACACACATGG + Intergenic
1171263798 20:23754096-23754118 TACAGGTGCAGTACCACACCTGG - Intergenic
1172214132 20:33222983-33223005 AACAGGGGCAGTACCTCACAGGG - Intronic
1174078705 20:47956154-47956176 TTCACGGACAGAAACACAAAGGG + Intergenic
1174491129 20:50896700-50896722 TTCAGGAACAGTAACACACATGG + Intronic
1174491455 20:50899650-50899672 TTCAGGAGCAGTAACACGCATGG - Intronic
1174678253 20:52378520-52378542 TTCAGGGGCAGTGTCATTCAAGG + Intergenic
1175515501 20:59567405-59567427 CCCAGGGCCAGAAACACACATGG - Intergenic
1175652974 20:60744194-60744216 TTCAGGGGCAGTAACACCCATGG - Intergenic
1175843085 20:62042872-62042894 TTCAGGGGCAGTAACACACATGG - Intronic
1176068014 20:63209826-63209848 TTCAGGGGCAACAACACACATGG + Intronic
1177572265 21:22902589-22902611 TTCAGGGGCAATAACAGGCATGG - Intergenic
1178946815 21:36955159-36955181 TTCACGGGCAGTAACGTGCATGG - Intronic
1178962042 21:37073817-37073839 GACAGGGGCAGTAACACAAAGGG - Intronic
1179196919 21:39172657-39172679 TTCAGGGACAGTAACACACATGG + Intergenic
1180072246 21:45442409-45442431 CTCAGGGGCAGGGACACCCATGG - Intronic
1180129314 21:45816642-45816664 CTCAGGGGCAGTAACAGGCGTGG + Intronic
1180684553 22:17655203-17655225 TTCAGAGGCAGTAACACCCATGG + Intronic
1180963960 22:19776096-19776118 TTCAGGGGCACTAGCAGCCATGG - Intronic
1182163638 22:28149659-28149681 TTCAGGGGCTATAACACACATGG + Intronic
1182675755 22:32038223-32038245 TTCAGGGGCAATAACACACAAGG - Intergenic
1182869227 22:33631581-33631603 CTCAGGGGCATTAACACACATGG + Intronic
1183141697 22:35947531-35947553 GTAATGGCCAGTAACACACATGG - Intronic
1184082218 22:42230700-42230722 TTTAGGGTCAGTAACACACATGG - Intronic
1184269392 22:43370196-43370218 ATCTGGGGCCGTAACTCACACGG + Intergenic
1184752606 22:46496752-46496774 TTCAGAGGCAGCAGCACACAGGG + Intronic
1184803771 22:46778584-46778606 TTCGGGGGCAATAACATGCATGG + Intronic
1184824384 22:46937687-46937709 TTCAGGGACAACAGCACACAGGG - Intronic
1184864930 22:47197101-47197123 TTCTGGGGCAGCCAGACACAGGG + Intergenic
949132214 3:517384-517406 TCCCGGGGCAATAACATACATGG - Intergenic
949252177 3:1998649-1998671 TTCAGGGACAGTAACACACATGG + Intergenic
949849556 3:8409247-8409269 TCCAGGGGCAGTAAGACACATGG - Intergenic
950474924 3:13209135-13209157 TTCAGGGGCAGGGACACATGTGG + Intergenic
950537245 3:13586056-13586078 TTAAGGGGCAGTAACATGCAGGG - Intronic
950705363 3:14776210-14776232 TTCAGGGGCTGAAACACAAGAGG + Intergenic
951444300 3:22760103-22760125 TTCAGGGACAATAACACACATGG - Intergenic
951475153 3:23097200-23097222 TTCAGGGACAATAATACGCATGG - Intergenic
951527386 3:23666702-23666724 TTCAGGGGCAGTAATATGCATGG + Intergenic
951943319 3:28106499-28106521 TTCAGGGGCAATAACACACATGG - Intergenic
951999067 3:28764120-28764142 TTCAGGGGCAGTAACAAGCAAGG - Intergenic
952072540 3:29655809-29655831 TTTAGGGGCAATAACATACATGG - Intronic
952114276 3:30160363-30160385 TTCAGGGGCAGTAACATCCATGG - Intergenic
952426492 3:33180217-33180239 TTCAGGGGCAGTAAGACACATGG - Intronic
952502332 3:33975336-33975358 TTCAGTGGCAATAACATGCAAGG + Intergenic
952588052 3:34917136-34917158 TTCAGGATCAGTAACACACATGG + Intergenic
952726344 3:36589849-36589871 TTCTGGGGCAATAACATGCATGG + Intergenic
952975372 3:38689980-38690002 CTTAGGGGCAGTAGCACTCATGG - Intergenic
953066556 3:39477704-39477726 TTCAGGGACTATAACACACATGG - Intronic
953497675 3:43402533-43402555 TGCTGGGGAAGTAACCCACAAGG - Intronic
953517550 3:43610253-43610275 TTCAGAGGCAGTAACACACATGG + Intronic
953678663 3:45023209-45023231 TTCAGGGACAGTCACACACATGG + Intronic
954174176 3:48830342-48830364 TTTAGGGGCAAAAACACACATGG + Intronic
954221420 3:49156753-49156775 TTTAGGGGCAGTAATATGCATGG - Intergenic
954585032 3:51726518-51726540 GTCAGGGGCAATAACACACATGG - Intergenic
954730989 3:52661699-52661721 TCCAGAGGCAGAAACACACCTGG + Intronic
954975841 3:54693648-54693670 TTCAGGGGCAATAACAGGCATGG - Intronic
955138443 3:56244486-56244508 TTCAGGGGCAGTAACACGCATGG - Intronic
955308264 3:57856563-57856585 TTCAGGGGCAGTAACATGCATGG + Intronic
955371720 3:58357394-58357416 TTCTGGGGCAATAACACACATGG + Intronic
955578302 3:60390588-60390610 TTTAGGGACAGTAACAGGCATGG - Intronic
956210945 3:66800768-66800790 TTCAGTGGCAATAACATGCAGGG - Intergenic
956247075 3:67195898-67195920 TTCAGGAGCAGTAACATGTATGG - Intergenic
956427354 3:69150314-69150336 TTCAAGGGCAGTAACACACATGG - Intergenic
956712877 3:72053688-72053710 TTCAGGGGCAATAATACACATGG - Intergenic
956889506 3:73598303-73598325 TTCAGAGGCAGAAAAACAAAAGG + Intronic
956896058 3:73661108-73661130 TTCAGGGGCAAGAACACGCATGG + Intergenic
956955226 3:74330702-74330724 TGCAGGGGCAATAACATGCATGG - Intronic
956963251 3:74428359-74428381 TTCAGGGGCAATAACATGCATGG - Intronic
957268406 3:77997639-77997661 TTCAGGAGCAATGACACACATGG - Intergenic
957275592 3:78087046-78087068 TTCAGGGGCAATAACACACATGG + Intergenic
957439621 3:80226972-80226994 TTCAGGAGCAATAAGACCCATGG - Intergenic
957460482 3:80512061-80512083 TTCAGGGGCAATAACGCTCATGG - Intergenic
957474708 3:80708425-80708447 TCCAGGAGCATTAACACACATGG + Intergenic
957484756 3:80844826-80844848 TTCAGGGGCAGTAACACGCATGG - Intergenic
957552509 3:81725415-81725437 TTCAGGAGCAGTAACACACATGG + Intronic
957592143 3:82213139-82213161 TTCAGGGGTAACAACACGCATGG - Intergenic
957638129 3:82814095-82814117 TTCAGGAGAAATAACACGCACGG + Intergenic
957701529 3:83721716-83721738 TTCAGGTGCAGTAACATGCATGG + Intergenic
957820738 3:85370796-85370818 TTCAGGGGCAATAACATGCATGG - Intronic
958596131 3:96226171-96226193 TTCAGGAGCAATGACACTCATGG - Intergenic
958598659 3:96264419-96264441 TTCAGGAGCAATAATACACGTGG - Intergenic
958882937 3:99693404-99693426 TTCAGGGACAGTAATACACATGG - Intronic
958948468 3:100391367-100391389 TTCAAGGGCATTAACATGCATGG - Intronic
959340196 3:105119458-105119480 TTCAGGAGCAGTAACACACATGG - Intergenic
959386836 3:105719828-105719850 TTCAGGGGCAGTAACACACGTGG - Intronic
959569936 3:107872446-107872468 TTCAGGGGCAGTAACACACACGG + Intergenic
959636011 3:108571103-108571125 TTCAGGGGCAGTAACACACAGGG + Intronic
959657823 3:108830001-108830023 TTCAAGGGCAATGACACACATGG - Intronic
960091157 3:113639882-113639904 TCCACGGGCAATAACACACAGGG + Intergenic
960135917 3:114104903-114104925 TTCAGGGGCAATTACATGCATGG - Intergenic
960138272 3:114127424-114127446 TTCAAGGGCGATAACACACAGGG + Intergenic
960346008 3:116534138-116534160 TCCAAGGGCAGCAAGACACATGG + Intronic
960357043 3:116666322-116666344 TTCAGGGGCCATAACCCACATGG + Intronic
960560971 3:119083956-119083978 TCCTTGGGCAATAACACACAGGG - Intronic
960567510 3:119149404-119149426 TTCAGAGGCAATAACATGCATGG + Intronic
960601731 3:119465603-119465625 TTCAGGGTCAAGAACACACATGG - Intronic
961023880 3:123534701-123534723 TTCGGAGGCACTAACACACATGG - Intronic
961098655 3:124179400-124179422 TTCAGGGGCAATAACACACATGG + Intronic
961204550 3:125071210-125071232 TTCAGGGGCAATAATACACATGG + Intergenic
961398283 3:126613973-126613995 CCCAGGGGTAGTAACACACATGG - Intronic
961595529 3:128013102-128013124 TTCAAGGACAGTAACACTAATGG - Intergenic
961616999 3:128190267-128190289 TTCAGAGGCAGTAACATGCATGG - Intronic
961994290 3:131224663-131224685 TCTAGGGGCAGTAACACACACGG - Intronic
962089177 3:132224966-132224988 TTCAGGAGCAATAACATGCACGG - Intronic
962256646 3:133874934-133874956 TTCAAGGGCAGTAACACACACGG + Intronic
962441413 3:135421310-135421332 TTCAGGGACAATAACATGCATGG + Intergenic
962700196 3:137990556-137990578 TTCAGGAGCAATAACACTCATGG + Intergenic
962828018 3:139116597-139116619 TTCAGGGGCAGTAACATGCATGG + Intronic
962885597 3:139623338-139623360 TGCAGGGGCAGAAACATGCATGG + Intronic
963134998 3:141894696-141894718 TTCAGGGGCAGCAACACGCATGG + Intronic
963144548 3:141979484-141979506 TTCAGGGGCAGTAACACACATGG - Intronic
963216030 3:142749472-142749494 TTCAGGGGTAATAACATGCATGG - Intronic
963258129 3:143166845-143166867 TTCACGGGCAATAACACACATGG - Intergenic
963377100 3:144481628-144481650 TTCAGGGGCAATAACACAAATGG - Intergenic
963608559 3:147436305-147436327 TTCAGGGGCAGTAACATGCACGG + Intronic
963886530 3:150588961-150588983 TTCAGGGGCAATAACACACATGG - Intronic
964147165 3:153478423-153478445 TTCAGGGGCAATAACACGCATGG + Intergenic
964201944 3:154127502-154127524 TTCAGGGACAGTAACATACATGG + Intronic
964229455 3:154446917-154446939 TTTAGGGGCAATAACATGCATGG - Intergenic
964423101 3:156525244-156525266 TTCAGGGGCAGTAAAACACATGG - Intronic
964592616 3:158382208-158382230 TTCAGGGGCAATAACATCCATGG + Intronic
964600419 3:158494830-158494852 TTTAGGGGCAATAACATGCATGG + Intronic
964965534 3:162488105-162488127 TTCAGAGGCAATAACATGCATGG + Intergenic
964987258 3:162759174-162759196 TGCAGGGGCAATAACATGCATGG - Intergenic
965066882 3:163860770-163860792 TTCAGGGGCAATAACAGGAATGG - Intergenic
965258461 3:166446915-166446937 TTCAGGGGGCGTAACACAAATGG + Intergenic
965364991 3:167787177-167787199 TTCAGGGGCAATAACACCCATGG + Intronic
965555505 3:170014176-170014198 TTCAGGGGCAAAAACATCCATGG - Intergenic
965990599 3:174812650-174812672 TTCAGGGGCAATAGCATGCATGG - Intronic
966025039 3:175268832-175268854 TTCAGGGACAGTAACATGCATGG + Intronic
966392780 3:179470319-179470341 TTCAGGGGCAATAACACACAAGG - Intergenic
966438490 3:179917234-179917256 TTCTGGGGCAATAACATGCATGG + Intronic
966499069 3:180617479-180617501 TTCAGGGTCAGTAACATGAATGG - Intronic
966687169 3:182708750-182708772 TTCAGGGGCAGGAACTGAGAGGG - Intergenic
966950766 3:184815080-184815102 TTTAGAGGCAGTAACACATAGGG + Intronic
967127710 3:186439929-186439951 TTCAGGGGCAATAACAAGCGTGG + Intergenic
967547952 3:190753862-190753884 TTGAGGGGCAGTAATGCAAATGG + Intergenic
968057058 3:195699793-195699815 TTCAGGGGCAATAACACACATGG + Intergenic
968723327 4:2224279-2224301 TTCAGAGGCACTAATACATATGG + Intronic
969210022 4:5680081-5680103 TTCAGAGGCAATAACAGGCATGG + Intronic
969906314 4:10399550-10399572 TCCAAGGGCAATAACATACATGG + Intergenic
969928330 4:10606328-10606350 GTCAGGGGCAATGACACGCATGG + Intronic
970551049 4:17181418-17181440 CTCCGGAGCAGTAACACACATGG - Intergenic
970634909 4:17998570-17998592 TTCAGGGGCAATAATAGGCATGG + Intronic
970820520 4:20206121-20206143 TTCCAGGGCAGTAACACACATGG + Intergenic
970845901 4:20536991-20537013 TTCAGGGGCAATAACATGCAAGG + Intronic
971047671 4:22823581-22823603 TTCAGGGGCCCTAACAGGCATGG - Intergenic
971213239 4:24640057-24640079 TTCAGGGGCCATGAGACACAGGG + Intergenic
971791292 4:31173135-31173157 TTCATGGGCAGTAACACTCATGG - Intergenic
971822964 4:31583051-31583073 TTCAGGGGCAGTAACACACAAGG - Intergenic
971949319 4:33324019-33324041 TTCAGGGACAATAACATACATGG + Intergenic
972001372 4:34039571-34039593 TTCAGGGTTAATAGCACACATGG + Intergenic
972004366 4:34080424-34080446 TTCAAGGGCAGTAACACACATGG + Intergenic
972030315 4:34448535-34448557 TTCAGGGGCAATAACACCAATGG - Intergenic
972160514 4:36220653-36220675 TTCAGGGACAGTTACATGCATGG - Intronic
972680030 4:41296482-41296504 TTCAGGGTCAATAACACGCATGG - Intergenic
972748619 4:41966598-41966620 TTCAGGGGCGGTAACATGCATGG - Intergenic
972878389 4:43394300-43394322 TTCAGGGGCAATAACATGCATGG - Intergenic
973561977 4:52146077-52146099 TTCAGGGACAGTAACAGGCATGG - Intergenic
973576347 4:52293542-52293564 TTCAGGGACAATAACACTCATGG + Intergenic
973952442 4:56030159-56030181 TTCAGGGGCAATAACATTTACGG + Intronic
974516357 4:62918255-62918277 TTCAGGGACAATAACATACAGGG + Intergenic
974679250 4:65139746-65139768 TTCAGGGGCAATAACATGCATGG - Intergenic
975077615 4:70231818-70231840 TTCAGGGGCAGTTAGACATGTGG - Intronic
975200776 4:71585859-71585881 TTCAGGGGCAATTACATACATGG - Intergenic
975278571 4:72533339-72533361 TTCAGAGGCAATAACATGCACGG + Intronic
975389754 4:73802480-73802502 ATCAGGGGCAGAAACCTACATGG - Intergenic
975601887 4:76109376-76109398 TTCAGGGGTAGTAACGTGCATGG + Intronic
975878841 4:78877530-78877552 TTTAGGGGCAATAACAGGCATGG + Intronic
976630848 4:87234791-87234813 TTCCGGGGCAATAACCCACATGG - Intronic
976651768 4:87442826-87442848 GTCAGGGGCAGTAATATGCATGG + Intronic
976834358 4:89353674-89353696 TTCAGGGATGGTAACACCCATGG + Intergenic
976896145 4:90114688-90114710 TTCAGGGACAATAACATGCATGG + Intergenic
977388604 4:96378631-96378653 TTCAGAGGCAATTATACACATGG + Intergenic
977402608 4:96552372-96552394 TTCAGGGACAATAACACGTATGG + Intergenic
977741549 4:100490034-100490056 TTCAAGGGCAATAACATTCATGG - Intronic
977841006 4:101704638-101704660 TTCAGGGGCAGTAACTTGCATGG + Intronic
977933427 4:102773777-102773799 TTCAAGTGCAATAACACACCTGG - Intergenic
978047864 4:104154438-104154460 TTCAGTGGCAGTAACACATGTGG - Intergenic
978292314 4:107156210-107156232 TTCAGGGCCAGTAACACACACGG - Intronic
978484800 4:109240011-109240033 TTCAGGGGCAATGACACATACGG + Intronic
978715466 4:111837511-111837533 TTCAGGGGTAATAACACACATGG - Intergenic
978780650 4:112549870-112549892 TTTAGGGGCACTAGGACACATGG - Intronic
978824475 4:113004506-113004528 TTCAGGGGCAGTAACACACATGG + Intronic
978998635 4:115188462-115188484 TTCAGGGGCAATAACACACATGG + Intergenic
979365966 4:119824004-119824026 TTCAGTGGCAATAACATTCATGG + Intergenic
979504042 4:121474278-121474300 TTCAGGGGCAGTAACACGCATGG + Intergenic
979681104 4:123460839-123460861 TTCAGGGGCAATAACACGCATGG - Intergenic
979811170 4:125038076-125038098 AGCAGGGGCAGAAGCACACAGGG + Intergenic
979844038 4:125485549-125485571 TTCAGGGACAATAACACAGATGG + Intronic
980069752 4:128231026-128231048 TTCAGGGGCAATGAAACACAAGG - Intergenic
980139962 4:128902970-128902992 TTCAGGAGTAATAACACACATGG + Intronic
980251768 4:130324959-130324981 TTCAGGGACAATAACACTCATGG + Intergenic
980550730 4:134330651-134330673 TTCAGGGGCAGCAACATACATGG - Intergenic
980867611 4:138571816-138571838 TTCAGGGGAAATAACATGCATGG + Intergenic
981037007 4:140182181-140182203 TTCAGGGGAAATAACACACAGGG - Intergenic
981125481 4:141101435-141101457 TTCAGGGGCAATAACATGCATGG + Intronic
981166655 4:141566648-141566670 TTCAGGGACAATAACATTCAAGG + Intergenic
981173857 4:141657720-141657742 TCCAGGGGCAGTAACACACATGG + Intronic
981202792 4:142001300-142001322 TCCAGGGGAAATAACACACATGG + Intergenic
981676358 4:147347730-147347752 CCCAGGGGCAGTAACACCCACGG - Intergenic
981811316 4:148778897-148778919 TTCAGGGGCAATAACATGCATGG + Intergenic
981943179 4:150308610-150308632 TTCAGGGGCAAGAACACGCATGG - Intronic
982027874 4:151269958-151269980 TTCAGGGGCAATAACATGTATGG + Intronic
982142718 4:152342584-152342606 TTCAGGTGCAGTACTACCCAAGG - Intronic
982154560 4:152505646-152505668 TTCAGAGGCAATCACACACATGG + Intronic
982277310 4:153649611-153649633 TTCAGGGGCAATAACACGCACGG + Intergenic
982345750 4:154356082-154356104 TTCAGAGCCAGTAACACACATGG - Intronic
982561608 4:156934881-156934903 TTCAGGGGCAATAATAGGCATGG + Intronic
982583238 4:157205547-157205569 TTCAGGGACAATAACACACACGG + Intronic
982941324 4:161560748-161560770 TTCAGGGGCAATAACACACATGG + Intronic
983464963 4:168075735-168075757 TTCATGGGCATTGACACTCAGGG - Intergenic
983474862 4:168201490-168201512 TTCAGGGGCAATAATACACATGG + Intergenic
983483459 4:168304219-168304241 TTCAGGGGCAGTAACACACATGG - Intronic
983578198 4:169281537-169281559 TTCAGGGGTAATAGCACACATGG - Intergenic
983581427 4:169313301-169313323 TGCAGGGACAGAGACACACAGGG + Intergenic
983776747 4:171617171-171617193 TTCAGGGGCAATAACAGGCATGG + Intergenic
984787086 4:183577459-183577481 TTCAGGGGAAGTAACAGGCATGG - Intergenic
984970394 4:185183779-185183801 TTAAGGCGCAGGAACAAACATGG - Intronic
985138071 4:186809255-186809277 TTCAGGGGCGATAACACGCATGG + Intergenic
985796420 5:1965432-1965454 TTCAGGGGCAATGACAGGCATGG + Intergenic
986285746 5:6357300-6357322 TTCAGGGGCAGTGACACGCATGG - Intergenic
986771236 5:10975796-10975818 TTCAGGAGGAGTCACTCACAAGG + Intronic
987475770 5:18391081-18391103 TTCAGGGGCAATAACACAGATGG + Intergenic
987484403 5:18506300-18506322 TTCTAGGGTAGTAACACACATGG - Intergenic
987646804 5:20683772-20683794 TTCAGAGGCAGTAAGATTCATGG - Intergenic
987725028 5:21687202-21687224 TTCAGGTGCAATGACATACATGG - Intergenic
987766392 5:22236861-22236883 TTCAGGGGCAGTAATATGCATGG + Intronic
987886991 5:23825833-23825855 ATCAGAGGCAATAACACTCAAGG + Intergenic
988045625 5:25948960-25948982 TTCCAGGGCAATAACACATATGG + Intergenic
988135376 5:27164025-27164047 TTCAGGGACAGTAACATGCATGG - Intergenic
988170398 5:27647149-27647171 TTCAGGGATAATAACACACATGG + Intergenic
988186449 5:27870346-27870368 TTCAGGGGCATTAACACACTGGG - Intergenic
988226343 5:28416668-28416690 TTCAGGGGCAATAACATGCATGG + Intergenic
988272846 5:29039484-29039506 TTCAGAGGTAGTAACACCCGAGG + Intergenic
988661499 5:33274847-33274869 TTCAGGGGGAATAACATACATGG + Intergenic
988793042 5:34626574-34626596 TTCTGGGGCAATAACATGCATGG - Intergenic
988831453 5:34991215-34991237 TTCAAGGGCAATAACAGGCATGG - Intergenic
988960095 5:36361612-36361634 ATCAGGGGCAATAACATGCATGG + Intergenic
989082007 5:37632433-37632455 TTCAGAGGTAATAACACACATGG - Intronic
989761042 5:45017086-45017108 TTCAGGGGCAATAACACATATGG - Intergenic
990190215 5:53251331-53251353 TTCAGGAGCAATAACACGCATGG + Intergenic
990813930 5:59761676-59761698 TTCTGGGGCAATAACATGCATGG + Intronic
990847478 5:60159207-60159229 TTTAGGGGCAATAACACACATGG + Intronic
990854665 5:60250887-60250909 TTCAGGGGCAATAACATGCAAGG - Intronic
991065423 5:62419557-62419579 TTCGGGGGCAATAACATTCATGG + Intronic
991375911 5:65966790-65966812 TTCAGGGGCAACAACACAACCGG - Intronic
991677949 5:69107271-69107293 TTCAGGGGCAGTAACATGCAAGG + Intronic
992501018 5:77344007-77344029 CTCAGGGGCAATAACACACATGG + Intronic
992705931 5:79392299-79392321 TTCAAGGGCAATAACAGGCATGG - Intronic
992901787 5:81303554-81303576 TTCAGGGGCAGTAACATGAATGG + Exonic
992943130 5:81782699-81782721 TTCAGGGGCAATAACAGTCATGG + Intergenic
993088554 5:83395384-83395406 TTCAGGGGCAATAACATACATGG + Intergenic
993461243 5:88185001-88185023 TTCAGGGGCAGTAACAAGCATGG + Intergenic
993469784 5:88293380-88293402 TTCAGGGGCAACAACACACAGGG - Intergenic
993567626 5:89494417-89494439 TCAAGGTGCAATAACACACATGG - Intergenic
993709246 5:91207416-91207438 TTCAGGGGCAGTAACACTCATGG + Intergenic
993853395 5:93039459-93039481 TTCAGGGGCAATAACACGCATGG - Intergenic
993894238 5:93512136-93512158 TTCAAGGGCAATAACATGCATGG - Intergenic
993954899 5:94220262-94220284 TTCTGGGGCAATAACACACATGG + Intronic
994165455 5:96603529-96603551 TTCAGGGGCAATAACACCCACGG + Intronic
994455667 5:100004044-100004066 TTCAGGGGCAATAACACATATGG - Intergenic
994680297 5:102878591-102878613 TTCAGGGGCAATAACATGCATGG - Intronic
994819971 5:104636970-104636992 TTCAGGTGCAATAGCACACATGG - Intergenic
995720559 5:115127899-115127921 TTCTGGGGCAGTAACATACATGG - Intronic
996225762 5:120994001-120994023 TTCAGGAGCAATAATAAACATGG + Intergenic
996436637 5:123440633-123440655 TTCAGGGTCAATTACACACATGG + Intergenic
996583253 5:125055171-125055193 TCCAGGTGCAGTAACACTCATGG + Intergenic
996677069 5:126188537-126188559 TTCAGTGGCAGAAACACTGAAGG + Intergenic
996926408 5:128832155-128832177 TTCAGGGGCAAAAACACATATGG - Intronic
997065585 5:130555519-130555541 TGCAGGGGCAGAGACCCACATGG - Intergenic
997173418 5:131748877-131748899 TTTAGGAGTAATAACACACATGG - Intronic
998067001 5:139167353-139167375 TTCAGGGGCAATCACACACTTGG - Intronic
998212760 5:140213127-140213149 TTCAGGGGTAATAACATACATGG - Intronic
998615847 5:143739639-143739661 TTCAGGGGCAATAACATTCATGG + Intergenic
998927665 5:147144208-147144230 TTCAGGGCCAGTAGCCCATATGG - Intergenic
998981166 5:147704048-147704070 TTCAGGGGCAATAACATGCATGG + Intronic
999077573 5:148811448-148811470 TTTAAGGGCAATAACACCCAGGG + Intergenic
999215213 5:149927964-149927986 TTCAGGGGCAAAAACACGCATGG + Intronic
999629684 5:153557817-153557839 TTCAGTGGCAATAGCACGCATGG + Intronic
999916003 5:156261718-156261740 TTCAAGGGCAATAACATACTTGG - Intronic
1000397434 5:160790619-160790641 TACAGGTGCAATAACACAAAGGG - Intronic
1000695160 5:164371659-164371681 CTTAGGGGCAATAACACACATGG - Intergenic
1000709286 5:164550674-164550696 TTCAGGGGCAATAACACGCATGG + Intergenic
1000769751 5:165338145-165338167 TTTAGGGGCAATAACACGCATGG - Intergenic
1001153781 5:169255328-169255350 TTCAAGGGCAGTAACACACATGG - Intronic
1001559453 5:172659706-172659728 GTCAGGGGCAGTATCACAAAGGG - Intronic
1002344966 5:178542459-178542481 TTCAGGGGCAGAAAGGCAGAGGG - Intronic
1002972635 6:2039708-2039730 TTCAGGGGCAGTGATATGCAAGG + Intronic
1003975239 6:11336889-11336911 TTCAGGGGCAATGACATACAGGG + Intronic
1003994649 6:11527021-11527043 TTCAGGGGCAGTAACACGCATGG - Intergenic
1003996500 6:11546117-11546139 TTCAGGGGCAATGACAGGCAGGG - Intronic
1004050200 6:12070054-12070076 TTCAGGGGCAGTGACACATATGG + Intronic
1004296605 6:14417531-14417553 TTCAGGGGCGGGGACAGACAGGG + Intergenic
1004578636 6:16925264-16925286 TTCAGGGGCACAAACAGGCATGG + Intergenic
1004658289 6:17686262-17686284 TTCAGGGGCATTAACATCCATGG - Intronic
1004891304 6:20103185-20103207 TTCAGAGGCAATAACATGCATGG - Intronic
1004951325 6:20675884-20675906 TTCAGGGGCAATAATACACTTGG - Intronic
1005009956 6:21326464-21326486 TTCAGGGGCAATAACACACAGGG + Intergenic
1005124998 6:22436856-22436878 TTCAGGGGCAATAACATGCGTGG + Intergenic
1005308701 6:24538589-24538611 TTCAGGGGCAATAACACGCAGGG + Intergenic
1005776763 6:29141467-29141489 TTCAGGGGCAATAACATGCATGG + Intergenic
1006064026 6:31448566-31448588 TTCAGGTGTAATAACACGCATGG + Intergenic
1006214133 6:32424375-32424397 TTCAGGGGCCATAGCACACATGG - Intergenic
1006332418 6:33401639-33401661 TTCAGGGGCAGTAACACACATGG + Intronic
1006595334 6:35188965-35188987 TGCAGGGGCACTACCACCCAAGG - Intergenic
1007127391 6:39438404-39438426 TTCAGGGGCAGTAACACACATGG - Intronic
1007714377 6:43846532-43846554 TTCAGGGGCAGTAACAGGCATGG + Intergenic
1008001874 6:46369199-46369221 TTCAAGGGCAGTAAGAGACATGG + Intronic
1008772066 6:54991608-54991630 TTCAGGGGCAGTAACATACATGG - Intergenic
1009319656 6:62271590-62271612 TTCAGGGGCAATAACACATAGGG - Intronic
1009342618 6:62575908-62575930 TTCAGAGGCAATAACACATGCGG + Intergenic
1009410692 6:63362063-63362085 TTCAGAGGCAGTAACATGCACGG + Intergenic
1009557892 6:65198232-65198254 TGCAGGGGCAGTAACATGTATGG + Intronic
1009586279 6:65608893-65608915 TTCAGAGGAAATAACACACATGG + Intronic
1009979545 6:70710988-70711010 TTCAAGGGCAATAACACACATGG + Intronic
1010588028 6:77678804-77678826 TTCAGGGGCAATAAAATGCATGG - Intergenic
1010668431 6:78656559-78656581 TTCCAGGACAATAACACACACGG + Intergenic
1011264653 6:85502539-85502561 TTCAGGGGCAGTAACGTGCATGG + Intergenic
1011569769 6:88723147-88723169 TTCAGGGCCAGTAACACACGTGG - Intronic
1011763204 6:90590747-90590769 TTCAGGGGCAATAACACGCACGG - Intergenic
1011856343 6:91696759-91696781 TTCAAGGGCAGTAACATGCATGG - Intergenic
1012055510 6:94403570-94403592 TGCAGGGACAGTGACACACATGG - Intergenic
1012114845 6:95283949-95283971 TTCAGGGGCAGTAACATGCATGG - Intergenic
1012146472 6:95690094-95690116 TTCAGGGGCAATAACACACAAGG - Intergenic
1012152483 6:95771847-95771869 TTCAGGGGCAGTAATATACATGG - Intergenic
1012178347 6:96118736-96118758 TTCAGGGGCAATAACGTGCATGG - Intronic
1012266326 6:97148434-97148456 TTCAGGGTCAGTAACGCACATGG - Intronic
1012827143 6:104161267-104161289 TTCAGAGGCAGTTACACACATGG + Intergenic
1012926350 6:105271916-105271938 TTCAGGGCCAGTAACGCTCATGG + Intergenic
1013258454 6:108413023-108413045 CTCAGGTGCAGAGACACACATGG + Intronic
1013440908 6:110167387-110167409 TTCAGAGGCAGTAACAAGCATGG - Intronic
1013573983 6:111461186-111461208 TTCAGGGACAATTACACACATGG - Intronic
1013637819 6:112045973-112045995 TTCAGGGGCAAAAACATGCATGG - Intergenic
1013811606 6:114050741-114050763 TTCAGGGGCAATAACAGGCATGG - Intergenic
1013858376 6:114603546-114603568 TTCAGGGGCAGTAATATGCACGG + Intergenic
1013887834 6:114991538-114991560 TTCAGGGGCAATAACATGCATGG - Intergenic
1013968022 6:115979197-115979219 TTTAGGGGCAATAACACCCATGG - Intronic
1014218025 6:118771902-118771924 TTCAGGGGCAATAACATGCATGG + Intergenic
1014259676 6:119202375-119202397 TTCAGGGGCAGTAGCACGCATGG + Intronic
1014321159 6:119929716-119929738 TTCAGAGGCAGTAACACACATGG + Intergenic
1014579414 6:123118029-123118051 TTAAGGGGAAGTAACATATACGG - Intergenic
1014806930 6:125840055-125840077 CTCAGGGGCAATAACACACAGGG - Intronic
1014843985 6:126253269-126253291 TTCAGGGGCAATAACACTCATGG + Intergenic
1014928130 6:127299297-127299319 TTCAGGGGCAGTAACATGCATGG - Intronic
1015043719 6:128753667-128753689 TTCAAGGACTATAACACACACGG - Intergenic
1015424334 6:133048458-133048480 TTCAGGGGCAATAACATACATGG - Intergenic
1015520112 6:134121532-134121554 TTCAGGAGCAATAACATGCATGG - Intergenic
1015696114 6:135981663-135981685 TTCAGGGGCAATAACACACATGG + Intronic
1015721173 6:136243812-136243834 TTCAGTGGCAATAACATGCATGG - Intronic
1015914070 6:138197269-138197291 TTCAGGGTCAGTAAAATGCATGG + Intronic
1016382077 6:143494620-143494642 TTCAGGGGCAATAATACCCACGG - Intergenic
1016474688 6:144414223-144414245 TTCAGGGGCAATAACATACATGG - Intronic
1016522141 6:144958165-144958187 TTCAAGGGCAATAACAGACTTGG + Intergenic
1016635853 6:146289204-146289226 TTCAGAGGCATTAACACACATGG - Intronic
1017072191 6:150585353-150585375 CTCAGGGGCAATAACATGCATGG - Intergenic
1017204820 6:151793306-151793328 CTCAGGGACAGTAACACCCCTGG + Intronic
1017599542 6:156065529-156065551 TTCAGGGGCAATAAGAAGCATGG - Intergenic
1017600911 6:156080128-156080150 TTCAGGGGCAATGCCACACATGG - Intergenic
1017626164 6:156351357-156351379 TTCAGGGACAGGAACAGTCAAGG + Intergenic
1017655880 6:156629249-156629271 TTTAGGGGCAGTAACACACATGG - Intergenic
1017669272 6:156754743-156754765 TTCAGGGGCAGTAACACACATGG - Intergenic
1017833170 6:158151112-158151134 TTCAGGGGCAGTGACATGCATGG - Intronic
1018041609 6:159928938-159928960 CTCAGGGGCAATAACATACATGG - Intergenic
1018256141 6:161921273-161921295 TTCAGGGGCAATGACATGCATGG + Intronic
1019098954 6:169611799-169611821 TTCAGGGGCAGTGAAATGCATGG + Intronic
1020505800 7:8986433-8986455 TTCAGGGGCAATAACACACATGG + Intergenic
1020516609 7:9128917-9128939 TTCAGGGGCAATAACATGCATGG + Intergenic
1020517674 7:9143838-9143860 TTCATGGGCAATAACATACATGG + Intergenic
1020551907 7:9617304-9617326 ATCAGGGGCAATAACACACATGG + Intergenic
1020740799 7:12014643-12014665 TTCAGGGGCAATAACACAAATGG + Intergenic
1020815164 7:12896259-12896281 GTCAGGGGCATGAAAACACAAGG - Intergenic
1021615160 7:22496044-22496066 TTCAAGGGCAGTAACAGGCATGG - Intronic
1021696546 7:23281843-23281865 TTCAGGGGCAATAACACCCATGG - Intergenic
1021760385 7:23897775-23897797 TTCAGGGGCAATAACACTCATGG - Intergenic
1021830267 7:24599954-24599976 TCAGGGGGCAGTAACACCCATGG + Intronic
1021929713 7:25567975-25567997 TTCAGGGGCTAGAACACCCATGG - Intergenic
1022971778 7:35525012-35525034 TTCAGGGGCAATAACATGCATGG + Intergenic
1023223637 7:37946662-37946684 GTCAGGGCCAGTAACATGCATGG - Intronic
1023308688 7:38858968-38858990 TTCAGGGGTAGTAACGCACATGG - Intronic
1023527922 7:41124248-41124270 TTCAGGGTTGCTAACACACATGG - Intergenic
1023731397 7:43195505-43195527 TTCTGGGGCAGTAACATAAGAGG - Intronic
1023952208 7:44855559-44855581 TTCAAGGGCATTAACACATATGG + Intergenic
1024469017 7:49747704-49747726 TTCAGGGGCAATGACAGGCAGGG + Intergenic
1024923460 7:54586737-54586759 TTCAGGGCCAATAACACGCAGGG + Intergenic
1024949708 7:54847183-54847205 TTCAGGGACAATAACAGGCATGG + Intergenic
1025270727 7:57511230-57511252 TTCAGGGGCAATAACACCAATGG + Intergenic
1025613533 7:63098530-63098552 TTCATGGGCAATAAAACTCATGG + Intergenic
1026147079 7:67756480-67756502 TTCAGGGGCAGTAAGACACATGG - Intergenic
1026419895 7:70223733-70223755 TTCAGGGGCAATAACATGCATGG - Intronic
1026628001 7:72013188-72013210 TTCAGGGGCAAAAACAAAAAGGG - Intronic
1027329914 7:77081363-77081385 TTCAGGGGCAATAACACACGTGG - Intergenic
1027475435 7:78625006-78625028 TTCAGGGGCAATAATAGGCATGG - Intronic
1027839017 7:83283473-83283495 TTCAGGGGCAATAACAAGCACGG - Intergenic
1027937564 7:84629677-84629699 TTCAAGGGCAATAGCACACATGG - Intergenic
1028231254 7:88308701-88308723 CTCAGGGGCAGTAACATGCATGG + Intergenic
1028368642 7:90065015-90065037 TTCAGGGGCAATAACATACATGG - Intergenic
1028369888 7:90079222-90079244 TCCAGGGCCAGAAGCACACAAGG - Intergenic
1028377336 7:90158579-90158601 TTCAAGGGCAGTAACAGGCATGG + Intronic
1028402638 7:90441123-90441145 TTCAGGGGCAATAACAGGCATGG + Intronic
1028601317 7:92603538-92603560 TCAGGGGGCAATAACACACATGG - Intergenic
1028607104 7:92666978-92667000 TTCAGGGGCAATAACATGCATGG - Intronic
1028681730 7:93542857-93542879 GTCAGGGGCAATAAAACACATGG + Intronic
1028757858 7:94458530-94458552 TTCGGGGGCAGTAACACACATGG - Intergenic
1029318470 7:99735895-99735917 GTCAGAGGAAGTGACACACAGGG - Intergenic
1029785852 7:102789978-102790000 TTCAGGGGAAATAACACACGTGG + Intronic
1030102591 7:105959626-105959648 TTCAGGGGCAATAACACACATGG + Intronic
1030123357 7:106132151-106132173 TTCAGGGGCAGTAACATGCATGG - Intergenic
1030493034 7:110263379-110263401 TTCAGGGGCAATAACATGCACGG - Intergenic
1030573727 7:111259966-111259988 TTCAGGGGCAAAAACATGCATGG + Intronic
1030767311 7:113426639-113426661 TTCAGGGGCAATAACACGAAAGG - Intergenic
1030981936 7:116196401-116196423 TTCAGAGGCAATAACATGCATGG + Intergenic
1031226540 7:119045888-119045910 TTCAGGGGCAATAACATGCATGG + Intergenic
1031316896 7:120269857-120269879 TTCAGGGACAGTAACATGCATGG - Intergenic
1031634724 7:124088458-124088480 TTCAGGGGCAGTAACATCCATGG + Intergenic
1031640596 7:124159201-124159223 TTCAAAGACAGTAACACCCATGG + Intergenic
1031716248 7:125112280-125112302 TTCAGGGGCAATAACATGCATGG + Intergenic
1031816203 7:126439731-126439753 TTAAGGGGCAATAACACACATGG - Intronic
1031888922 7:127271784-127271806 TTCAGGGGCCATAACACCCATGG + Intergenic
1031891944 7:127304753-127304775 TTCAGGGGCAATAATACACATGG - Intergenic
1031939601 7:127774162-127774184 TTCAGGGGCAATAACACACATGG - Intronic
1032099342 7:128960427-128960449 TTCAAGGGCAGTAACACACATGG - Intronic
1032265773 7:130368907-130368929 TTCAGGGCCCGGAACACAGAAGG + Intergenic
1032501751 7:132404877-132404899 TTCAGGGGGAGTACTGCACAGGG + Intronic
1032578752 7:133083446-133083468 TTCAGAGGCAATAACACGTATGG + Intergenic
1032631332 7:133655688-133655710 TTCAGGGGCAGTAACACACATGG + Intronic
1032735091 7:134685078-134685100 TTCAGGGGCACTAACATGCATGG + Intergenic
1032857912 7:135851557-135851579 TTCAGGGGCAATAACATGCGTGG + Intergenic
1032908618 7:136403089-136403111 TTCAGGGGCAAGAGCATACATGG - Intergenic
1032929563 7:136651023-136651045 TTCAGGGGCAAAAACATGCATGG + Intergenic
1032940797 7:136788355-136788377 TTCAGGGACAATAACATATATGG - Intergenic
1033059620 7:138093567-138093589 TTCCGGAGCAATAACACGCATGG + Intronic
1033429626 7:141277437-141277459 TTCAGGGGCAATGGCACACAGGG + Intronic
1033474110 7:141674312-141674334 TCAAGGGGCTGTAACACTCAGGG + Intronic
1033480624 7:141736808-141736830 TTCAGAAGCAGTGACACACAGGG - Intergenic
1033784072 7:144708849-144708871 TTCAGGGACAGTAGCACTCATGG - Intronic
1033803579 7:144928960-144928982 TTCAGGAGCAGTAACATGCATGG - Intergenic
1034023212 7:147668470-147668492 CTCAGGGGCACTGACACCCATGG - Intronic
1034092087 7:148373042-148373064 TTCAGGGGCAGTGACACACATGG + Intronic
1034209304 7:149349051-149349073 TTCAGGGGGTGTAAGACCCAAGG - Intergenic
1034609312 7:152351062-152351084 TTCAGCGACAATAACACACAAGG + Intronic
1034709107 7:153175086-153175108 TTCAGGGACAATAACATGCATGG + Intergenic
1035048914 7:155987126-155987148 TACAGAGGCAGCAACAAACAGGG + Intergenic
1035358391 7:158293866-158293888 TTCAGGGGCAATAGCACATGTGG + Intronic
1035719060 8:1777736-1777758 TTCAGGGGCAGTAACAGACATGG + Intronic
1035917051 8:3636210-3636232 TTCAGGAGCAGTAACAGGCGTGG + Intronic
1035936382 8:3845960-3845982 CTCAGGGGCAGTAGTACCCATGG + Intronic
1036000399 8:4596087-4596109 TACAATTGCAGTAACACACAGGG - Intronic
1036083737 8:5589672-5589694 TTCACGGGCCATAACACACATGG + Intergenic
1036131599 8:6119887-6119909 TTCAGTGGCAGTGACATGCATGG + Intergenic
1036591146 8:10169388-10169410 GAAAGTGGCAGTAACACACAGGG - Intronic
1036806241 8:11836294-11836316 ATGAGTGGCAGTGACACACAGGG - Intronic
1037112644 8:15183058-15183080 TTCAGGGGCAGTAACAGGCATGG + Intronic
1037395957 8:18443476-18443498 TTCAGGGGCAATAACATGCATGG - Intergenic
1037593496 8:20333562-20333584 TTCGGGGGCAGTAACAGGCGTGG - Intergenic
1037860121 8:22399080-22399102 TTCAGGGGCAGAAAGACAAGTGG - Intronic
1037867165 8:22454338-22454360 TTCAGGGGAATTAACAGGCATGG + Intronic
1037868879 8:22472485-22472507 TTCAGGAGCAGTAACAGGCATGG + Intronic
1037870737 8:22493679-22493701 TTCAGGGGCAGTAACAGTCATGG + Intronic
1038003376 8:23409212-23409234 TTCAGGGGCGTTAACAGACATGG - Intronic
1038415813 8:27394966-27394988 TTCAGGGGCAGTAACAGACATGG + Intronic
1038628146 8:29214493-29214515 TTCAGGGGCAGTAACAGGCATGG + Intronic
1038710154 8:29936325-29936347 TTCAGGGACAGAAACATGCATGG - Intergenic
1038813171 8:30872605-30872627 TTCAGGTGCAGTAACGTGCATGG - Intronic
1038834409 8:31103133-31103155 TTTAGGGGCAGTAACACTCATGG + Intronic
1038839089 8:31162412-31162434 TTCAGGGGCAGTCATATGCATGG + Intronic
1038961894 8:32529756-32529778 TCCAGGGACAGTAACACACACGG + Intronic
1039305924 8:36262779-36262801 TTCAGGGGCAGTAACAGGCATGG - Intergenic
1040430218 8:47333154-47333176 TTCAGGGGCAGTAACACTCATGG + Intronic
1040539799 8:48342340-48342362 TTCCTGGGCAGTATCCCACAAGG - Intergenic
1040695934 8:49998704-49998726 TTCAGGGACAATAACAGGCATGG + Intronic
1040724147 8:50361263-50361285 TTCAGGGGCATTAACAGCCATGG + Intronic
1040750743 8:50703428-50703450 TTCAGGGGCAATAACACGCATGG + Intronic
1040759505 8:50821886-50821908 TTCAGGGACAATAACATGCATGG + Intergenic
1040764115 8:50886037-50886059 TGCAGGGGCAATAACAAGCATGG + Intergenic
1040896268 8:52372075-52372097 TTCAGGGGCAACAACATACGAGG - Intronic
1040902867 8:52434949-52434971 TTGCGGGGCAATAACAAACATGG - Intronic
1041426959 8:57732418-57732440 TTTAGGGGCAATAACAGGCATGG + Intergenic
1041440486 8:57890679-57890701 TTCAGGGGCAATAACAGGCATGG + Intergenic
1041503599 8:58568370-58568392 TTCAGAGGCAGTAACATGCATGG + Intronic
1041610922 8:59847908-59847930 TTCAGGGGCAATTACACACATGG - Intergenic
1041861810 8:62522555-62522577 TTCAGGGTCAATGACACGCATGG - Intronic
1041894921 8:62913042-62913064 TTCAGGGGCAATAACAGGCATGG + Intronic
1042156847 8:65853412-65853434 TTCAGGGGCAATAATACTCATGG + Intergenic
1042310749 8:67377167-67377189 TTCAGGGGCAATAACACGCATGG + Intergenic
1042406321 8:68409316-68409338 TTCAGGGGCAATAACATACATGG - Intronic
1043219573 8:77642738-77642760 GTCAGGGGCAATAACACATATGG - Intergenic
1043307223 8:78810215-78810237 TTCAGGGACAATAACATGCATGG + Intergenic
1043445135 8:80312058-80312080 TTCAGGGGCAATAACATACATGG - Intergenic
1043491857 8:80757192-80757214 TTCAGGGGCAATAACATGCATGG - Intronic
1043669896 8:82870644-82870666 TTCAAGGGCATTAACATACACGG - Intergenic
1044117406 8:88351505-88351527 TTCAGGGGTAATAACAGACATGG + Intergenic
1044189684 8:89300320-89300342 TTCAGGGGCAATAACACACATGG - Intergenic
1044246752 8:89957190-89957212 TTCTGGGGCACTAACACACATGG - Intronic
1044280808 8:90353598-90353620 TTCAGGGGCAATAACACATATGG + Intergenic
1044517999 8:93162154-93162176 TTCAGGGGCAATAACATGCATGG - Intronic
1044538055 8:93380319-93380341 TTCGGGGGCAATAACATGCATGG - Intergenic
1044660242 8:94588112-94588134 TCCAAGGGAAATAACACACATGG - Intergenic
1044872767 8:96636379-96636401 CTCAGGGGCAATAACATGCATGG - Intergenic
1044957863 8:97500270-97500292 TTCAGAGGCAATGACACACATGG + Intergenic
1045025412 8:98082055-98082077 TTCAGAGGCAGTAGCTCTCAAGG - Intronic
1045205096 8:100030476-100030498 TTCAGGGGCAGTAACATGCATGG - Intronic
1045858157 8:106788311-106788333 TTCAGGGTCAATAACACACACGG + Intergenic
1046013652 8:108579891-108579913 TTTAGGGACAATAACACACATGG + Intergenic
1046233849 8:111394613-111394635 TTCAGGGGCAATAACACGCATGG - Intergenic
1046341778 8:112868195-112868217 CTCAGGGGTAATAATACACATGG + Intronic
1046663111 8:116970268-116970290 TTTAGGGGCAATAACACACATGG + Intronic
1046890003 8:119412540-119412562 GTCAGGGGTAATAACACACATGG - Intergenic
1046982021 8:120346579-120346601 TGCAGAGGCAGAAATACACAAGG - Intronic
1047136617 8:122086004-122086026 CTTTGGGGCAGTAACACACACGG - Intergenic
1047351135 8:124075426-124075448 TTCAAGGGCACTAACACGCATGG + Intronic
1047430606 8:124788300-124788322 TTCAGGGACAATAACACGCATGG - Intergenic
1047932186 8:129739909-129739931 TTCAGGGACAATAACATGCATGG - Intergenic
1048171766 8:132113848-132113870 TTCAGGGACAATCACACACATGG + Intergenic
1048602819 8:135936515-135936537 TTCAGGGGCAATAACAGACATGG + Intergenic
1048697827 8:137048058-137048080 TTCAGGGGCAATTATACACCTGG - Intergenic
1049141260 8:140956631-140956653 TTTAGGGGCAATAACACACATGG - Intronic
1050250094 9:3734664-3734686 TTTAGGAGCTGTAACACTCACGG + Intergenic
1050285060 9:4092664-4092686 TTCAGGGGCAGTAACAAGCCTGG + Intronic
1050495836 9:6241085-6241107 TTCAGGGGCAATAACATGCATGG + Intronic
1050525938 9:6546531-6546553 TTCAGGGACAGTAACACACACGG + Intronic
1050889067 9:10800349-10800371 TTCAGGGGCAGTAATACACATGG - Intergenic
1051046228 9:12877542-12877564 TTCAGGGGCAATAACATGCATGG - Intergenic
1051063884 9:13078037-13078059 TTCATGGTCAATAACACACATGG + Intergenic
1051181472 9:14416379-14416401 TTCAGGGGCAGTAACACATGCGG - Intergenic
1051263905 9:15292623-15292645 TTCAGGGGCAGTAACATGGCTGG - Intronic
1051474905 9:17495322-17495344 TTCAGGGACAATAACACAAACGG - Intronic
1051879979 9:21830000-21830022 TTCCAGGGCAGTCACACCCAGGG - Intronic
1051943762 9:22540783-22540805 TTCAGGGGCAATAACACACATGG + Intergenic
1052011424 9:23414334-23414356 GTCAGGGGCAATAACACACATGG - Intergenic
1052148516 9:25080817-25080839 TTCAGTGGCAATAACATGCATGG - Intergenic
1052246515 9:26342126-26342148 TTCAGGGGCAGTAACATGCATGG - Intergenic
1052623181 9:30941155-30941177 TTAAAGGGCAATAATACACATGG + Intergenic
1052729522 9:32268967-32268989 TTCAGGTGCAAGAACACTCATGG - Intergenic
1052744648 9:32428392-32428414 TTCAGGGGCAATAACATCCATGG + Intronic
1053671788 9:40372785-40372807 TTCAGGGGCAATAACATGCATGG - Intergenic
1053856549 9:42344427-42344449 TTTAAGGGCTGTAACACTCACGG - Intergenic
1053920845 9:42988275-42988297 TTCAGAGGTAGTTACACTCATGG + Intergenic
1053921601 9:42999143-42999165 TTCAGGGGCAATAACATGCATGG - Intergenic
1054382903 9:64512829-64512851 TTCAGGGGCAATAACATGCATGG - Intergenic
1054512830 9:66003525-66003547 TTCAGGGGCAATAACATGCATGG + Intergenic
1054852357 9:69860864-69860886 TTCAGGGGCAGTAACATGCATGG + Intronic
1054859704 9:69937093-69937115 TTTAGGGGCAATAACAGGCATGG + Intergenic
1054978506 9:71176242-71176264 TTCAGGGGCAATAACATGCATGG - Intronic
1055179784 9:73371235-73371257 TTCAGGGGCAATAACACGCATGG - Intergenic
1055287823 9:74748464-74748486 TTCAGGGGCAATAACACACATGG - Intronic
1055393787 9:75851721-75851743 TTCAGGGGCAATAGTACACATGG + Intergenic
1055464879 9:76554855-76554877 TTCAGGGGCAATAACACTCATGG + Intergenic
1055630405 9:78217781-78217803 TTCAGGGTCAATAACATGCATGG + Intergenic
1055925086 9:81501777-81501799 ATCAAGGGCAGTATCACATAGGG - Intergenic
1056189380 9:84169858-84169880 TTCAGGGGCAAGAACATACATGG + Intergenic
1056405297 9:86268201-86268223 GTCAGGGGCAGTAACACTCATGG - Intronic
1056432037 9:86537449-86537471 TTCCGGGGCAGTAACACGCATGG - Intergenic
1056443945 9:86646490-86646512 TTCAGGGACAGAAGCACACGTGG - Intergenic
1056566845 9:87780450-87780472 TTCAAGGGCAGTAACACACAGGG + Intergenic
1056645122 9:88405009-88405031 TTCAGGTGCAATAACACATATGG + Intronic
1056748608 9:89327689-89327711 TTCAGGGACAGTAACATGCGTGG + Intronic
1056769427 9:89466088-89466110 TGAAGGGGCAGGACCACACAGGG + Intronic
1056961421 9:91127387-91127409 TTCAGGGACAGTAACACGCATGG - Intergenic
1057019744 9:91687692-91687714 TTCAGGGGCAGTAACACTCTTGG + Intronic
1057020049 9:91690258-91690280 TTCAGGGGCAATAATACGCTTGG - Intronic
1057032880 9:91790730-91790752 CTCAAGGACAGTAGCACACATGG - Intronic
1057762135 9:97884823-97884845 TTCAGGGACAATAACACACACGG + Intergenic
1057920770 9:99094892-99094914 TTCAGGGGAAGGTACACAAAAGG + Intergenic
1058281246 9:103117646-103117668 TTCAGGGGCAGTAGCATACAAGG - Intergenic
1058434563 9:104950389-104950411 TTCAAGGGCAGTAACATGCATGG + Intergenic
1058662380 9:107278408-107278430 CTCAAGGGCAGTAACACCCATGG - Intergenic
1058712011 9:107687561-107687583 TTCAGAGGCAGTAACATGCATGG + Intergenic
1058774832 9:108272949-108272971 TCCAGGGGAAGAAAAACACAGGG - Intergenic
1058990154 9:110247886-110247908 TTCAGGGACAGTAACATGCATGG - Intronic
1059028560 9:110664559-110664581 CTCAGGGGCAATAACACACATGG + Intergenic
1059714612 9:116902165-116902187 TTCTGGGGCAGTAACACATATGG - Intronic
1059718965 9:116940403-116940425 TTCAGGGACAATAACACACATGG - Intronic
1059848325 9:118306347-118306369 CTAAGTGGCAGTAACACTCAAGG - Intergenic
1059951516 9:119467590-119467612 TACAGGGGGAATAACGCACACGG - Intergenic
1060129701 9:121083498-121083520 TTCAAGGGCAATAACATGCATGG + Intronic
1060868309 9:127017880-127017902 TTCAGGGATGGTCACACACATGG + Intronic
1061311391 9:129765222-129765244 TTCAGGGGCAATAACAGGCATGG + Intergenic
1062663330 9:137652141-137652163 TTCAGAGGCACTAACATGCATGG - Intronic
1186033820 X:5398938-5398960 TTCAGGGGCGATAACATGCATGG - Intergenic
1186296327 X:8153048-8153070 TTCAGGGACAATAACATGCATGG + Intergenic
1186697301 X:12049743-12049765 TTCAGGGGAAACAACATACATGG - Intergenic
1186791290 X:13001726-13001748 CTCAGGGGAAGTAACAGGCATGG - Intergenic
1187209902 X:17219174-17219196 TTCAGGGGCAATAACATGCATGG - Intergenic
1187395269 X:18913876-18913898 TTCAGGGGCAGTAATGTACATGG + Intronic
1187562736 X:20418195-20418217 TACAGGGGTAGAAAGACACAGGG - Intergenic
1187636617 X:21236925-21236947 TTCAGGGGTGGTAACACGCATGG - Intergenic
1187762283 X:22601133-22601155 TTCAGGGGCAGTAATACCCTTGG - Intergenic
1188084798 X:25890675-25890697 TTCAGAGGCAATAACTCACATGG + Intergenic
1188269588 X:28122130-28122152 TTCAGGGGCAATAACACTCATGG + Intergenic
1188442469 X:30226222-30226244 TTCAGGGACAATAATACGCATGG - Intergenic
1188777458 X:34238459-34238481 TTCAGGGGCAATAACATGCATGG + Intergenic
1188778017 X:34246076-34246098 TTCATGGGCTATAAGACACAAGG - Intergenic
1188824455 X:34813359-34813381 TTCAGGGGCAATGACACACATGG - Intergenic
1188850110 X:35121688-35121710 CTCAGGGGCAATAACATGCATGG + Intergenic
1189028321 X:37423035-37423057 TTCAGGGACAATAACATGCATGG - Intronic
1189158244 X:38782267-38782289 TTCAGGGGCAATAACATGCATGG + Intergenic
1189765447 X:44367722-44367744 TTCAGGGTCAATAACACGCATGG - Intergenic
1189991494 X:46599548-46599570 GTAAAGGGCAGGAACACACATGG + Intronic
1190574069 X:51815318-51815340 TTCAGGGGCAATAACACACATGG - Intronic
1191056571 X:56247727-56247749 TTCAGGGGTAATAACATGCATGG + Intronic
1191090250 X:56613000-56613022 TTCAGGGGCAATAACAGGCATGG + Intergenic
1191801824 X:65089896-65089918 TTCAGGGACAACAACACACATGG + Intergenic
1192385106 X:70660609-70660631 CTCAGGGGCAATAACATGCATGG + Intronic
1192407706 X:70903074-70903096 TTCAGGGGCAATAAAATGCATGG + Intronic
1192569767 X:72193407-72193429 TTCAGGGACAATAACATGCATGG - Intronic
1192861185 X:75073061-75073083 TTCAGGGGCAATAACATGCATGG + Intronic
1193089637 X:77480589-77480611 TTCGAGGGCAATAACACGCATGG + Intergenic
1193374776 X:80746163-80746185 TTTAGGGGCAGTCATACATATGG - Intronic
1193579224 X:83242526-83242548 TTCATAGGCAGTAACACACATGG - Intergenic
1193611605 X:83638332-83638354 TTTAGGGGTAATAACACACGTGG + Intergenic
1193912884 X:87327438-87327460 AGCAGGGGCAGTGACCCACATGG - Intergenic
1193973159 X:88083173-88083195 TTCAGGGGCAATTCCACATATGG + Intergenic
1194236473 X:91390230-91390252 TTTAAGGGCAGTAACAAGCATGG + Intergenic
1194432333 X:93824698-93824720 TTCAGGGGCAATATCACAAATGG - Intergenic
1194440260 X:93924059-93924081 TCTAGGGGCAGTAACATTCATGG + Intergenic
1194586999 X:95747573-95747595 TTCAGGAGCAGTAACATGCAGGG - Intergenic
1194588082 X:95762173-95762195 TTTGGGGGCAATAATACACATGG + Intergenic
1194640299 X:96396095-96396117 TTCAGGGGCAATAAAACTCATGG - Intergenic
1194697058 X:97065765-97065787 TCAAGGGGCAATAACACACATGG - Intronic
1194724360 X:97377126-97377148 TTCAGGGGCAATAACACACATGG + Intronic
1194820975 X:98506646-98506668 TTCAGGGGCAATAACAGGCATGG - Intergenic
1194904985 X:99564225-99564247 TTCAGGGACAATAGGACACATGG + Intergenic
1195040759 X:101011928-101011950 TTCAGGGGCAATAACATACATGG + Intronic
1195550056 X:106158438-106158460 TTCAGGGGCGGTAACAGGCATGG - Intergenic
1195551122 X:106172588-106172610 TTCAGGGGCAGTAACACTCATGG + Intronic
1195772690 X:108368870-108368892 TTTGGGGGCAATAACACACATGG + Intronic
1196265379 X:113638188-113638210 TTCAGGGGCAATAACACACACGG + Intergenic
1196568247 X:117233749-117233771 TTCAAGGACAGTAACACACGTGG + Intergenic
1196641464 X:118067744-118067766 TTCAGGGGCAATAACGTGCATGG + Intronic
1196894060 X:120316325-120316347 TTCAGGAGCAATAACACACATGG - Intergenic
1197047254 X:122012429-122012451 TTCAAGGACCATAACACACATGG - Intergenic
1197265415 X:124364164-124364186 TTCAGGTGCAGTCACACACACGG - Intronic
1197444343 X:126530984-126531006 TTCAGGGGCACTCACACACATGG + Intergenic
1198884880 X:141323788-141323810 TTCAGGGGAAATAACATACACGG + Intergenic
1199281884 X:146011118-146011140 TTCAGAGGCAGTAACACACATGG - Intergenic
1199335357 X:146613125-146613147 CTCAGGGGCAATAACAGGCATGG + Intergenic
1199940617 X:152623283-152623305 TCCAGGGGCAATAATACACATGG - Intergenic
1201638492 Y:16152221-16152243 TTCAGGGGCAATAACATGCATGG + Intergenic
1201942102 Y:19471418-19471440 CTCATGTGCAGTGACACACATGG - Intergenic