ID: 1156517185

View in Genome Browser
Species Human (GRCh38)
Location 18:37690326-37690348
Sequence TCCTACTGGGAGGTCTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1282
Summary {0: 2, 1: 28, 2: 271, 3: 432, 4: 549}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156517185_1156517194 -8 Left 1156517185 18:37690326-37690348 CCCCTGAAGACCTCCCAGTAGGA 0: 2
1: 28
2: 271
3: 432
4: 549
Right 1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG No data
1156517185_1156517191 -10 Left 1156517185 18:37690326-37690348 CCCCTGAAGACCTCCCAGTAGGA 0: 2
1: 28
2: 271
3: 432
4: 549
Right 1156517191 18:37690339-37690361 CCCAGTAGGACAAGATGTGGAGG No data
1156517185_1156517195 -7 Left 1156517185 18:37690326-37690348 CCCCTGAAGACCTCCCAGTAGGA 0: 2
1: 28
2: 271
3: 432
4: 549
Right 1156517195 18:37690342-37690364 AGTAGGACAAGATGTGGAGGGGG 0: 12
1: 230
2: 429
3: 429
4: 727
1156517185_1156517193 -9 Left 1156517185 18:37690326-37690348 CCCCTGAAGACCTCCCAGTAGGA 0: 2
1: 28
2: 271
3: 432
4: 549
Right 1156517193 18:37690340-37690362 CCAGTAGGACAAGATGTGGAGGG No data
1156517185_1156517196 0 Left 1156517185 18:37690326-37690348 CCCCTGAAGACCTCCCAGTAGGA 0: 2
1: 28
2: 271
3: 432
4: 549
Right 1156517196 18:37690349-37690371 CAAGATGTGGAGGGGGAAGACGG No data
1156517185_1156517197 29 Left 1156517185 18:37690326-37690348 CCCCTGAAGACCTCCCAGTAGGA 0: 2
1: 28
2: 271
3: 432
4: 549
Right 1156517197 18:37690378-37690400 TGATGATTCTGACCCTGTGTAGG 0: 24
1: 271
2: 486
3: 505
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156517185 Original CRISPR TCCTACTGGGAGGTCTTCAG GGG (reversed) Intergenic
903510827 1:23873810-23873832 TGCTGCTGGAAGGACTTCAGAGG + Exonic
903750896 1:25619840-25619862 CCCTACTGGGAGGTCGAGAGGGG - Intronic
904263090 1:29302061-29302083 TCCCACTGGGAGGTCTTTAGGGG - Intronic
904436341 1:30500167-30500189 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
904491456 1:30862482-30862504 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
904492113 1:30867698-30867720 TGCCACTGGGAGGTCCTCACAGG - Intergenic
904722254 1:32519084-32519106 TCCCACTGGAAGGTCTTCAGGGG + Intronic
905360639 1:37417480-37417502 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
905790959 1:40789193-40789215 TCCTCCTGGGGGGTCCTCGGGGG + Intronic
906029436 1:42706101-42706123 TCCCACTGAAAGGTCTTCAGGGG + Intergenic
906547491 1:46630829-46630851 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
906754183 1:48293011-48293033 GCCAGCTGGGAGGTCTTCAGTGG + Intergenic
906994932 1:50782286-50782308 TCCTACTGGAAGGTTTTCAGAGG - Intronic
907087669 1:51691862-51691884 TCCCGCTGGAAGGTTTTCAGGGG + Intronic
907117509 1:51982100-51982122 TCCCACTGGAAGGTCTTCAGGGG - Intronic
907222650 1:52918475-52918497 TCCCACTGGAAGGTCTTCAGGGG - Intronic
907500189 1:54873557-54873579 TCCCACTGGAAAGTCTTCAGGGG - Intronic
907768447 1:57435656-57435678 TCCCAGTGGAAGGTCTTCAGGGG + Intronic
908680550 1:66656225-66656247 TCCCACTGGAAGGCCTGCAGGGG + Intronic
908771149 1:67597236-67597258 TCCCGCTGGAAGATCTTCAGGGG + Intergenic
908806063 1:67934080-67934102 TCCCACTGTAAGGTCTTCAGGGG - Intergenic
908934232 1:69355497-69355519 TCCCACTGGAAGATGTTCAGTGG + Intergenic
909004392 1:70257767-70257789 TCCCACCGGAAGGTCTTAAGGGG - Intergenic
909027456 1:70499490-70499512 TCTCACTGGAAGGTTTTCAGGGG - Intergenic
909361619 1:74766363-74766385 TACCACTGGAAGGTCTTCAGGGG - Exonic
909418650 1:75436974-75436996 ACCCACTGGAAGGTCTTCAGGGG + Intronic
909610288 1:77544657-77544679 GCCCACTGGAAGGTCTTCAGGGG + Intronic
909782865 1:79569473-79569495 TCCCACTGGAAAGGCTTCAGGGG + Intergenic
909830794 1:80187143-80187165 TCCCACTGAGCAGTCTTCAGGGG - Intergenic
910003483 1:82365726-82365748 TCCCACTAGAAGGTCTTTAGGGG + Intergenic
910346543 1:86245376-86245398 TCCCAATGGAAGGACTTCAGGGG + Intergenic
910667126 1:89737911-89737933 TCCCACTGGAAGGTCTTCAGGGG + Intronic
910880839 1:91921105-91921127 TGTTGCTGGGAGGTGTTCAGAGG + Intergenic
910943830 1:92566706-92566728 TCCCACTGGAAGATCTTCAGGGG - Intronic
911061807 1:93754948-93754970 TCCCACTGGAAGGTCTTCAGGGG - Intronic
911085023 1:93969150-93969172 TCCCACTGGGAAGTCTCCAGGGG - Intergenic
911156522 1:94642725-94642747 CCCTGCTGGGAAGTCTGCAGTGG + Intergenic
911275181 1:95851720-95851742 TTCCACTAGAAGGTCTTCAGGGG + Intergenic
911316942 1:96367265-96367287 TTCCACTGGAAGATCTTCAGGGG - Intergenic
911327523 1:96485999-96486021 TCCCACTGGAAGGTTTTCAGGGG - Intergenic
911539288 1:99139146-99139168 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
911544121 1:99196051-99196073 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
911545306 1:99209111-99209133 TCCCACTAGAAGGTCTTCAGGGG + Intergenic
912037775 1:105343493-105343515 TCCCACTGAGAAGTCTTCAAGGG - Intergenic
912155188 1:106909778-106909800 TCCTGCTGGAAGTTCCTCAGGGG - Intergenic
912262406 1:108122550-108122572 TCCTCCTCGGAGGTCACCAGGGG - Intergenic
912705949 1:111912615-111912637 TCCCACTGGAAGGTCATCTGGGG - Intronic
912909474 1:113743345-113743367 TCCTACTGTAGGGTCTTCAGGGG + Intronic
912913288 1:113785247-113785269 TCCTGCTGAAAAGTCTTCAGGGG + Intronic
913025641 1:114836269-114836291 TCCCTCTGGCAGGTCTTCAAGGG + Intergenic
913136469 1:115894379-115894401 TCCCACTGGCAGGTCTTCAGGGG - Intergenic
913194848 1:116447324-116447346 TCCCACTGGAAGGTATTCAGGGG - Intergenic
913344178 1:117791590-117791612 TCCTACTGGGACTACATCAGTGG + Intergenic
914406594 1:147380701-147380723 TCCCACTGGGAGGTCTTCAGGGG + Intergenic
914778021 1:150756216-150756238 TCCCACTGGAAGGTCTTCAGGGG + Intronic
914889520 1:151610690-151610712 TCTCACTGGAAGGTCTTCATGGG + Intergenic
915251796 1:154595371-154595393 TCCCACTGTAAGGTGTTCAGGGG - Intronic
915374663 1:155382625-155382647 TTCTACTGAAAGGTCTTCAGGGG - Intronic
915621348 1:157087146-157087168 TCCCACGGGAAAGTCTTCAGGGG - Intergenic
915621554 1:157089075-157089097 TCCCACGGGAAAGTCTTCAGGGG - Intergenic
915647094 1:157280321-157280343 ACCCACTGAGAGTTCTTCAGAGG + Intergenic
915896682 1:159816720-159816742 TCCCGCTGGAAAGTCTTCAGAGG - Intergenic
916227615 1:162505260-162505282 TCTTACTGGAATGTCTGCAGGGG + Intronic
916325028 1:163546680-163546702 TCTCACTGGAAGATCTTCAGGGG + Intergenic
916404070 1:164480028-164480050 TTCTACTGGAAGACCTTCAGGGG - Intergenic
916404611 1:164485629-164485651 TCCTGCTGAGAGTTCTCCAGAGG - Intergenic
916410159 1:164539266-164539288 TCCCACTGGAAGGTCTCCAGGGG - Intergenic
916813765 1:168330048-168330070 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
917114013 1:171583427-171583449 TCCCACTGGGAGGTCTTCAGGGG + Intronic
917169926 1:172160550-172160572 TCTTACTGGAAGGTCTTCGGTGG + Intronic
917260528 1:173162450-173162472 CTCCACTGGAAGGTCTTCAGGGG + Intergenic
917588160 1:176449430-176449452 TCTTACTGGAAGGTCTTCAGGGG + Intergenic
917633346 1:176911627-176911649 TCCCACTGGCAGGTCTCTAGGGG + Intronic
918174094 1:182028186-182028208 TCCCATTGGAAGGTCTTCAGGGG + Intergenic
918259256 1:182780368-182780390 TCCCACTGGAAGGTCTTCAGCGG + Intergenic
918764887 1:188468125-188468147 TCCCACTGGGAGGTCTTCAGAGG + Intergenic
918817993 1:189214845-189214867 TCCCATTGGAAGGTCTTCAGGGG - Intergenic
918916388 1:190645295-190645317 TCCCACTGGAAGGTATTCAGGGG + Intergenic
919649617 1:200133874-200133896 TCCCATTGGAAGGTCTTCAGGGG - Intronic
920680246 1:208066768-208066790 TCCCACTGTGAGGTCTTCAGGGG - Intronic
920717168 1:208350926-208350948 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
921377000 1:214484810-214484832 TCCAAGAGGGATGTCTTCAGGGG + Intronic
921399826 1:214709144-214709166 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
921643638 1:217586481-217586503 TCTCACTGGAAGGTCTTCAGGGG + Intronic
921722184 1:218485014-218485036 TCCCAGCGGAAGGTCTTCAGGGG - Intergenic
921770464 1:219032331-219032353 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
921788857 1:219266390-219266412 TCCCACTAGAAGTTCTTCAGAGG + Intergenic
922122734 1:222688961-222688983 TCCCACTGGAAGGTCTTCCAGGG - Intronic
922480100 1:225934300-225934322 TCCCAGTAGAAGGTCTTCAGGGG + Intergenic
922501716 1:226101902-226101924 TCCCACTGGAAGGTCTTCCAGGG - Intergenic
923002074 1:230015005-230015027 TCCCACTGGAAGTGCTTCAGGGG - Intergenic
923128166 1:231050571-231050593 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
923405859 1:233659292-233659314 TCCCACTGGAAGGTCTTCAGGGG + Intronic
923925564 1:238623304-238623326 TCCCACTGGAAGGTATTCAGGGG - Intergenic
924166821 1:241292086-241292108 TCCTACTGGAAGGTCTTCAGAGG + Intronic
1063283495 10:4658046-4658068 CCCCATTGGAAGGTCTTCAGGGG + Intergenic
1063836079 10:10014316-10014338 TCCCACTAGAAGGTCTTCAAAGG - Intergenic
1064530189 10:16300660-16300682 TCTCACTGGGAGGTCTTCAGGGG + Intergenic
1064545462 10:16445807-16445829 GTCTCCTGGGTGGTCTTCAGAGG + Intronic
1065631115 10:27682033-27682055 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1065781486 10:29172426-29172448 TCCCACTGGAAAGTCTTCTGGGG + Intergenic
1066352553 10:34650007-34650029 TCCCACTGGAAGGGCTTCAGAGG + Intronic
1066678180 10:37910405-37910427 TTCCTCTGGAAGGTCTTCAGGGG + Intergenic
1067250809 10:44585575-44585597 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1068065433 10:52124912-52124934 TCCCCTTGGAAGGTCTTCAGGGG + Intronic
1068362986 10:56004195-56004217 TCCTACTGGAAGGACTTCAGGGG + Intergenic
1068441335 10:57058473-57058495 TCCCACTGGAAGGTCTTCTGGGG + Intergenic
1068484414 10:57638899-57638921 TCCCACTGGCAGGTCTTCAGGGG - Intergenic
1068756102 10:60655319-60655341 TCCCCCTGGAAGGTCTTCAGAGG - Intronic
1068912463 10:62393114-62393136 TCCCACTGGAAGGTCTTCAGAGG + Intronic
1069125711 10:64629746-64629768 TCCCACTGAAAGTTCTTCAGGGG - Intergenic
1069153191 10:64991889-64991911 TCCCACTGAGAGGCCTCCAGGGG - Intergenic
1069211218 10:65761896-65761918 TCCCACTGGAAGGTCTTGAGGGG + Intergenic
1069304588 10:66952956-66952978 AACTACTTGGAGGTCTTCTGTGG - Intronic
1069357459 10:67603473-67603495 TCCCACTGAAAGGTCTTCAGGGG - Intronic
1069418603 10:68225287-68225309 TCGCACTGGAAGGTGTTCAGGGG - Intergenic
1070084674 10:73225317-73225339 TCCCACCGGAAGGTCTTCAAAGG - Intronic
1070098713 10:73364628-73364650 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1071339609 10:84632276-84632298 TCCCACTGGAAGGTTTTCAGGGG - Intergenic
1071356655 10:84803335-84803357 TCCTGCTTGAAGATCTTCAGGGG - Intergenic
1071461249 10:85898689-85898711 TCTCACTAGAAGGTCTTCAGGGG + Intronic
1071701474 10:87942684-87942706 TCCCACTGGAAGGTCTTAAGGGG - Intronic
1071863152 10:89696829-89696851 TTCTACTGGAATGTTTTCAGGGG + Intergenic
1072061350 10:91814138-91814160 TCCCACTGGAAGGTCTTTAGGGG - Intronic
1072111080 10:92320494-92320516 TCCCACTAGAAGGTCTTCAGGGG - Intronic
1072295056 10:94000897-94000919 TCCTACTGGCTGGTAGTCAGGGG - Intronic
1072386091 10:94929669-94929691 TCCCACTGTAAGGTTTTCAGGGG + Intergenic
1072631028 10:97146566-97146588 ATCTACTGGGAGGTGTTCAGTGG - Intronic
1072644053 10:97238101-97238123 TTCCACTAGAAGGTCTTCAGAGG - Intronic
1074626176 10:115189436-115189458 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1074683874 10:115939831-115939853 TCCTGGTGAGAGGTCTTCTGGGG - Intronic
1074729543 10:116354785-116354807 CCCTACTGGAAGGCCCTCAGGGG - Intronic
1075163564 10:120045850-120045872 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1075422985 10:122317775-122317797 TCCCACTGGAAGGCCTTCAGGGG + Intronic
1075770054 10:124926514-124926536 TCCCACTGGAAGGTCTTCGGGGG + Intergenic
1076165931 10:128282814-128282836 TCCCATTGGAAGGTCTTCAGGGG + Intergenic
1076182000 10:128416760-128416782 TCCCACTGGAAGTTCTTGAGGGG - Intergenic
1076661099 10:132056686-132056708 TGCAACTGTGAGGACTTCAGAGG - Intergenic
1077633055 11:3824117-3824139 TCCTCCTCCGAGGACTTCAGTGG + Exonic
1078031436 11:7755441-7755463 TCCCACTGGAAGGTGTTCAGGGG - Intergenic
1078125006 11:8552701-8552723 TTCCTCTGGAAGGTCTTCAGGGG + Intronic
1078281868 11:9910573-9910595 TCTCACTGGAAGTTCTTCAGGGG - Intronic
1078329099 11:10404197-10404219 TCCCACTGGAAGATCTTCAGGGG - Intronic
1078343461 11:10520460-10520482 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1078644527 11:13127830-13127852 TCCCACTGCAAGGTCTTCAGGGG - Intergenic
1078749700 11:14149178-14149200 TCCCACTGGAAGGTCCTCGGGGG - Intronic
1079118905 11:17663328-17663350 TCCCACTGGAAGGTATTCAGGGG + Intergenic
1079147350 11:17865497-17865519 TCTCACTGGAAGGTCTTCAGAGG - Intronic
1079199452 11:18363099-18363121 TCCCACTGAAAAGTCTTCAGGGG + Intronic
1079352870 11:19707506-19707528 TCCCTCTGGAAGGTCTTCAGGGG + Intronic
1079777390 11:24549317-24549339 TCCTACTGGAAGGTCTCCATGGG + Intronic
1080090059 11:28336952-28336974 TCCCACTGGAAGGTGTTCAGGGG - Intergenic
1080724812 11:34886197-34886219 TCTCAGTGGAAGGTCTTCAGGGG - Intronic
1081004232 11:37714156-37714178 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1082892114 11:58150920-58150942 TCTTACTAGAAGGTCTTCAGGGG - Intronic
1083072907 11:60005152-60005174 TCCCACTGGAAGGTCTTCGTGGG - Intergenic
1083167045 11:60896329-60896351 TCCCACCGGAAGGTCTTCGGGGG - Intronic
1083379092 11:62249994-62250016 TGGGACTGGGAGGTCTGCAGAGG + Intergenic
1084293214 11:68190525-68190547 TCCCACTGGAGCGTCTTCAGGGG - Intronic
1084753184 11:71217608-71217630 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1085241049 11:75055974-75055996 TCCCACTGGAAGATCTTCAGGGG - Intergenic
1085555469 11:77416439-77416461 TCCCACTGGAAGGTCTTTAGGGG + Intronic
1085677364 11:78536408-78536430 TCCTACTGAAAGGTCTTCAGGGG - Intronic
1085910393 11:80817918-80817940 TCCTACGTGGAGCTCTCCAGAGG + Intergenic
1086293844 11:85342426-85342448 CCCCACTGGAAGGTGTTCAGGGG + Intronic
1086601078 11:88634573-88634595 TCCTACCAGAAGGTCTTCAGGGG + Intronic
1086643546 11:89190303-89190325 TCCCACTGGAAAATCTTCAGGGG - Intronic
1086799880 11:91159753-91159775 CCTCACTGGAAGGTCTTCAGGGG + Intergenic
1087088904 11:94247888-94247910 TCCCACTGGAAGTTCTTCAGAGG + Intergenic
1087114105 11:94505322-94505344 TCCTGCTGGGAGGTGTTCAGGGG - Intergenic
1087156764 11:94912313-94912335 TCCCATTGGAAGGTCTTCAGGGG + Intergenic
1087432449 11:98070698-98070720 TCCCACTGGAAGTTCTTTAGGGG - Intergenic
1087475497 11:98628645-98628667 TCCCACTGGAAGGTCTTCAAGGG + Intergenic
1087502229 11:98972152-98972174 TCTTAATGGAAGGTCTTCAGGGG + Intergenic
1087666060 11:101049207-101049229 TCTCACTGGAAGGTCTTCAGGGG + Intronic
1087819690 11:102697941-102697963 TCCCACTGGAAAGTCTTCAGGGG + Intronic
1087921626 11:103873328-103873350 TCACACTGGAAGGTCTTCAGGGG - Intergenic
1087976089 11:104548900-104548922 TCCTACTGGAAGGTCTTCAGGGG + Intergenic
1088056234 11:105582995-105583017 TCCCACTGGAAGGTCTTTAGGGG - Intergenic
1088086861 11:105991630-105991652 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1088096783 11:106109629-106109651 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1088118679 11:106341715-106341737 TCCCACTGGAAGCTCTTCAGGGG - Intergenic
1088336498 11:108710527-108710549 TCCCACTAGAAGGCCTTCAGGGG + Intronic
1088383868 11:109227807-109227829 TCCCACTAGAAGGTCTTCAGAGG + Intergenic
1088453329 11:110006127-110006149 TCCCACTGAAAGGTCTTCAGGGG + Intergenic
1088462651 11:110098122-110098144 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1088744047 11:112790122-112790144 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1088993987 11:114980024-114980046 TCCCACTAGTAGGTCTTCAGGGG - Intergenic
1089995371 11:122902000-122902022 TCTCACTGGAAGGTCTTCAGGGG + Intronic
1090041213 11:123293701-123293723 TCCCACTGGAAGGTCTTTAGGGG + Intergenic
1090111900 11:123921031-123921053 TCCTACTGGGATGTCTTACTTGG + Intergenic
1090361225 11:126174139-126174161 TCCCACTGGAAGCTCTTCAGGGG + Intergenic
1090418024 11:126554329-126554351 TGCTGCTGGGAGGTGCTCAGAGG + Intronic
1090740495 11:129655030-129655052 TTCTGCTGGGAAGTCTTCTGGGG - Intergenic
1090970173 11:131635307-131635329 TCCCACTGGAAGGTTTTCAGGGG - Intronic
1091063711 11:132489249-132489271 CCCCGCTGGGAGGTCTTCAGGGG + Intronic
1091361234 11:134979899-134979921 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1091364169 11:135003768-135003790 TCCCACTGGAACATCTTCAGGGG + Intergenic
1091700666 12:2658733-2658755 TCCTATCGGAAGGTCTTCAGGGG - Intronic
1091766921 12:3127239-3127261 TCCCGCTGGAAGGTCTTCAGGGG + Intronic
1091812752 12:3413522-3413544 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1092110295 12:5956382-5956404 TTCCACTGGAAAGTCTTCAGGGG - Intronic
1092499896 12:9034901-9034923 TCCCACTGGGAGTTCTTCAGGGG - Intergenic
1092546481 12:9456366-9456388 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1093009308 12:14087933-14087955 TCCCACTGGAAGGTCTTCAGAGG + Intergenic
1093058853 12:14582082-14582104 TCCTACTGTAAGGTATTTAGGGG + Intergenic
1093122667 12:15291647-15291669 TCCCATTGGAAGGTCCTCAGGGG + Intronic
1093407884 12:18827559-18827581 TCCCACTGGCAGGTCTTCAGGGG + Intergenic
1093439052 12:19171919-19171941 TCCCACTGTAAGATCTTCAGGGG + Intronic
1093680861 12:22001137-22001159 TCCCACTGGAAGGTCTTCAGAGG + Intergenic
1093835043 12:23818903-23818925 TCTCACTGGAAGGTCTTCAGGGG + Intronic
1093956397 12:25224304-25224326 TCCCACTGGAAGATCTTCAGGGG - Intronic
1094030057 12:26001668-26001690 TCGTACTGGAAGGTCTTCAGGGG + Intronic
1094232191 12:28119458-28119480 CCCTAATGGAAGGTCTTCAGAGG - Intergenic
1094416271 12:30218810-30218832 TCCCGCTGGAAGGTCTTCAGGGG - Intergenic
1094455487 12:30627949-30627971 TCCCCCTGGAAGGTCTTAAGGGG - Intergenic
1094506459 12:31065708-31065730 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1094737209 12:33248555-33248577 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1095170737 12:39032948-39032970 TCCCATAGGAAGGTCTTCAGGGG - Intergenic
1095223996 12:39656683-39656705 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1095383769 12:41626502-41626524 TTCTAATGGGAAATCTTCAGTGG + Intergenic
1095715145 12:45336901-45336923 TCTCACTGGAAGGTCTTCAGGGG - Intronic
1096342663 12:50815233-50815255 TCCCACTGGAAGGTCTTTAGGGG - Intronic
1096474950 12:51902972-51902994 TCCCACTGGTAGGTCTTCAGGGG + Intergenic
1096911930 12:54992827-54992849 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1097003240 12:55896260-55896282 TCCCACTGGAAGGTTTTCTGGGG + Intergenic
1097025562 12:56052739-56052761 TCCCACTGGAAGATCTTCAGGGG + Intergenic
1097272496 12:57785346-57785368 TCCTGCTGGAAGGTCTTCAGGGG + Intronic
1097490719 12:60267126-60267148 TCCTACTGAAAAGTCTTCAGGGG + Intergenic
1097630881 12:62060690-62060712 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1097649418 12:62278195-62278217 TCCCATTGGAAGGTCTTCATGGG + Intronic
1098017148 12:66117726-66117748 TCCCACTGCAAGGCCTTCAGGGG - Exonic
1098108696 12:67098440-67098462 TACCACTGGAAGGTCTTCAGGGG - Intergenic
1098351435 12:69565712-69565734 TCCCACTGGAAAGTCTTCAGGGG + Intronic
1098507433 12:71270231-71270253 TCTCACTGGAAGGTCTGCAGTGG + Intronic
1098773478 12:74584036-74584058 TCTCACTGGAAGGTCTGCAGGGG + Intergenic
1098785847 12:74754057-74754079 TCCCACTGGAAAGTCTTCAAGGG - Intergenic
1098796628 12:74896772-74896794 TCTGACTGGAAGGTGTTCAGGGG + Intergenic
1098800275 12:74948794-74948816 TCCCACTGGAAGGTCTTCGGGGG + Intergenic
1098880454 12:75912006-75912028 TCCCACTGGGAGGTCTTCATGGG - Intergenic
1099546101 12:83981915-83981937 TCCCACTGGAAGGTCGTCAGGGG + Intergenic
1099559721 12:84155991-84156013 TTCTACTGGAAGATTTTCAGGGG - Intergenic
1099670258 12:85682372-85682394 TCCCACTAGAAGATCTTCAGGGG + Intergenic
1100152368 12:91754986-91755008 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1100314283 12:93429672-93429694 TCCTACTCGAAGGTCTTCAGGGG - Intronic
1100402673 12:94245891-94245913 TCCTGCTCAGAGATCTTCAGTGG - Intronic
1100457001 12:94762047-94762069 TCCCACTGGGAGGTCTTCAGGGG - Intergenic
1100692633 12:97054810-97054832 TCCCTCTGGAAGATCTTCAGGGG - Intergenic
1100807877 12:98306572-98306594 TTCCACTGGAAGGTCTTCAGGGG + Intergenic
1100967176 12:100025767-100025789 TCCTACTGGAAGGTCTTCAGGGG + Intergenic
1101050796 12:100861952-100861974 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1101555370 12:105803786-105803808 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1101563092 12:105878732-105878754 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1101673009 12:106894244-106894266 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1102403727 12:112654034-112654056 TTCCACTGGAAGATCTTCAGGGG + Intronic
1102607830 12:114083188-114083210 TCCCACTAGAAGATCTTCAGAGG - Intergenic
1102918004 12:116769437-116769459 TCCCACTGGAAGATCTTCAGGGG - Intronic
1103178665 12:118888156-118888178 TCCTACTGGAAGGTCTTCAGGGG + Intergenic
1103229589 12:119317745-119317767 TCCCATTAGGAGGTCTTCAGGGG + Intergenic
1103941876 12:124505707-124505729 TCCTTCTGGGGGCTCTTCTGTGG - Intronic
1104659918 12:130604032-130604054 TCCTGCTGGAAGGTCTCCAGGGG - Intronic
1104675945 12:130712511-130712533 TCCCGCTGGGAGGTCTCCAGGGG + Intronic
1105683772 13:22756624-22756646 ACCCACTGGAAGGTCTTCAGGGG - Intergenic
1105778750 13:23687803-23687825 TCCCACTGGAAGGTCTGCAGAGG - Intergenic
1105795935 13:23852826-23852848 TCCTACTAGAAGGTCTGCAAGGG - Intronic
1105832921 13:24181644-24181666 TCCCACTAGAAGGTCTTCAGGGG + Intronic
1105944820 13:25180220-25180242 TGGTACAGGGAGGTCTTGAGAGG - Intergenic
1106406119 13:29475526-29475548 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1106417830 13:29560254-29560276 TCCCACCGGAAGGTCTTCAGGGG + Intronic
1106957721 13:34960100-34960122 TCCCACTGAAAAGTCTTCAGGGG - Intronic
1107268810 13:38589987-38590009 TTCCACTGGAAGGTCTGCAGGGG - Intergenic
1107294752 13:38897123-38897145 TCCCGCTGGAAGGTCTTCAGGGG + Intergenic
1107321923 13:39199007-39199029 TCCCACTGGAAGGTCTGCAGGGG - Intergenic
1107445045 13:40462922-40462944 TCCCATTGGAAGGTCTTCAGGGG + Intergenic
1107454718 13:40544426-40544448 TCCCACTGGAAGGTCTGCAGGGG - Intergenic
1108384859 13:49889866-49889888 TCCCACTGGAGGGTCTTCAGGGG - Intergenic
1108387070 13:49908879-49908901 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1108453723 13:50592236-50592258 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1108531039 13:51327438-51327460 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1108583415 13:51846681-51846703 TCCCACTGGAAGTTCTTCAGGGG - Intergenic
1108747163 13:53407875-53407897 TCCCATTGAAAGGTCTTCAGGGG + Intergenic
1108767851 13:53655693-53655715 TCCCACTGGGAAGTCTTCAGGGG + Intergenic
1108812434 13:54244645-54244667 TATCACTGGAAGGTCTTCAGGGG + Intergenic
1108825155 13:54404578-54404600 TCCCACTGAAAGGTCTTCAGGGG + Intergenic
1109110088 13:58305885-58305907 TCCCACTGGAAGGTCTTGAGGGG + Intergenic
1109126782 13:58527889-58527911 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1109385255 13:61621926-61621948 TCCCACTGAAGGGTCTTCAGGGG + Intergenic
1109454176 13:62561897-62561919 TCCCTCTGGAGGGTCTTCAGGGG - Intergenic
1109472101 13:62821454-62821476 TCCCACTGGAAGGCCTTCAGGGG - Intergenic
1109505412 13:63294462-63294484 TCCCACTGGTAGGTCTTCAGGGG + Intergenic
1109587440 13:64425258-64425280 GCCAACTGGAAGGTCTTCATGGG + Intergenic
1109591884 13:64495320-64495342 TTCCACTGGAAGGTCTTCAGGGG - Intergenic
1109744334 13:66602377-66602399 TCCCACTGCAAGGTCTTCAGAGG - Intronic
1109831033 13:67789193-67789215 TCCTACTGGAAGGTCTTTAAGGG - Intergenic
1109874641 13:68385064-68385086 TCCCACTGGGAGGTCTTTAGAGG - Intergenic
1109990079 13:70042836-70042858 TCCCACTGGAGAGTCTTCAGGGG - Intronic
1110454139 13:75671091-75671113 TCCCACTGGAAGGCCCTCAGGGG + Intronic
1110473380 13:75885763-75885785 TTCCACTGGAAGGTCTTCAGGGG + Intergenic
1110517833 13:76437486-76437508 CCCCACTGGAAGGTCTTCATAGG - Intergenic
1110758439 13:79203161-79203183 TCCCACTGGAAGGACTTCAGGGG - Intergenic
1110769603 13:79325379-79325401 TCCCACTGGAAAGTCTTGAGGGG - Intronic
1110786061 13:79527861-79527883 TCCCACTGGAAGGTCGTCAAGGG - Intronic
1110903214 13:80850984-80851006 TCTTTCTGGAAGGTCTTCAGGGG - Intergenic
1111053506 13:82917497-82917519 TCCTACTGGAAGGTCTTCAGGGG - Intergenic
1111289962 13:86153277-86153299 TCCCACTGGTAGGTCGTCAGGGG + Intergenic
1111349139 13:87003068-87003090 TCCCACTGGCAGGTCTTCAGGGG - Intergenic
1111370971 13:87316058-87316080 TCCCACCAGGAGGTCTTCAGGGG - Intergenic
1111591907 13:90358758-90358780 TCCCATTGGAAGTTCTTCAGGGG - Intergenic
1111753709 13:92365777-92365799 TCCTACTGTGGGGTCTTCAGGGG + Intronic
1111787046 13:92801637-92801659 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1112253942 13:97810798-97810820 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1112470435 13:99683621-99683643 TCCCAGTGGAAGGTCTTTAGGGG + Intronic
1112993311 13:105540979-105541001 TGCAACTGGGATTTCTTCAGAGG - Intergenic
1113030530 13:105989365-105989387 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1113125480 13:106973868-106973890 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1113137060 13:107102858-107102880 TCCTACTGGAAGGTCTTCAGGGG - Intergenic
1113153634 13:107292603-107292625 TTCCACTGGAAGATCTTCAGAGG + Intronic
1113390908 13:109895550-109895572 TCCCACTGGGAGTTTGTCAGGGG + Intergenic
1113529401 13:111010292-111010314 TCCCACTGCAAGATCTTCAGGGG - Intergenic
1113694441 13:112333909-112333931 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1114382136 14:22218119-22218141 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1114464001 14:22907794-22907816 TCCCACTGGAAGGTCTTCAAGGG - Intronic
1114879247 14:26763260-26763282 TCCCACTGGAAGGTGTTCAGGGG + Intergenic
1114951348 14:27758174-27758196 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1115210412 14:30962044-30962066 TCCCACTGGAAGGTCTTCAAGGG - Intronic
1115254999 14:31390956-31390978 TCCCACTGGATGGTCTTCAAGGG - Intronic
1115404963 14:33004944-33004966 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1115916837 14:38324627-38324649 TCCCACTTGAAGGTCTTCAGGGG + Intergenic
1115930675 14:38489454-38489476 TCTTACTGGGCTGTCTTCAAGGG + Intergenic
1116105629 14:40500396-40500418 TCCCACTGGACGGTTTTCAGGGG - Intergenic
1116106111 14:40508990-40509012 TCCCACTGGTAAGTCTTCAGGGG - Intergenic
1116687136 14:48054050-48054072 ACCTACTGGAAAGTCTTCAGAGG - Intergenic
1116998491 14:51348641-51348663 ACCTCCTGGAAGCTCTTCAGTGG - Intergenic
1117149355 14:52869832-52869854 TCTCACTGGAAGGTCTTCAGGGG - Intronic
1117197722 14:53357250-53357272 TCCCACTGGAAGGTCTTCAAGGG - Intergenic
1117215877 14:53551044-53551066 TCCTCTTGGGTGGTCCTCAGTGG + Intergenic
1117235191 14:53766981-53767003 TCCCACTGGAAGGCCTTCAAGGG + Intergenic
1117344153 14:54816622-54816644 TTCTGCTGGAAGGTCTTCACGGG - Intergenic
1117558877 14:56915325-56915347 TCCCACTGGAAAGCCTTCAGGGG + Intergenic
1117696067 14:58364043-58364065 TTCTACAGGGAGGTATTCAGAGG + Intronic
1117732549 14:58737949-58737971 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1117863332 14:60116805-60116827 TTCCACTGGAAAGTCTTCAGGGG - Intronic
1117873798 14:60228873-60228895 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1118079819 14:62345687-62345709 TCCCACCGGGATGTCTTCAGGGG + Intergenic
1118307166 14:64664559-64664581 TACCACTGGAAGGTCTTTAGGGG + Intergenic
1118698258 14:68406955-68406977 TCTCACTGGAAAGTCTTCAGGGG + Intronic
1118802069 14:69199727-69199749 TCCCACTGGAAAGTCTTCAGGGG + Intronic
1119314645 14:73682753-73682775 TCCCACTGGAAAGTCTTCAGGGG + Intronic
1119374226 14:74176061-74176083 TCCCACTGGAAGGTCTTCAGAGG + Intronic
1119828030 14:77674199-77674221 TTCTCCTGGGTGGTCTTCAAAGG - Exonic
1120065450 14:80035186-80035208 TCCCACTGGAAGGCCTTCAGGGG - Intergenic
1120493819 14:85208907-85208929 TCCCACCGGAAGGTCTTCAGAGG - Intergenic
1120712981 14:87812155-87812177 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1121855303 14:97263835-97263857 TCTCCCTGGAAGGTCTTCAGGGG - Intergenic
1122559923 14:102605823-102605845 TCCCACTGGAAGGTCTTCAGAGG - Intronic
1122856648 14:104563340-104563362 TCCCACTGGGAGTTCTTCTATGG - Intronic
1123642286 15:22408560-22408582 TCCCTCTGGGGGGTCTTCATGGG - Intergenic
1123825265 15:24075249-24075271 CTTTACTGGAAGGTCTTCAGTGG - Intergenic
1123966223 15:25461437-25461459 TCACACTGGCAGGTTTTCAGGGG - Intergenic
1124018550 15:25899335-25899357 GTCTACTGAAAGGTCTTCAGGGG - Intergenic
1124163556 15:27296953-27296975 TCCCACTGGAAGGTTTTCAGGGG - Intronic
1124449188 15:29770017-29770039 TCCTAGTGGGAGGTCTTCAGGGG - Intronic
1124506915 15:30285403-30285425 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1124665901 15:31592466-31592488 TCCCACTGGTAGGTCTTCAGGGG + Intronic
1124736642 15:32253258-32253280 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1125147088 15:36483817-36483839 TCCCACTAGAAGGTCTTCAGGGG - Intergenic
1125322601 15:38504546-38504568 TCCTATTGGAAGGTCTTTAGGGG + Intronic
1125436770 15:39654038-39654060 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1125444161 15:39735927-39735949 TCCCACTGGAAGGTCTTCAAGGG + Intronic
1125456319 15:39862950-39862972 TCCCATAGGAAGGTCTTCAGGGG - Intronic
1125519848 15:40341861-40341883 ACCCACTGGAAGGTCTTCAGGGG - Intergenic
1125990677 15:44104066-44104088 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1126329677 15:47518779-47518801 TCCCACTGGAAAGCCTTCAGGGG + Intronic
1126402725 15:48290249-48290271 TCCCACTGGAAGGTCTTCCAGGG + Intronic
1126440266 15:48680716-48680738 TCCCACTGGAAGGTCTTCAAGGG + Intergenic
1126477531 15:49081164-49081186 TCCCACTGGATGGTCTTCAAGGG - Intergenic
1126494421 15:49274854-49274876 TCCTACTGGAAGGTCTTCAGGGG + Intronic
1126523861 15:49628191-49628213 TCCCACTGGAAGCTCTTCAGGGG + Intronic
1126529461 15:49696921-49696943 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1126702018 15:51376837-51376859 TCCTATTGGAGGGTCTCCAGGGG + Intronic
1127013835 15:54660607-54660629 ACGAACTGGGAGGACTTCAGAGG - Intergenic
1127565512 15:60184478-60184500 TCCCACTGGGAGGTCCCCCGGGG - Intergenic
1127662208 15:61110632-61110654 TCCCCCTGGCAGGTCTTCAAGGG - Intronic
1128334192 15:66775619-66775641 TCCTGCTGGGAGGGTTCCAGGGG - Intronic
1128493173 15:68171222-68171244 TCCCACTGGAACGTCTTCAGTGG + Intronic
1129043687 15:72713419-72713441 TCCTTATGGAAGGTCTTCAGTGG + Intronic
1129196593 15:73971900-73971922 TCCCACTGGAAGTTCTTCATAGG + Intergenic
1129620460 15:77139202-77139224 TCCCAGTGGCAGGTCTTCAGGGG + Intronic
1129961094 15:79685287-79685309 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1130021762 15:80237470-80237492 TCCCACTGGAAGGGCTTCAGGGG - Intergenic
1131412533 15:92222008-92222030 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1131868353 15:96735364-96735386 TCTTTCTGGGAGGTCTTTGGAGG + Intergenic
1132033149 15:98455418-98455440 TCCCACTGGAAGGTCTCCAGGGG - Intronic
1132126505 15:99231393-99231415 TCCCACTGGAGGGTCTTCAGTGG - Intronic
1132253384 15:100351481-100351503 TCCCACTGGAAGGTCTTCAATGG + Intergenic
1133164999 16:3940150-3940172 TCCCACTGGAAGGTCTTCAGAGG - Intergenic
1134393037 16:13837472-13837494 TCCCACTGGAAGTTCTTCAGTGG + Intergenic
1134789433 16:16975633-16975655 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1134833392 16:17342057-17342079 CCACACTGGGAAGTCTTCAGAGG - Intronic
1135110738 16:19688913-19688935 CCCTACTGGGAACACTTCAGTGG - Intronic
1136018145 16:27419314-27419336 TCCCACTGGAAGGTCTTCAGTGG + Intronic
1136528916 16:30853382-30853404 CCCCACTGGAAGGTCTTCAGAGG + Intronic
1137419770 16:48322446-48322468 GCCCACTGGAAGGTCTTCAGAGG + Intronic
1137633926 16:49969170-49969192 TCCTCTTGGAAGGTCTTCATTGG + Intergenic
1138356860 16:56388804-56388826 TCCCACTGGAACGTCTTCAGGGG + Intronic
1138521038 16:57570946-57570968 TCCGACTAGGAGGACTTGAGAGG - Intronic
1138799116 16:60004536-60004558 TCCCACTGGTAGGTCTTCAGAGG + Intergenic
1139104173 16:63806217-63806239 TCTCACTGGAAGGTCTTCAGGGG - Intergenic
1140274934 16:73500197-73500219 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1140551629 16:75872011-75872033 TCCTACTGGAAGTACTTCACTGG - Intergenic
1140632666 16:76872892-76872914 TCCTATTAGGAGATCTACAGTGG + Intergenic
1140716579 16:77731748-77731770 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1142745707 17:1956667-1956689 GCCTCCTGGGAGGGCTGCAGGGG + Intronic
1143339378 17:6197982-6198004 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1144117772 17:12116710-12116732 CCCCACTGGAAGGTCCTCAGGGG + Intronic
1144224669 17:13133316-13133338 TCCTTCTGTGAGGTTTTCAGGGG + Intergenic
1144312100 17:14023386-14023408 TCCCACCGGAAGGTCTTCAGGGG - Intergenic
1144331260 17:14226168-14226190 TACTTCTGGGAGGTCTCCAGAGG + Intergenic
1144332660 17:14237933-14237955 TCCCACCGGAAGGTCTTCAGGGG + Intergenic
1144370106 17:14582208-14582230 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1144450456 17:15373197-15373219 TCCCACTAGAAGGTCCTCAGGGG + Intergenic
1145085526 17:19935729-19935751 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1145735382 17:27226368-27226390 TCCCACTGGGAGATCTTCGGGGG - Intergenic
1145820891 17:27834389-27834411 TCCCACTGGAAGGTCTTTGGGGG + Intronic
1145879557 17:28343459-28343481 TCCAGCTGGGAGATCTGCAGAGG + Intronic
1146031482 17:29370021-29370043 GCCTACTGAGAGATCTGCAGAGG + Intergenic
1146643534 17:34559982-34560004 TTGCACTGGAAGGTCTTCAGGGG - Intergenic
1146702976 17:34978263-34978285 TCCTACTGGAAGGCCTTCAGGGG + Intronic
1147487755 17:40834440-40834462 TCCATCTGAGAAGTCTTCAGAGG - Exonic
1147669929 17:42171075-42171097 TCCTTCTGGGATTCCTTCAGTGG - Intronic
1147683135 17:42267377-42267399 TTCCACTGAAAGGTCTTCAGGGG - Intronic
1148223199 17:45879594-45879616 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1148731006 17:49836597-49836619 TAATACTGTGAGGTCTTCAAGGG + Intergenic
1149169997 17:53798135-53798157 TCCTTTTGGAAGGTCTTCAGGGG - Intergenic
1149407243 17:56366035-56366057 TCCCACTGGAAGTTCTTAAGGGG - Intronic
1149426748 17:56562214-56562236 TCCGATTGGAAGGCCTTCAGGGG - Intergenic
1149629045 17:58105650-58105672 TCTTACTAGAAGGTTTTCAGGGG - Intergenic
1150011028 17:61503864-61503886 TCCCACTGGAAGGTCCTCAGGGG + Intergenic
1150607159 17:66703369-66703391 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1150683097 17:67298909-67298931 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1151059050 17:71069890-71069912 TCCCACTAGAAGGTCTTCAGGGG + Intergenic
1151141959 17:72001949-72001971 TCCCACTGGAAGCTCTTCAGGGG + Intergenic
1151930831 17:77230428-77230450 CCCAACTGGGGGGACTTCAGAGG + Intergenic
1152426460 17:80220898-80220920 TGCTTCTGGGAGGACATCAGAGG - Exonic
1152721056 17:81924012-81924034 GCCGACTGGGAGGTCTAGAGGGG - Intronic
1153084004 18:1262211-1262233 TCTCACTGGAAGGTGTTCAGGGG + Intergenic
1153198633 18:2627242-2627264 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1153566555 18:6424743-6424765 TCCCACTTGAAGGTCTTCAGGGG - Intergenic
1153692864 18:7610952-7610974 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1153711221 18:7801415-7801437 ACTCACTGGAAGGTCTTCAGAGG + Intronic
1153728534 18:7982403-7982425 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1154494060 18:14942993-14943015 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1155439690 18:25849206-25849228 CCCCACTGGAAGGTCTTCAGAGG - Intergenic
1155623834 18:27812056-27812078 TTCCACTGGAAGGTCTTCAGGGG + Intergenic
1155632918 18:27915964-27915986 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1155663982 18:28284818-28284840 TCCCAGTGGAAGGTCTTCAGGGG + Intergenic
1155694077 18:28662755-28662777 TCCCACTGGAAAGGCTTCAGGGG + Intergenic
1155822911 18:30400757-30400779 TCCCACTGGAAGGTTTTCAGGGG - Intergenic
1156326081 18:36076748-36076770 TCCCACTAGAAGATCTTCAGGGG - Intergenic
1156517185 18:37690326-37690348 TCCTACTGGGAGGTCTTCAGGGG - Intergenic
1156615073 18:38773142-38773164 TTCCACTGGAAGGTCTTCAGGGG + Intergenic
1156666658 18:39416635-39416657 TTCTACTCGAAGGACTTCAGGGG + Intergenic
1156974528 18:43202764-43202786 TCCCACTGGAGGGTCTTCAGGGG + Intergenic
1157052354 18:44181284-44181306 CCCCAGTGGGAGGTCTTCAGGGG + Intergenic
1157117373 18:44874756-44874778 TCCTACTCAGAGATCATCAGAGG + Intronic
1157129112 18:44986739-44986761 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1157443082 18:47724914-47724936 TCCTGCTGGGTGGTTTTCAGGGG + Intergenic
1157890860 18:51416359-51416381 TCCCACTAGAAGGTGTTCAGGGG + Intergenic
1158158578 18:54453821-54453843 TTCCACTGGAAGGTCTTCAGGGG + Intergenic
1158911869 18:62072002-62072024 TCCCACTGGAAGGTGTTCACAGG - Intronic
1159187221 18:64990781-64990803 TCCCACTGGAAGGTCTTTGGGGG - Intergenic
1159332362 18:67013511-67013533 TCCCACTGGAAGGTTTTCACTGG - Intergenic
1159870270 18:73753501-73753523 TCCCACTGGAAAGTCTTCAGGGG - Intergenic
1160368039 18:78346084-78346106 TTCCACTGGAAGGTCTTCAGGGG + Intergenic
1160457368 18:79011852-79011874 TCCCACTGGGAGGTCTCCTGGGG - Intergenic
1162413318 19:10519033-10519055 CCATGCTGGGAGATCTTCAGGGG - Intergenic
1163081643 19:14948152-14948174 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1164675715 19:30099483-30099505 TCCCACTGGAAGATCTTCAGGGG - Intergenic
1164802175 19:31086521-31086543 CCCCACTGGAAGATCTTCAGGGG + Intergenic
1165195661 19:34101016-34101038 TCTCATTGGAAGGTCTTCAGGGG - Intergenic
1165292969 19:34904288-34904310 GCCTACTGGAAGGTCTTCTTTGG - Intergenic
1165648264 19:37463740-37463762 TTCCACTGGAAGGTCTTCAGGGG - Intronic
1165699158 19:37924301-37924323 TCCCACTGGAAGGTCTTCGGGGG + Intronic
1166941637 19:46370420-46370442 TCCCACTGGAAGGTCCTCTGGGG + Intronic
1167653980 19:50751354-50751376 TCCCACTGGAAGATCTTCAGGGG - Intergenic
1168399163 19:56074080-56074102 TCCCCCTAGAAGGTCTTCAGGGG + Intergenic
925600226 2:5600964-5600986 TCCCACTGGAAGGTCTTCGGCGG + Intergenic
925630076 2:5882927-5882949 TCCCATTGGAAGGTTTTCAGGGG - Intergenic
925669836 2:6299793-6299815 TCCCACCAGAAGGTCTTCAGGGG - Intergenic
925740636 2:7002875-7002897 TCCCACTAGAAGTTCTTCAGGGG - Intronic
925808367 2:7674446-7674468 TCCTGCTGTAAGCTCTTCAGTGG + Intergenic
925915834 2:8605112-8605134 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
925959322 2:9001080-9001102 TCCCACTGAAAGGTCTTCAGGGG + Intronic
926303878 2:11623480-11623502 TCCCACTAGAAGGTCTTCAGGGG - Intronic
926317088 2:11718100-11718122 TCCTCTTGGGAGGTCCTCACTGG + Intronic
926433328 2:12813359-12813381 TCCACCTGGGAGGTCTTCCAGGG - Intergenic
928221979 2:29411207-29411229 TCCCACTGGAAGGTCTTCAGGGG + Intronic
928355310 2:30607765-30607787 TCTCACTGCAAGGTCTTCAGAGG - Intronic
928736879 2:34301351-34301373 TCCCACTGGAAGGTGTTCAGGGG + Intergenic
928874499 2:36021707-36021729 TCCCACTGGGAGGTGTTCAGGGG - Intergenic
928933238 2:36647146-36647168 TCCTACTGGAAAGTCTTCAAGGG - Intergenic
928956160 2:36870852-36870874 TCCCACTAGAAGGTCTTCAGGGG - Intronic
929240081 2:39645227-39645249 TCCCCTTGGAAGGTCTTCAGGGG + Intergenic
929253798 2:39787695-39787717 ACCCACTGGGAGGTATTCAGGGG - Intergenic
930144573 2:47988568-47988590 TCTCCCTGGAAGGTCTTCAGGGG - Intergenic
930169608 2:48237561-48237583 TCCCATTGGAAGGTCTGCAGGGG - Intergenic
930182818 2:48381806-48381828 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
930535450 2:52640226-52640248 TCCCACTGAAAGGTCTTCGGGGG - Intergenic
930985813 2:57586888-57586910 TCCCACTAGAAGGTCTTTAGGGG - Intergenic
931024747 2:58098000-58098022 TCCCCCTGGAAGGTCTTCAGGGG - Intronic
931260835 2:60617367-60617389 TCCCTCTGGTAGGTTTTCAGGGG - Intergenic
931324846 2:61209816-61209838 CCCACTTGGGAGGTCTTCAGAGG - Intronic
931423254 2:62147430-62147452 TCCCACTGGACGGTCTCCAGGGG - Intergenic
931898404 2:66760215-66760237 TCCCATTGGAAGGTCTTCAGGGG - Intergenic
931957930 2:67449571-67449593 TGCCACAGGAAGGTCTTCAGGGG - Intergenic
932444815 2:71772299-71772321 TCCCACTGGAAGGTCTACAGGGG - Intergenic
933120781 2:78534883-78534905 TCCCACTGGAAGGTCCTCAGGGG - Intergenic
933374100 2:81456998-81457020 TCCAACTAGAAGGTCTTCAGAGG - Intergenic
934029622 2:88031198-88031220 TCCCACTGGGGGGTCTTCAGGGG - Intronic
934486004 2:94711527-94711549 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
934544361 2:95202549-95202571 TCCCAGTGGAAGGTCTTCAAGGG - Intergenic
934690726 2:96356772-96356794 CTCTACTGAGAGGTCTTCGGAGG + Intronic
934962782 2:98691807-98691829 TCCCACTGGAAGGCCTTCAGGGG - Intronic
935080479 2:99788343-99788365 TCCCACTGGGAGGTCTTCAGGGG - Intronic
935083358 2:99821187-99821209 TCCCACTGGAAGGTCTTCAAGGG + Intronic
935178039 2:100666395-100666417 TCCCACTGAAACGTCTTCAGGGG - Intergenic
935423601 2:102896120-102896142 TTCCACTGGAGGGTCTTCAGGGG - Intergenic
935644408 2:105322052-105322074 TCCCACTGGAAGGTCTTCGGGGG - Intronic
935818668 2:106871727-106871749 TCCCACTGGAAGGTCTTCAGGGG + Intronic
935866289 2:107391263-107391285 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
936143540 2:109962675-109962697 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
936180223 2:110260638-110260660 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
936201148 2:110408791-110408813 TCCCACTGGAAGGTCTTCAGGGG - Intronic
936933664 2:117816501-117816523 TCCCACTGGAAGATCTTCAGGGG + Intronic
937260959 2:120586660-120586682 TGCTACTGGCAGGCTTTCAGGGG - Intergenic
937682694 2:124661457-124661479 TCCCATTGGTAGGTTTTCAGAGG + Intronic
937824222 2:126347730-126347752 CCCCGCTGGAAGGTCTTCAGGGG + Intergenic
938276766 2:130033114-130033136 TCCTATTGGGGACTCTTCAGAGG - Intergenic
938695905 2:133835333-133835355 TCCTACAGGGAGCTCTGCAGTGG + Intergenic
938789451 2:134663868-134663890 TCCTACTGTCAAGGCTTCAGTGG - Intronic
938886862 2:135658927-135658949 TCCCTCTAGAAGGTCTTCAGAGG + Intronic
939075766 2:137600857-137600879 TCCTACTAGAAGGTCTTCAGGGG - Intronic
939144197 2:138392662-138392684 TCTCACTGGAAGGTCTTCAGGGG - Intergenic
939330217 2:140749615-140749637 TCCCACTGGAAGGTCTTCAGGGG + Intronic
939694600 2:145308944-145308966 TCCTACTGGCCAATCTTCAGGGG - Intergenic
939866425 2:147478075-147478097 TCCCACTGGAAGGTCTTCAGCGG + Intergenic
939975539 2:148713233-148713255 TCCCACTGGAAGCTCTTTAGGGG - Intronic
940023005 2:149175841-149175863 TCCCACTGGAAGGTCTTCAGGGG + Intronic
940038605 2:149335245-149335267 TCCCACTGGAAGGTCTTCAGGGG - Intronic
940697578 2:156998716-156998738 TCTCACTGGAAGGTCTTCAGGGG + Intergenic
941074871 2:160995514-160995536 GCCCATTGGAAGGTCTTCAGGGG - Intergenic
941250743 2:163158703-163158725 TCCCATTGGAAGGTCCTCAGGGG + Intergenic
941549422 2:166896360-166896382 TCCCACTGGAAGGTTTTCAGGGG - Intronic
941891750 2:170589432-170589454 TCCCACTGGAAGGTCTTCAGAGG - Intronic
942151443 2:173079774-173079796 GCTCACTGGAAGGTCTTCAGGGG + Intronic
942264821 2:174212807-174212829 TCCCACTGGAAGGTCTTCAGGGG + Intronic
942266917 2:174237292-174237314 TCCCACAGGAAGGTTTTCAGGGG + Intronic
942493499 2:176513710-176513732 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
942920579 2:181368501-181368523 TCCCATTAGTAGGTCTTCAGGGG - Intergenic
943174950 2:184460003-184460025 TCCCACTGGAAGGTCTTCAGAGG - Intergenic
943265175 2:185721442-185721464 TCCCACTGGAAGGTCTTTAAGGG - Intergenic
943292270 2:186089198-186089220 TTCCACTGGAAGGTCTTTAGGGG + Intergenic
943346186 2:186739602-186739624 TCCTACTGGAAGGTCTTCAGGGG + Intronic
943404049 2:187457031-187457053 TCCTACTGGAAGGTCTTCAGGGG + Intergenic
943563275 2:189488596-189488618 TCCCCCTGGAAGGTCTTCAGGGG - Intergenic
943741977 2:191419662-191419684 TCCCACTGGAAAGTCTTCAGGGG - Intronic
943769307 2:191697887-191697909 TCCCACTGGAAGGTCTTGAGGGG + Intergenic
944009892 2:194962047-194962069 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
944034460 2:195277040-195277062 TCCCACTGGTAGATCTTCAGGGG - Intergenic
944317514 2:198299081-198299103 TCCCACTGGAAGGTCTTCAGGGG - Intronic
944879435 2:203996549-203996571 TCCCACCGGAAGGTCTTCAGGGG + Intergenic
944986107 2:205179010-205179032 TCCCACTGGAAGGTCTTCAGGGG - Intronic
945119720 2:206444308-206444330 TTCCACTGGGAGGTGTTTAGTGG + Intronic
945197246 2:207248432-207248454 TCCCACTGAAAGGTCTTCAGGGG - Intergenic
945226851 2:207540237-207540259 TCCCACTGGAATGTCTTCAAGGG - Intronic
945433079 2:209787956-209787978 TCCCAAAGGAAGGTCTTCAGGGG - Intronic
945637751 2:212378064-212378086 TCCCATTGGAAGGTCTTCACGGG + Intronic
945758012 2:213874511-213874533 TCCCACTGGAAGTTCTTCAGGGG + Intronic
945906019 2:215594193-215594215 TCTTACCAGAAGGTCTTCAGGGG - Intergenic
946016560 2:216608676-216608698 ACCTACTGAGAGGTCTCAAGAGG - Intergenic
946087066 2:217184834-217184856 TCCCACAGGAAGGTCTTCAAGGG + Intergenic
946678690 2:222190249-222190271 TTCTACTTAGAGCTCTTCAGTGG + Intergenic
946816407 2:223582972-223582994 TACCACTGGAAGGTCTTCAGGGG - Intergenic
947038133 2:225883391-225883413 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
947410010 2:229827595-229827617 TCCCACTGGAAGGTCTTCAGGGG + Intronic
947527514 2:230887894-230887916 TCCCACTGGAAGGACTTCAGAGG - Intergenic
947675011 2:231971037-231971059 TCCTGCTGAAAAGTCTTCAGGGG + Intronic
947980770 2:234407486-234407508 TCCCACTGGAAGGTTTTCAGGGG - Intergenic
948199377 2:236119081-236119103 TCCTCCTGGGGGGTCTACAGAGG - Intronic
1168936062 20:1665999-1666021 TCCCACTGGAAGGCCTTCAGGGG - Intergenic
1169057882 20:2638599-2638621 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1169685260 20:8264258-8264280 TCCCACTGGAAGGTCTGCAGGGG + Intronic
1170041889 20:12047609-12047631 GTCCACTGGGAGGTCTTTAGGGG - Intergenic
1170120335 20:12904756-12904778 TCCTGCTGGAAGGTCTTCAGGGG - Intergenic
1170334842 20:15257914-15257936 TCCCACTGGGAGGTCTTCAGGGG - Intronic
1170381796 20:15768936-15768958 TCTCACTGGAAGGTCTTCAGGGG + Intronic
1170515456 20:17125118-17125140 TCCCACTGGAAGGTTTTTAGGGG + Intergenic
1170828790 20:19821445-19821467 TCCTACTCAGAAGTATTCAGTGG + Intergenic
1170881492 20:20300387-20300409 TCCCACTGGAAGGGCTTCAGAGG - Intronic
1172004935 20:31812561-31812583 TCCTATAGGGAGGTGTCCAGTGG + Intergenic
1172068501 20:32238938-32238960 TCCCAAAGGGTGGTCTTCAGAGG + Intergenic
1172318377 20:33974820-33974842 TGCCACTGGAAGGTCTTCGGCGG - Intergenic
1172667262 20:36608972-36608994 TCCCACTGGGAGTTATACAGGGG + Intronic
1173029817 20:39344890-39344912 CCCTACTAGAAGGTATTCAGGGG - Intergenic
1173351931 20:42253378-42253400 TCCCACTGGAAGCCCTTCAGTGG + Intronic
1174114020 20:48214630-48214652 TCCCATTGGGAGGTCAGCAGGGG + Intergenic
1174884490 20:54317446-54317468 TCCCACTAGAAGGTCTTCAGGGG + Intergenic
1175549419 20:59807387-59807409 TCCCACTGGAAGATCTTCAGGGG + Intronic
1175582200 20:60108893-60108915 TCCCACTGGACGGTCATCAGAGG - Intergenic
1175652977 20:60744209-60744231 TCCCATTGGAAGGTTTTCAGGGG - Intergenic
1176068011 20:63209811-63209833 CCCCACTGGAAGGTATTCAGGGG + Intronic
1177447765 21:21219807-21219829 TCCCACTGGAAAGTCTTCAGGGG - Intronic
1177572269 21:22902604-22902626 TCCCACTGCAAGATCTTCAGGGG - Intergenic
1177664383 21:24134834-24134856 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1177737936 21:25116329-25116351 TCCCACTGAAAGGCCTTCAGGGG + Intergenic
1178380132 21:32100705-32100727 TCCTCCTGGGAGGTCTCCCTAGG + Intergenic
1178946818 21:36955174-36955196 TCCTCCTGGAAGGTCTTCACGGG - Intronic
1179410323 21:41157473-41157495 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1179578554 21:42322882-42322904 TGCTTCCGGGGGGTCTTCAGGGG + Intergenic
1180021650 21:45132268-45132290 TCCTATTGGAAGGTCGGCAGTGG + Intronic
1180129309 21:45816627-45816649 TCCCGCTGGAAGGTCCTCAGGGG + Intronic
1180684550 22:17655188-17655210 TCCCACTGGACAGTCTTCAGAGG + Intronic
1181077806 22:20393261-20393283 TCCTACTGAGAGGTGGTCCGGGG - Intergenic
1182112104 22:27731218-27731240 TCCTTCTGGAAGGCCTTCAGTGG + Intergenic
1182675758 22:32038238-32038260 CCCCACTGAAAGGTCTTCAGGGG - Intergenic
1182869223 22:33631566-33631588 TCCCACTGGAAGGTCCTCAGGGG + Intronic
1182879172 22:33718670-33718692 TTTCACTGAGAGGTCTTCAGGGG - Intronic
1182975065 22:34616138-34616160 TCCCACTGGAAGGGCTTCAGAGG - Intergenic
1183100824 22:35583109-35583131 GCCCACTGGCAGATCTTCAGGGG + Intergenic
1184307964 22:43620586-43620608 TCCTATAGGAAGTTCTTCAGGGG + Intronic
1184752602 22:46496737-46496759 TCCCATCGGGAAGTCTTCAGAGG + Intronic
1185125169 22:49006587-49006609 TCCAACTGGTGGGTCTGCAGAGG - Intergenic
949668625 3:6371320-6371342 TCACACTGGACGGTCTTCAGAGG + Intergenic
949729019 3:7085702-7085724 ACATACTTGGAGGGCTTCAGTGG + Intronic
949849559 3:8409262-8409284 ACCCACTGGGAGGTCTCCAGGGG - Intergenic
950245694 3:11415672-11415694 ACCCACTGGAAGGTCTTCAGGGG + Intronic
950277890 3:11679237-11679259 TCCCACTGGAAGGTCTTCAGGGG - Intronic
950537249 3:13586071-13586093 TCCCGCTGGGACGTCTTAAGGGG - Intronic
951527383 3:23666687-23666709 TCCCACTGGAAGGTTTTCAGGGG + Intergenic
951999070 3:28764135-28764157 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
952033003 3:29167039-29167061 CCCGACTGGAAGGTCTTCAGGGG + Intergenic
952114278 3:30160378-30160400 TTCCACTGGAAGGTCTTCAGGGG - Intergenic
952178920 3:30897043-30897065 TCGCGCTGGAAGGTCTTCAGGGG + Intergenic
952363280 3:32652307-32652329 TCCCACTGGAAGTTCTCCAGAGG - Intergenic
952502330 3:33975321-33975343 TTCCAATGGAAGGTCTTCAGTGG + Intergenic
952670565 3:35962207-35962229 TGCTACAGTGATGTCTTCAGGGG - Intergenic
953247701 3:41210554-41210576 TCCTTCTGGAATGTCTTCAGAGG + Intronic
953638121 3:44680277-44680299 TCCCACTGGAAGGTCTTCCCGGG + Intergenic
953819797 3:46196778-46196800 TCCCACTGGAAGGCCTTCAGGGG - Intronic
954174174 3:48830327-48830349 TACCACTGGAAGGTCTTTAGGGG + Intronic
954377699 3:50203756-50203778 TCCCACTGGCAGTTCTTGAGGGG - Intergenic
954585035 3:51726533-51726555 TCCCACTGGAAGGTCGTCAGGGG - Intergenic
954924818 3:54224162-54224184 TCCCACTGGAAGGCCTTCATGGG + Intronic
954975845 3:54693663-54693685 TCCCACTGGAAGGTCTTCAGGGG - Intronic
955138446 3:56244501-56244523 TCCCACTGGAAGGTCTTCAGGGG - Intronic
955308261 3:57856548-57856570 TCCCACTGAAAGGTCTTCAGGGG + Intronic
955371717 3:58357379-58357401 TCCCACTGGAAGGTCTTCTGGGG + Intronic
955540150 3:59967134-59967156 TCCCACTGAAAGGCCTTCAGGGG + Intronic
955607083 3:60716500-60716522 TCCAACTGGCAGGTCTTCAGGGG + Intronic
956139648 3:66132508-66132530 TCCCAGTGGCAGATCTTCAGTGG - Intergenic
956210949 3:66800783-66800805 TCCCACTGGAAGGTCTTCAGTGG - Intergenic
956427357 3:69150329-69150351 TCCCACTGGAAGGTCTTCAAGGG - Intergenic
956896057 3:73661093-73661115 TCTCACTGGAAGGTCTTCAGGGG + Intergenic
956955227 3:74330717-74330739 TCTCACTGGGAGGTCTGCAGGGG - Intronic
956963253 3:74428374-74428396 TGCCACTGGAAGATCTTCAGGGG - Intronic
956996747 3:74834505-74834527 TCCCACTGGAAGGTCCTCAGGGG + Intergenic
957275589 3:78087031-78087053 TCCCACTGGAAGGTATTCAGGGG + Intergenic
957310004 3:78507449-78507471 ACCTTCTGCTAGGTCTTCAGGGG + Intergenic
957460485 3:80512076-80512098 TCCCACTGGAAGCTCTTCAGGGG - Intergenic
957592146 3:82213154-82213176 TCCCATTGGAAGATCTTCAGGGG - Intergenic
957656195 3:83080017-83080039 TCCCACTTGAAGGTCTTCAGTGG + Intergenic
957820741 3:85370811-85370833 TCCCAGTGGAAAGTCTTCAGGGG - Intronic
957838652 3:85636209-85636231 TCCCACTGGAAGGTCTTCAAGGG - Intronic
958168043 3:89902469-89902491 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
958437200 3:94111704-94111726 TCCCACTGGAAGGTCTTCAGGGG + Intronic
958514931 3:95102020-95102042 TTCCACAGGAAGGTCTTCAGAGG + Intergenic
958587409 3:96107320-96107342 TCCCACTGGAAGGTCTTCAAGGG + Intergenic
958647824 3:96895156-96895178 TCCCACTGAAAGGTCTTCAGGGG - Intronic
958761540 3:98315014-98315036 TGCCACTGGAAGGTCTTTAGGGG - Intergenic
958948471 3:100391382-100391404 TCCCACTGGAAGATCTTCAAGGG - Intronic
959184039 3:103021574-103021596 TCTCACTGGAAGGTCTTCAGGGG - Intergenic
959204659 3:103290556-103290578 TCCCACTGGAAGATCGTCAGGGG - Intergenic
959251328 3:103951178-103951200 TACCACTGGAAAGTCTTCAGGGG - Intergenic
959272009 3:104223680-104223702 TCCCACTGGAAGGTTTTCAGGGG - Intergenic
959386839 3:105719843-105719865 TCCCACTGGAAGGTCTTCAGGGG - Intronic
959417451 3:106093432-106093454 TTCCACTGGAAGGTCATCAGGGG + Intergenic
959569933 3:107872431-107872453 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
959636007 3:108571088-108571110 TCCCACTGGAAGGTCTTCAGGGG + Intronic
959709014 3:109366225-109366247 TCCCATTGGAAGGTCTTCAGAGG + Intergenic
959845913 3:111033231-111033253 TCTTGCTGGAAGGTCTTCAGGGG - Intergenic
959967188 3:112369694-112369716 TCCCACTGAAAGATCTTCAGAGG - Intergenic
960129494 3:114039611-114039633 TCTCACTAGAAGGTCTTCAGGGG - Intronic
960135920 3:114104918-114104940 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
960458812 3:117907409-117907431 TCCCACTGGAAAGTCTTCAGGGG - Intergenic
960567507 3:119149389-119149411 TCCCACTGGAAGGTCTTCAGAGG + Intronic
961098654 3:124179385-124179407 TCTCACTGGAAGGTCTTCAGGGG + Intronic
961204547 3:125071195-125071217 CCCCAGTGGCAGGTCTTCAGGGG + Intergenic
961617001 3:128190282-128190304 TTCCACTGGAAGGTCTTCAGAGG - Intronic
962208397 3:133455002-133455024 TCCCACTGAAAGGTCTTCAGGGG + Intronic
962256643 3:133874919-133874941 TCCCACTAGAAGGTCTTCAAGGG + Intronic
962495076 3:135931417-135931439 AGCTACTGAAAGGTCTTCAGGGG - Intergenic
962828015 3:139116582-139116604 TCCCACTGGAAGGTCTTCAGGGG + Intronic
962885594 3:139623323-139623345 TCCCACTAGAAGGTCTGCAGGGG + Intronic
962914701 3:139889682-139889704 TTCCACTAGAAGGTCTTCAGGGG - Intergenic
963134995 3:141894681-141894703 CCCCACTGGAAGGTCTTCAGGGG + Intronic
963144550 3:141979499-141979521 TCCTACTGGAAGGTCTTCAGGGG - Intronic
963216033 3:142749487-142749509 TCCCAATGGAAGGTCTTCAGGGG - Intronic
963258132 3:143166860-143166882 TCCCACTGGAAGGTCTTCACGGG - Intergenic
963608558 3:147436290-147436312 TCTTACTAGAAAGTCTTCAGGGG + Intronic
963886531 3:150588976-150588998 TCTCACTGGAAGGTGTTCAGGGG - Intronic
964147162 3:153478408-153478430 TCCCACTGGAAGGTTTTCAGGGG + Intergenic
964397033 3:156256612-156256634 GCCCACTGGTAAGTCTTCAGTGG - Intronic
964423103 3:156525259-156525281 TTCCTCTGGGAAGTCTTCAGGGG - Intronic
964430541 3:156601531-156601553 CCCCACTGGAAGGTTTTCAGGGG + Intergenic
964592613 3:158382193-158382215 TCCCATTGGAAGATCTTCAGGGG + Intronic
964780649 3:160333656-160333678 TCCCACTGGAAGGTCTTCAGGGG + Intronic
964965532 3:162488090-162488112 TCCTATTGGAAGGTTTTCAGAGG + Intergenic
964987261 3:162759189-162759211 TCCCACTGGGAGTTCTGCAGGGG - Intergenic
965258459 3:166446900-166446922 TGTCACTGGAAGGTCTTCAGGGG + Intergenic
965364988 3:167787162-167787184 TCCCACTAGATGGTCTTCAGGGG + Intronic
965555508 3:170014191-170014213 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
965749660 3:171962758-171962780 TCCTCCTGAGAGGGCTTCACAGG + Intergenic
965990600 3:174812665-174812687 TCTCACTGGAATGTCTTCAGGGG - Intronic
966110430 3:176394610-176394632 TCCCACTGGGAGGTTTTCAGGGG + Intergenic
966343241 3:178949142-178949164 TCCCACTGAAAGGTCTTCAGGGG + Intergenic
966438487 3:179917219-179917241 TCCCACTGGAAAGTCTTCTGGGG + Intronic
966618378 3:181937282-181937304 TCCCACTGGAAGGTTTTCAAGGG - Intergenic
966628078 3:182040946-182040968 TCCCACTGGAAGGTTTTCAGAGG + Intergenic
967127707 3:186439914-186439936 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
967939056 3:194752510-194752532 TCCTACCGGAAGCTCTTCAGGGG + Intergenic
968057057 3:195699778-195699800 TCTCTCTGGAAGGTCTTCAGGGG + Intergenic
968255713 3:197268964-197268986 TACCACTGAAAGGTCTTCAGAGG + Intronic
968462131 4:731448-731470 TCCTGCAGGGAGGTCCTCAGGGG + Intronic
968723322 4:2224264-2224286 TCCCCCTGGAAGGTCTTCAGAGG + Intronic
969210018 4:5680066-5680088 TCCCACTGGAAGGTCTTCAGAGG + Intronic
969695421 4:8731542-8731564 TCCTCCCTGGAGGGCTTCAGGGG - Intergenic
969906311 4:10399535-10399557 TCCCACTGGAAGGTCTCCAAGGG + Intergenic
969925393 4:10580507-10580529 TCCTACTAGAAGGTCTTCAGGGG - Intronic
969928327 4:10606313-10606335 TCCCACTGGAAGGTCGTCAGGGG + Intronic
970634905 4:17998555-17998577 TCCCACTGGAAAATCTTCAGGGG + Intronic
970673284 4:18419474-18419496 TCCAAATGGAAGGTCTTCAGGGG + Intergenic
970742930 4:19259123-19259145 TCCCACTGGAAAATCTTCAGGGG - Intergenic
970845898 4:20536976-20536998 TCCCAGTGGAAGGTCTTCAGGGG + Intronic
970889051 4:21021680-21021702 TCCTGCTGGAAGGTCTTTAGGGG + Intronic
970984268 4:22137518-22137540 TTCCACTGGAAGATCTTCAGGGG + Intergenic
971001988 4:22333648-22333670 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
971047675 4:22823596-22823618 TCCCACTGGAAGGTTTTCAGGGG - Intergenic
971383677 4:26123825-26123847 TTCCACTGGAAGGTCTTCAGGGG + Intergenic
971791295 4:31173150-31173172 TCCCACTGAGAGGTCTTCATGGG - Intergenic
971822967 4:31583066-31583088 TCCCACTGGGAGGTCTTCAGGGG - Intergenic
971965230 4:33545897-33545919 TCCCACTGGAAAGTCTTCAGGGG - Intergenic
972030318 4:34448550-34448572 ACCCACTGGAAGGTCTTCAGGGG - Intergenic
972258745 4:37386747-37386769 ACCTAGTGGGAGGTGTTCATGGG + Intronic
972452680 4:39218985-39219007 TCCCACTGAAAGGTCTTCAGCGG + Intronic
972748622 4:41966613-41966635 TTCCACTGGAAGGTCTTCAGGGG - Intergenic
972878392 4:43394315-43394337 TCCCATTGGAAGGTTTTCAGGGG - Intergenic
973048225 4:45563326-45563348 TCTTACTGTGAGGTCTTCCCTGG + Intergenic
973086678 4:46071610-46071632 TCCCACTAGAAGGTCTTCAGGGG - Intronic
973286890 4:48428521-48428543 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
974204679 4:58686058-58686080 TCCCAGTGGAAGGTCTTCAGGGG - Intergenic
974362801 4:60903811-60903833 TCCCACTGGACAGTCTTCAGGGG - Intergenic
974667276 4:64980259-64980281 TACCACTGGAAGGTCTTCAACGG - Intergenic
974679253 4:65139761-65139783 TCCCACGAGTAGGTCTTCAGGGG - Intergenic
974855095 4:67452074-67452096 TCCCACTGAAAGGTCTTCAAGGG + Intergenic
975077617 4:70231833-70231855 TCCTACTGGAAGATCTTCAGGGG - Intronic
975200779 4:71585874-71585896 TCCCACTAGAAGATCTTCAGGGG - Intergenic
975278568 4:72533324-72533346 TCCCACTGGAAGGTCTTCAGAGG + Intronic
975545112 4:75552368-75552390 TTCCACTGGAAGATCTTCAGGGG + Intergenic
975564712 4:75741990-75742012 TTCCACTGGAAGGTCTTCAGGGG + Intronic
975601885 4:76109361-76109383 TTCCACTGGAAGGTCTTCAGGGG + Intronic
975663784 4:76713447-76713469 TCCCTCTGGAAGGTCTGCAGGGG + Intronic
975686739 4:76923342-76923364 TCCCACTGGAAGGTCTTTGGTGG - Intergenic
976002903 4:80393005-80393027 TCCCACTGGAAAGTCTTCAGGGG - Intronic
976072373 4:81256433-81256455 TCCATCTGGGTGGTCTTCAGGGG + Intergenic
976463795 4:85344359-85344381 GCCTAATGGGAGGTTTTCATGGG + Intergenic
977263819 4:94831108-94831130 TCCCACTAGAAGGTCTTCAGGGG - Intronic
977676349 4:99752198-99752220 TCCCACTGGAAGGTCTTTGGGGG + Intergenic
977741552 4:100490049-100490071 TCCCACTGGAAGGTCTTCAAGGG - Intronic
977831696 4:101601922-101601944 TTCCACTGGAAGGTCTTTAGAGG - Intronic
977841005 4:101704623-101704645 TCTCACTGGAAGGTCTTCAGGGG + Intronic
977991140 4:103443994-103444016 TCCCACTGTATGGTCTTCAGGGG - Intergenic
978047867 4:104154453-104154475 TCCCACTGAAAGGTTTTCAGTGG - Intergenic
978101357 4:104844357-104844379 TCCCATTGGAAGGTCTTCAGTGG - Intergenic
978484799 4:109239996-109240018 TCTCACTGGAAGGTCTTCAGGGG + Intronic
978610471 4:110533017-110533039 TTCCACTGGAAGGTTTTCAGTGG + Intronic
978715469 4:111837526-111837548 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
978824473 4:113004491-113004513 CTCCACTGGAAGGTCTTCAGGGG + Intronic
979194734 4:117906999-117907021 CCCTACTATAAGGTCTTCAGGGG - Intergenic
979365963 4:119823989-119824011 TCCCACTGGAAGGTCTTCAGTGG + Intergenic
979504039 4:121474263-121474285 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
979681106 4:123460854-123460876 TTCCACTGGAAGGTCTTCAGGGG - Intergenic
979765154 4:124455592-124455614 TCTCACTGGAAGGTCTTCAGGGG + Intergenic
979794290 4:124827125-124827147 TCCGACTGGAAGGTCTTCATGGG - Intergenic
980069755 4:128231041-128231063 TCCTACCAGAAGGTCTTCAGGGG - Intergenic
980158208 4:129132008-129132030 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
980164976 4:129214934-129214956 TCCCATTGGGAGGTTTTCAGGGG - Intergenic
980199072 4:129631031-129631053 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
980223973 4:129956982-129957004 TCCTACTGGAAGGTCTTTAAAGG - Intergenic
980350398 4:131676380-131676402 TCCCACTGGAAGGTCTTCCAGGG - Intergenic
980408800 4:132388107-132388129 TCCTACTGGAATGTCTTCAGGGG - Intergenic
980515581 4:133854256-133854278 TCCCTCTGGAAGGTCTTCAGGGG - Intergenic
980578688 4:134719517-134719539 TCATACTGGCAGGTTTTCAGGGG - Intergenic
980867608 4:138571801-138571823 TCCCACTGAAAGGTCTTCAGGGG + Intergenic
981037012 4:140182196-140182218 TCCCACCGGAAGGTCTTCAGGGG - Intergenic
981041140 4:140223261-140223283 TCCTTCTGAAAGGTCTTCACGGG + Intergenic
981125478 4:141101420-141101442 TCCCATTGGAAGGTCTTCAGGGG + Intronic
981173856 4:141657705-141657727 TCTCACTGGAAGGTCTCCAGGGG + Intronic
981202787 4:142001285-142001307 TCCCCCTGGAAGGTCTCCAGGGG + Intergenic
981674714 4:147328557-147328579 TCCAACTGGAAGGTCTCCAGGGG - Intergenic
981811314 4:148778882-148778904 TTCCACTGGAAGGTCTTCAGGGG + Intergenic
981914618 4:150020620-150020642 TCCCGCTGGAAGGTCTTTAGGGG + Intergenic
981943182 4:150308625-150308647 TCCCACTGGAAGGTCTTCAGGGG - Intronic
982027871 4:151269943-151269965 TCCCACTGGAAGGTGTTCAGGGG + Intronic
982082320 4:151802556-151802578 TCCCACTGGCAGGTCTTCAGGGG - Intergenic
982154557 4:152505631-152505653 TCCCACTGGAAGGTCTTCAGAGG + Intronic
982277308 4:153649596-153649618 TCCTGCTCGAAGGTGTTCAGGGG + Intergenic
982561604 4:156934866-156934888 TCCCACTGGAAGGTTTTCAGGGG + Intronic
982802431 4:159721882-159721904 TCCCACTGGAAGTTCTTCCGGGG + Intergenic
982950007 4:161682633-161682655 TCCCACTGGAAGGTCTTCAAGGG + Intronic
983254707 4:165384792-165384814 TCATACAGGGAGCTCTTCAGGGG + Intronic
983366751 4:166800470-166800492 TCCCACTGGAAGCTCTTCAGGGG - Intronic
983422317 4:167534753-167534775 TCCCACTTAAAGGTCTTCAGAGG - Intergenic
983474859 4:168201475-168201497 TCCCACTGGAAGGTTTTCAGGGG + Intergenic
983483462 4:168304234-168304256 TCCCACTGGAAAGTCTTCAGGGG - Intronic
983493338 4:168414216-168414238 TGCTAAAGGGAGTTCTTCAGTGG + Intronic
983578199 4:169281552-169281574 TCTTACTGGAAGGTTTTCAGGGG - Intergenic
983757061 4:171351861-171351883 TCCCACTGGAAAGTCTTCACGGG - Intergenic
983776743 4:171617156-171617178 TCCCACTAGAAGTTCTTCAGGGG + Intergenic
984057710 4:174949632-174949654 TCCTACAAGTAGATCTTCAGAGG - Intronic
984276868 4:177621413-177621435 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
984787089 4:183577474-183577496 TGCCACTGGAAGGTCTTCAGGGG - Intergenic
985060688 4:186074913-186074935 TCCCACTGGAAGCTCTTTAGGGG + Intronic
985138068 4:186809240-186809262 TCCCACTGGGAGGGCTTCAGGGG + Intergenic
985235946 4:187874410-187874432 TCTCACTGGAAGGTCTTCAGGGG + Intergenic
985294007 4:188415211-188415233 TCCCACGGGAAGGGCTTCAGGGG - Intergenic
985796416 5:1965417-1965439 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
985974185 5:3402337-3402359 TCCCACTAGAAGGTCTTCAGAGG - Intergenic
986285751 5:6357315-6357337 CCCCCCTGGGATGTCTTCAGGGG - Intergenic
986447429 5:7834177-7834199 TCCCACTGGAAGGTCTTCAAAGG - Intronic
987040021 5:14053592-14053614 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
987766390 5:22236846-22236868 GTCCACTGGAAGGTCTTCAGGGG + Intronic
988003281 5:25377479-25377501 TCCTAAAGGGAGGCCTTCTGCGG - Intergenic
988080978 5:26415199-26415221 TCCTACTGGAAAGTCATCATGGG - Intergenic
988226341 5:28416653-28416675 GTCCACTGGAAGGTCTTCAGGGG + Intergenic
988661495 5:33274832-33274854 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
988960092 5:36361597-36361619 TCCCACTGGAAGGTCATCAGGGG + Intergenic
989037503 5:37191079-37191101 TTCTACTGGAAAGTCTTCAGGGG - Intronic
989135138 5:38146475-38146497 TCCCACTGGAAGGTCTTCAGAGG - Intergenic
989337381 5:40334409-40334431 TCCAACTGGAAGGTCTTCACAGG + Intergenic
989761044 5:45017101-45017123 TACCACTGGAAGGTCTTCAGGGG - Intergenic
990091015 5:52049072-52049094 TCCCACTGGAAGGTCTTCAGGGG - Intronic
990527362 5:56641080-56641102 TGCTACTGGGAGGACATAAGAGG + Intergenic
990813927 5:59761661-59761683 TCCCACTGGAAGCTCTTCTGGGG + Intronic
990847475 5:60159192-60159214 TCCCACTGGAAGGTCTTTAGGGG + Intronic
991065422 5:62419542-62419564 TCTCACTGGAAGGTCTTCGGGGG + Intronic
991072491 5:62499929-62499951 TCCCACTAGAAGGTCTTCTGGGG + Intronic
991375912 5:65966805-65966827 TCTGACTGGAAGGTCTTCAGGGG - Intronic
991708124 5:69379765-69379787 GTCCACTGGAAGGTCTTCAGAGG + Intronic
992057954 5:73011578-73011600 TACTACTGGAAGGTCTTCAGGGG + Intronic
992065391 5:73103066-73103088 TCCCACTGGAAGGTCCTCAGGGG + Intergenic
992501014 5:77343992-77344014 TCCCACTGGAAGGTCCTCAGGGG + Intronic
992517953 5:77515370-77515392 TCCCATCAGGAGGTCTTCAGGGG + Intronic
992671462 5:79065153-79065175 TCCCACTGGAAGGTCTTCAGGGG + Intronic
992686608 5:79205459-79205481 TGCCATTGGGAGGTCGTCAGGGG - Intronic
992705935 5:79392314-79392336 TCCCACTAGAAGGTCTTCAAGGG - Intronic
992901785 5:81303539-81303561 TCCTACTGGAAGGTTTTCAGGGG + Exonic
992943127 5:81782684-81782706 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
993088551 5:83395369-83395391 GCCCACTGGAAGGTCTTCAGGGG + Intergenic
993089511 5:83407791-83407813 TCCCACTGGAAGGCCTTCAGGGG + Intergenic
993461241 5:88184986-88185008 TACCACTGGAAGGTCTTCAGGGG + Intergenic
993469788 5:88293395-88293417 TCCCACTGGAAGTTCTTCAGGGG - Intergenic
993522915 5:88926686-88926708 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
993853396 5:93039474-93039496 TTTCACTGGAAGGTCTTCAGGGG - Intergenic
993894241 5:93512151-93512173 TCCCACTGGGAGCTCTTCAAGGG - Intergenic
993954896 5:94220247-94220269 TCCCACTGGAAGTTCTTCTGGGG + Intronic
994053217 5:95385725-95385747 TCCCACTGGAAAATCTTCAGGGG - Intergenic
994111799 5:96014267-96014289 TCCCACTGGAAGGTTATCAGGGG + Intergenic
994638106 5:102367738-102367760 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
994680300 5:102878606-102878628 TCCTCCTGGAAGGTGTTCAGGGG - Intronic
994938109 5:106282817-106282839 TCCTCTTTGGAAGTCTTCAGTGG - Intergenic
995488782 5:112667588-112667610 TCCCACTGGAAGGTCTTCAGAGG + Intergenic
995720562 5:115127914-115127936 TCCCACTGGAAGGTCTTCTGGGG - Intronic
995900249 5:117057267-117057289 TCCCACTGGAAGATTTTCAGGGG - Intergenic
995933142 5:117475288-117475310 TCCTATTATGAGGTCTACAGAGG + Intergenic
995993420 5:118270163-118270185 TGCTACAAGGAGCTCTTCAGTGG - Intergenic
996419820 5:123250281-123250303 TCCCATTGGAAAGTCTTCAGGGG - Intergenic
998067004 5:139167368-139167390 TCCCACTGGAAGGTCTTCAGGGG - Intronic
998135005 5:139669908-139669930 CCCTACTGGGAGGTGCTCCGAGG + Intronic
998258276 5:140606859-140606881 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
998281633 5:140814325-140814347 TCCCACTGGAAGGTCTTCTGGGG + Intronic
998578006 5:143338452-143338474 TCCCACTGGAAGGCCTTCAGGGG - Intronic
998615845 5:143739624-143739646 TCCGACTGGAAGGTCTTCAGGGG + Intergenic
998791510 5:145770607-145770629 TCCCATTGGAAAGTCTTCAGGGG - Intronic
998794716 5:145806418-145806440 TCCCACTGGAAAGTCTTCAGGGG + Intronic
998898981 5:146831891-146831913 TCCCACTGGAAGGCCTTCAAAGG - Intronic
998981163 5:147704033-147704055 TCCCACTAGAAGGTCTTCAGGGG + Intronic
999077569 5:148811433-148811455 TCCTACTGGAAGGCCTTTAAGGG + Intergenic
999215208 5:149927949-149927971 TCCCCCTGGAACGTCTTCAGGGG + Intronic
999389151 5:151177564-151177586 TCCCACTGGGACCTCCTCAGTGG - Intergenic
999629682 5:153557802-153557824 TCCGGCTGAAAGGTCTTCAGTGG + Intronic
1000425818 5:161090144-161090166 TCTCACTGGAAGGTCTTCAGGGG + Intergenic
1000695164 5:164371674-164371696 TCCCACTGGAAGGTCCTTAGGGG - Intergenic
1000709283 5:164550659-164550681 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1000950175 5:167472142-167472164 TCCAAATTGGATGTCTTCAGTGG - Intronic
1001078490 5:168648282-168648304 TCCCACTGGAAGGTCTTCAGTGG - Intergenic
1001153784 5:169255343-169255365 TCCCACTGGTAAGTCTTCAAGGG - Intronic
1001395221 5:171414395-171414417 TCTCACTGGAAGGTCTTCAGGGG + Intergenic
1001822459 5:174720924-174720946 TCCTAATGGGAGCTCGTTAGCGG - Intergenic
1002089182 5:176794432-176794454 TCCGACTGGGAGGGCTGGAGTGG + Intergenic
1002385572 5:178863745-178863767 CCCCACTGGAAGGTCTTCAGGGG - Intronic
1002972633 6:2039693-2039715 TCCTGCTGGAAGGTCTTCAGGGG + Intronic
1003749415 6:9039930-9039952 TTCTCCAGGGAGGGCTTCAGGGG - Intergenic
1004524723 6:16396138-16396160 TCCATCTGTAAGGTCTTCAGAGG - Intronic
1004578634 6:16925249-16925271 TTGCACTGGAAGGTCTTCAGGGG + Intergenic
1004587709 6:17018203-17018225 TCCCACTGGGAGGTCTTCACGGG - Intergenic
1004591014 6:17051759-17051781 TCCCACTGGAAGCTCTTCAGGGG - Intergenic
1004779134 6:18886410-18886432 TCCCGCTGGGAGGCTTTCAGAGG - Intergenic
1004891305 6:20103200-20103222 CCATTGTGGGAGGTCTTCAGAGG - Intronic
1004948863 6:20645922-20645944 TCCCACTGGAAGATCTTCAGGGG + Intronic
1005105076 6:22215237-22215259 TCCCAGTAGAAGGTCTTCAGGGG - Intergenic
1005124995 6:22436841-22436863 TCCCACTGGGAGGTCTTCAGGGG + Intergenic
1005279245 6:24254135-24254157 TCCCAGTGGAAGGTCTTCAGAGG + Intronic
1005308697 6:24538574-24538596 CCCCGCTGGAAGGTCTTCAGGGG + Intergenic
1005776760 6:29141452-29141474 TCCCACTGGAAGGTTTTCAGGGG + Intergenic
1006097425 6:31664826-31664848 TCCTACTGGTATGTCTTACGGGG - Exonic
1006332417 6:33401624-33401646 TCTCACTGGAAGATCTTCAGGGG + Intronic
1006506241 6:34490628-34490650 TCCAACTAGCAGGTCTTCAGAGG + Intronic
1006960327 6:37923384-37923406 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1006965745 6:37982850-37982872 TCCTACTGGAAGGTCTTCAGGGG - Intronic
1007020038 6:38510812-38510834 TCCCACTGGAAGGCCTCCAGGGG + Intronic
1007103241 6:39265657-39265679 TCCCACTGGAAGGTCTTCAGAGG - Intergenic
1007127394 6:39438419-39438441 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1007869358 6:45015878-45015900 TCCCACTGGAAGGTCTTCAAGGG + Intronic
1008001871 6:46369184-46369206 TCCCACTGGAAGGTCTTCAAGGG + Intronic
1008627370 6:53330914-53330936 TCCCACTGGAAGGCCTTCAGGGG + Intronic
1008772069 6:54991623-54991645 TCCCATTGGAAGGTCTTCAGGGG - Intergenic
1008901654 6:56625848-56625870 TCCCATGGGAAGGTCTTCAGGGG - Intronic
1009319659 6:62271605-62271627 TCCTACTGGGAGGTCTTCAGGGG - Intronic
1009342615 6:62575893-62575915 TCCCACTGGAAGGTTTTCAGAGG + Intergenic
1009410689 6:63362048-63362070 TCCCACTGGAAGTTCTTCAGAGG + Intergenic
1009557889 6:65198217-65198239 TCCCACTGGAAGGTGTGCAGGGG + Intronic
1009586276 6:65608878-65608900 TCCCACAGAAAGGTCTTCAGAGG + Intronic
1010026995 6:71230405-71230427 TCCCACTGGAAGATCTTCAGGGG - Intergenic
1010588032 6:77678819-77678841 TCCCACCGGAAGGTCTTCAGGGG - Intergenic
1011249158 6:85352693-85352715 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1011456771 6:87558950-87558972 TCCCACTGGAAAGTCTTCAGGGG - Intronic
1011885927 6:92095662-92095684 TCCCTCTGGAAGGTCTTCAGGGG - Intergenic
1011934627 6:92759949-92759971 TCCTGCTGGAAGGTCTTCAGGGG - Intergenic
1012077086 6:94703056-94703078 TCCCACTGGAAGGTCTTCAAGGG + Intergenic
1012114848 6:95283964-95283986 TCCCACTGAAAGGTCTTCAGGGG - Intergenic
1012146473 6:95690109-95690131 TTTCACTGGAAGGTCTTCAGGGG - Intergenic
1012152485 6:95771862-95771884 TTCCACTGAGAGGTCTTCAGGGG - Intergenic
1012178348 6:96118751-96118773 TCTCACTGGGAGGTCTTCAGGGG - Intronic
1012236536 6:96823302-96823324 TCCCACCGGAAGGTCTTCAGGGG - Intronic
1012529981 6:100223816-100223838 TCCTACCAGAAGGTTTTCAGGGG - Intergenic
1012609211 6:101194696-101194718 TTCCACTGGAAGGTCTTTAGAGG + Intergenic
1012827140 6:104161252-104161274 TCCCACTGCTAAGTCTTCAGAGG + Intergenic
1012919664 6:105208472-105208494 TCCCACTGGAAGGTCTTTGGGGG + Intergenic
1013440911 6:110167402-110167424 TCCCACTGGAAGGTCTTCAGAGG - Intronic
1013473168 6:110483789-110483811 TCCCACTGGAATGTCTTCAAGGG - Intergenic
1013637822 6:112045988-112046010 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1013759829 6:113504929-113504951 TCCCATTGGAAGGTCTTCAGGGG + Intergenic
1013811609 6:114050756-114050778 TTCCACGGGAAGGTCTTCAGGGG - Intergenic
1013858373 6:114603531-114603553 TCCGACCAGAAGGTCTTCAGGGG + Intergenic
1013887837 6:114991553-114991575 TCCCACTGGAAAGTCTTCAGGGG - Intergenic
1013968023 6:115979212-115979234 TTCTACTGGAAGGTCTTTAGGGG - Intronic
1013992288 6:116267312-116267334 TCCCAATAGAAGGTCTTCAGAGG - Intronic
1014218022 6:118771887-118771909 TCCCACTGGAAAGTCTTCAGGGG + Intergenic
1014321156 6:119929701-119929723 TCCCACTGGAAGGTCTTCAGAGG + Intergenic
1014347023 6:120284007-120284029 TCCCACTGGAAGGTCTTTGGAGG + Intergenic
1014579416 6:123118044-123118066 TGCCACTGGAAGGTCTTAAGGGG - Intergenic
1014643273 6:123941158-123941180 CACCACTGGAAGGTCTTCAGGGG + Intronic
1014722219 6:124931094-124931116 TCCCACTGTGAGGTCTTCAATGG + Intergenic
1014843982 6:126253254-126253276 TCCCACAGGAAGGTCTTCAGGGG + Intergenic
1015302047 6:131664182-131664204 CCCTACTGAAAGGTCTTCAGGGG - Intronic
1015424336 6:133048473-133048495 TCCTACTGGAAGGTCTTCAGGGG - Intergenic
1015696111 6:135981648-135981670 TCCCACAGGAAGGTCTTCAGGGG + Intronic
1015721176 6:136243827-136243849 TCCTACTGGAAGGCCTTCAGTGG - Intronic
1015781167 6:136867378-136867400 TCCTGCTGGAAGGTTTTCGGGGG - Intronic
1015840195 6:137468462-137468484 TCCCACTGGAAGGTCCTCGGGGG - Intergenic
1016474691 6:144414238-144414260 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1016635856 6:146289219-146289241 TCCCTCTGGAAGGTCTTCAGAGG - Intronic
1017072195 6:150585368-150585390 TCCCACTGGAGGGTCCTCAGGGG - Intergenic
1017460010 6:154640285-154640307 TCCCACTGGAAGATCTTCAGGGG - Intergenic
1017599545 6:156065544-156065566 TCCCACTGAAAGTTCTTCAGGGG - Intergenic
1017600914 6:156080143-156080165 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1017655883 6:156629264-156629286 TCCCACTGGAAGGTGTTTAGGGG - Intergenic
1017669275 6:156754758-156754780 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1017833173 6:158151127-158151149 TCCCACTGTGAGGTCTTCAGGGG - Intronic
1017862996 6:158416336-158416358 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1018041613 6:159928953-159928975 TCCCACTGGGAGGTCCTCAGGGG - Intergenic
1018191898 6:161316328-161316350 TCCCACTGGGAGGTCTTCAGGGG - Intergenic
1018256138 6:161921258-161921280 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1018355617 6:163011919-163011941 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1018527768 6:164733085-164733107 TCCCACTGGGAGGTCTTCAGGGG - Intergenic
1018539099 6:164857882-164857904 TCCCAGTAGAAGGTCTTCAGGGG + Intergenic
1018859757 6:167703037-167703059 TCCCACTGGAAGGTCTGCAGGGG + Intergenic
1018886778 6:167945286-167945308 TCCCACGGGAAGGTCTTCAGGGG + Intronic
1019098951 6:169611784-169611806 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1019512487 7:1424713-1424735 TCTTAATGGGAGGTTTCCAGCGG + Intergenic
1020121111 7:5504113-5504135 TTCTGCTGGAGGGTCTTCAGTGG - Intronic
1020505797 7:8986418-8986440 TCCCACTGGAAGATCTTCAGGGG + Intergenic
1020516606 7:9128902-9128924 TCCCACTGAAAGGTGTTCAGGGG + Intergenic
1020529243 7:9309531-9309553 TCCCACTGGAAGTTCTTCATAGG - Intergenic
1020636654 7:10703744-10703766 TCCCAGTGAAAGGTCTTCAGGGG - Intergenic
1020740796 7:12014628-12014650 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1020832232 7:13107068-13107090 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1020908471 7:14096769-14096791 TCCCTCTGGAAGGTCTTCAGAGG + Intergenic
1021165328 7:17332435-17332457 TCCCACTGGAAGGTCTGCGGGGG - Intronic
1021496624 7:21281901-21281923 TCCAACTTGAAGGTCTTCACAGG - Intergenic
1021615164 7:22496059-22496081 TCCCACTGGAAGGTCTTCAAGGG - Intronic
1021696549 7:23281858-23281880 TCCCAGTGGGTGGTCTTCAGGGG - Intergenic
1021760389 7:23897790-23897812 TCCCACTGGAAAGCCTTCAGGGG - Intergenic
1021830263 7:24599938-24599960 TCCCACTGGAAAGTCTTCAGGGG + Intronic
1021929716 7:25567990-25568012 TCCCATTGAAAGGTCTTCAGGGG - Intergenic
1022971776 7:35524997-35525019 TCCAACTGGGTGGTCTTCAGGGG + Intergenic
1023308691 7:38858983-38859005 TCCTGCTGGAAGGCCTTCAGGGG - Intronic
1023795289 7:43787485-43787507 TACTACTGGGAGTCATTCAGAGG - Intronic
1024345389 7:48308236-48308258 TCCCACTGGGCGGTCTTCAGGGG + Intronic
1024401668 7:48930742-48930764 TCCCACTGGGAGGTCTTCCGGGG + Intergenic
1024784849 7:52895548-52895570 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1025270724 7:57511215-57511237 ACCCACTGGAAGGTCTTCAGGGG + Intergenic
1026147082 7:67756495-67756517 TCCCACTGGGAGGTCTTCAGGGG - Intergenic
1026419896 7:70223748-70223770 TCACACTGCAAGGTCTTCAGGGG - Intronic
1026565171 7:71483979-71484001 TCCCACTGGTAGGTCTTCAGGGG + Intronic
1027329918 7:77081378-77081400 TCCCACTGAAAGGCCTTCAGGGG - Intergenic
1027475439 7:78625021-78625043 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1027545792 7:79525923-79525945 TCCCACTGGAGGATCTTCAGGGG + Intergenic
1027839020 7:83283488-83283510 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1027937566 7:84629692-84629714 TCCTACTGGAAGGTCTTCAAGGG - Intergenic
1028075228 7:86504593-86504615 TCATACTGGGAGATGCTCAGAGG - Intergenic
1028368645 7:90065030-90065052 TCCCACTGGAAGGTTTTCAGGGG - Intergenic
1028377332 7:90158564-90158586 TCCCACTGGAAGGTCTTCAAGGG + Intronic
1028402634 7:90441108-90441130 TCCCGCTGGAAGTTCTTCAGGGG + Intronic
1028601321 7:92603554-92603576 TCCCACGGGAAGGACTTCAGGGG - Intergenic
1028607107 7:92666993-92667015 TCCCACTAGGAGGGCTTCAGGGG - Intronic
1028878837 7:95856267-95856289 TCCCCCTGGACGGTCTTCAGGGG + Intronic
1028977247 7:96927640-96927662 TCCCACTGGAAGGAATTCAGGGG - Intergenic
1029309127 7:99644926-99644948 TCCTGCTGGGTGGGCTTCTGTGG - Intergenic
1029785848 7:102789963-102789985 TCCCACTGAAAGGCCTTCAGGGG + Intronic
1029792904 7:102864072-102864094 TCCTACTCAGAGTTCTTCAATGG + Intronic
1030102588 7:105959611-105959633 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1030123360 7:106132166-106132188 TCCCAGTGGAAGGTCTTCAGGGG - Intergenic
1030493037 7:110263394-110263416 TCCCACTGGAATGTCTTCAGGGG - Intergenic
1030573724 7:111259951-111259973 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1030767313 7:113426654-113426676 TTCCACTGGAAGGTCTTCAGGGG - Intergenic
1030981933 7:116196386-116196408 TCCCACTGGAAGGTTTTCAGAGG + Intergenic
1031091234 7:117357404-117357426 TCCCACTGGAAGGTCTTCAAGGG - Intergenic
1031226537 7:119045873-119045895 TCCCACTAGACGGTCTTCAGGGG + Intergenic
1031634721 7:124088443-124088465 TCCCACTGGAAAATCTTCAGGGG + Intergenic
1031716247 7:125112265-125112287 TCTCACTGGAAGGTCTTCAGGGG + Intergenic
1031816205 7:126439746-126439768 TTCCACTGGAAGGTCTTAAGGGG - Intronic
1031872132 7:127099476-127099498 TCCTACTGGGAGCTCTACCTAGG + Intronic
1031891947 7:127304768-127304790 CCCCACTAGAAGGTCTTCAGGGG - Intergenic
1031948910 7:127871110-127871132 TCCCACTGGAAGGTTTTCAGGGG + Intronic
1032149421 7:129415297-129415319 CCCTAATGGGAAATCTTCAGAGG + Intronic
1032465748 7:132143644-132143666 GACTACTGGGAGCTGTTCAGTGG - Intronic
1032578749 7:133083431-133083453 TCCCACTGAAAGGTCTTCAGAGG + Intergenic
1032631328 7:133655673-133655695 TCCCACCAGAAGGTCTTCAGGGG + Intronic
1032735088 7:134685063-134685085 TCCCACTGGAGGGTCTTCAGGGG + Intergenic
1032857909 7:135851542-135851564 TCCCACTGGAGGGTCTTCAGGGG + Intergenic
1032908621 7:136403104-136403126 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1033407172 7:141081162-141081184 GCCCACTGGAAAGTCTTCAGGGG - Intronic
1033429621 7:141277422-141277444 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1034023215 7:147668485-147668507 TCCCACTGGGACGTTCTCAGGGG - Intronic
1034057468 7:148050268-148050290 TCCTACTGCGAGGTCTTCAGGGG - Intronic
1034092086 7:148373027-148373049 TCACACTGGGAGGTCTTCAGGGG + Intronic
1034373206 7:150619023-150619045 TCCCGCTGGAAGTTCTTCAGGGG + Intergenic
1034535537 7:151723686-151723708 ACCTACAGGGAGCTCTTCAAGGG + Intronic
1035064154 7:156093335-156093357 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1035358388 7:158293851-158293873 TCCCACAGGAAGGTCTTCAGGGG + Intronic
1035416936 7:158697181-158697203 TCCCAGTGGAAGGTCTTCAGGGG - Intronic
1035914781 8:3607251-3607273 TCCCACTGGGAAGTCTTCAGGGG + Intronic
1036083734 8:5589657-5589679 TCCCACTGGAAGGTCTTCACGGG + Intergenic
1036113547 8:5933138-5933160 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1036595019 8:10203833-10203855 TCCCACTGGAAGGTCTTTAGAGG - Intronic
1036734080 8:11293113-11293135 CCCCACTGGAAGGTCTTCAGGGG - Intronic
1037414612 8:18636107-18636129 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1037867161 8:22454323-22454345 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1037870733 8:22493664-22493686 TCCCACTGGAAGGCCTTCAGGGG + Intronic
1038371923 8:27002759-27002781 CCCCACTGGAAGGCCTTCAGGGG - Intergenic
1038415810 8:27394951-27394973 TCCCACTGGAAGCTCTTCAGGGG + Intronic
1038628142 8:29214478-29214500 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1038834406 8:31103118-31103140 TCCCACTGGAAGTTCTTTAGGGG + Intronic
1038868673 8:31468425-31468447 TCCTGCTGGACGGTCTCCAGGGG - Intergenic
1039125962 8:34202163-34202185 TCCCACTGGGAGGTCTTCAGGGG + Intergenic
1039305928 8:36262794-36262816 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1039715616 8:40105251-40105273 TCCCACGGGAAGGTCTTTAGGGG + Intergenic
1040430216 8:47333139-47333161 TTCCACTGAAAGGTCTTCAGGGG + Intronic
1040645788 8:49395179-49395201 TCCTACTGAAACATCTTCAGGGG + Intergenic
1040724144 8:50361248-50361270 TCCCACTGGAAAGTCTTCAGGGG + Intronic
1040750740 8:50703413-50703435 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1040837756 8:51750304-51750326 TCCCACTGGAAGGTCCTCAGGGG + Intronic
1040896269 8:52372090-52372112 TCTCACTGGAAGGTGTTCAGGGG - Intronic
1040902870 8:52434964-52434986 TCCCACTGGAAGGTCTTGCGGGG - Intronic
1041369675 8:57145564-57145586 TCCCACTGAAAGGTTTTCAGGGG - Intergenic
1041440482 8:57890664-57890686 TCCCACTGGAAAGTCTTCAGGGG + Intergenic
1041503596 8:58568355-58568377 TCCCACTGAAAGGTCTTCAGAGG + Intronic
1041610925 8:59847923-59847945 TCCCACTAGAAAGTCTTCAGGGG - Intergenic
1041830962 8:62152836-62152858 TCTTAGTGGCAGGTGTTCAGTGG - Intergenic
1041921056 8:63181717-63181739 TCCAACTGGGAGCACTTCACAGG - Intronic
1042156844 8:65853397-65853419 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1042310747 8:67377152-67377174 TCCTACTGGAAGGTTTTCAGGGG + Intergenic
1042406324 8:68409331-68409353 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1042797595 8:72681461-72681483 CCTTACTGGAAGGTCTTCAGGGG + Intronic
1043106381 8:76117503-76117525 TCCTACTGGAAAGTCTTCCGGGG + Intergenic
1043267088 8:78279875-78279897 TCTCACTGGGGGGTCTTCTGAGG - Intergenic
1043491858 8:80757207-80757229 TTCTACTGGAAGGTGTTCAGGGG - Intronic
1043759170 8:84044535-84044557 TCCCACTGGAAGGTCTGCAGGGG - Intergenic
1043909520 8:85845166-85845188 TCCTCCTGGAAGGTCTTCAGAGG - Intergenic
1043997362 8:86834787-86834809 TCCCACTGGAAGGGCTTCAGGGG + Intergenic
1044189685 8:89300335-89300357 TATGACTGGAAGGTCTTCAGGGG - Intergenic
1044246755 8:89957205-89957227 TCCCACTGGAAAGTCTTCTGGGG - Intronic
1044280803 8:90353583-90353605 TCCCACCCGAAGGTCTTCAGGGG + Intergenic
1044518002 8:93162169-93162191 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1044538058 8:93380334-93380356 TCCCAGTGGAAGGTCTTCGGGGG - Intergenic
1044546258 8:93463567-93463589 TCCCACTAGAAGGTATTCAGGGG + Intergenic
1044679406 8:94762444-94762466 TCCTACTGGCAGAGCTTCATAGG + Intronic
1044872771 8:96636394-96636416 TCCCACTGGAAGGTCCTCAGGGG - Intergenic
1044957862 8:97500255-97500277 TCACAGTGGAAGGTCTTCAGAGG + Intergenic
1045205098 8:100030491-100030513 TACCACTGGAAGGTTTTCAGGGG - Intronic
1045444359 8:102244705-102244727 TCCCACTGGAAGGTCTCCAGGGG - Intergenic
1045484349 8:102619272-102619294 TCCCACTGGAAGGTCTTCATGGG - Intergenic
1046116340 8:109788773-109788795 TCCCACTGGAAGCTCTTTAGGGG - Intergenic
1046663108 8:116970253-116970275 TCCCACTGGAAGGACTTTAGGGG + Intronic
1046890006 8:119412555-119412577 TCCCACTGGAAGGTTGTCAGGGG - Intergenic
1046915167 8:119672038-119672060 TGCTACAAGGAGGTCTTCGGCGG + Intronic
1047142579 8:122158024-122158046 TCCCACTGGAAGGCCTTCAGGGG - Intergenic
1047351132 8:124075411-124075433 TCCCACTGGAAGGTCTTCAAGGG + Intronic
1047715851 8:127594484-127594506 CCCTACTAGGTGGTCTTAAGAGG + Intergenic
1047923629 8:129660380-129660402 TTCCACTGGAAGGTCCTCAGAGG + Intergenic
1048602816 8:135936500-135936522 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1048789676 8:138088544-138088566 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1049123178 8:140758521-140758543 TCCCACTGGAAGGTCCTCAGAGG - Intronic
1049127186 8:140802190-140802212 TCCCACTGGGAGGTCTTCAGGGG - Intronic
1049141263 8:140956646-140956668 TCCCACTGGAAAGTCTTTAGGGG - Intronic
1049473695 8:142787372-142787394 TCCCACGGGGAGGGCTTCTGGGG - Intergenic
1049689810 8:143953521-143953543 TCCTACTGGGCTGGCTTCAGCGG - Intronic
1049703085 8:144023816-144023838 TCCTAAGGGGAGGTCCTGAGGGG - Intronic
1049927995 9:428390-428412 GCCTGCTGGGAGGTGTTCTGAGG + Exonic
1050285057 9:4092649-4092671 TCCCACTGGAGGGTCTTCAGGGG + Intronic
1050495834 9:6241070-6241092 CCCTACTGGAAGTTCTTCAGGGG + Intronic
1050499298 9:6278463-6278485 TCCCACTGGAATTTCTTCAGGGG + Intergenic
1050757295 9:9021641-9021663 TCCCACTAGAAGATCTTCAGGGG - Intronic
1050848611 9:10256292-10256314 TCCCACTGGAAGGTCTTCGGGGG + Intronic
1050889070 9:10800364-10800386 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1051046231 9:12877557-12877579 TCCCACTGGAAGGTTTTCAGGGG - Intergenic
1051128260 9:13830301-13830323 TCCCACTGAAATGTCTTCAGGGG + Intergenic
1051181473 9:14416394-14416416 TCTCACTGGAAGGTCTTCAGGGG - Intergenic
1051643076 9:19241634-19241656 TCCTACTGGAAGGTCTTCAGGGG + Intronic
1051943759 9:22540768-22540790 TCCCAGGGGAAGGTCTTCAGGGG + Intergenic
1052011425 9:23414349-23414371 TCTCACTGGGAGGTCGTCAGGGG - Intergenic
1052148518 9:25080832-25080854 TTCCACTGGAAGGTCTTCAGTGG - Intergenic
1052168891 9:25369430-25369452 TCCCACTGGAAGGTCTTCAAGGG + Intergenic
1052246517 9:26342141-26342163 TTCCACTGGAAGGTTTTCAGGGG - Intergenic
1052361746 9:27568943-27568965 TCCCACTGGAAGGTTTTTAGGGG - Intronic
1052652736 9:31324611-31324633 TCCCACTGGAAGGTCTTCAGTGG - Intergenic
1052744645 9:32428377-32428399 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1052881709 9:33604608-33604630 TACTCCTGGGATGGCTTCAGGGG + Intergenic
1053049491 9:34947664-34947686 TCTCACTGGAAGGCCTTCAGAGG - Intergenic
1053450761 9:38192318-38192340 CCCTTCTGGCAGCTCTTCAGAGG - Intergenic
1053472938 9:38359787-38359809 TCCCACTGGCACCTCTTCAGTGG - Intergenic
1053494604 9:38541229-38541251 TACTCCTGGGATGGCTTCAGGGG - Exonic
1053543084 9:38994393-38994415 TGCTCCTGGCAGATCTTCAGAGG - Intergenic
1053613624 9:39741394-39741416 TGCTTCTGGGGAGTCTTCAGGGG + Intergenic
1053671791 9:40372800-40372822 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1053782312 9:41623329-41623351 TCCCACTGGAAGGTCTTCCAGGG + Intergenic
1053807522 9:41817910-41817932 TGCTCCTGGAAGATCTTCAGAGG - Intergenic
1053871665 9:42499350-42499372 TGCTTCTGGGGAGTCTTCAGGGG + Intergenic
1053921604 9:42999158-42999180 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1054170262 9:61833484-61833506 TCCCACTGGAAGGTCTTCCAGGG + Intergenic
1054239890 9:62601003-62601025 TGCTTCTGGGGAGTCTTCAGGGG - Intergenic
1054382906 9:64512844-64512866 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1054512827 9:66003510-66003532 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1054554023 9:66635530-66635552 TGCTTCTGGGGAGTCTTCAGGGG - Intergenic
1054623070 9:67369517-67369539 TGCTCCTGGAAGATCTTCAGAGG + Intergenic
1054667276 9:67747331-67747353 TCCCACTGGAAGGTCTTCCAGGG - Intergenic
1054859701 9:69937078-69937100 TGCCACTGGGAGGTCTTTAGGGG + Intergenic
1054978509 9:71176257-71176279 TCCCACTGGAAGGTCTTCAGGGG - Intronic
1055179787 9:73371250-73371272 ACCCACTGGAAGGTCTTCAGGGG - Intergenic
1055287826 9:74748479-74748501 TCCCACTGGAAGGTGTTCAGGGG - Intronic
1055393783 9:75851706-75851728 TCCCAGTGGAAGGCCTTCAGGGG + Intergenic
1055464876 9:76554840-76554862 TCCCGCTGGAAGGACTTCAGGGG + Intergenic
1055991228 9:82108174-82108196 TCCCACTGGAAGGTTTTCAGGGG - Intergenic
1056122887 9:83507011-83507033 TCCCACTGAAAGGCCTTCAGAGG + Intronic
1056123372 9:83511414-83511436 TCCTACCAGGAGGGCTTAAGTGG - Intronic
1056242519 9:84662466-84662488 TCCCACTGGAAGATCTTCAGGGG + Intergenic
1056317484 9:85404685-85404707 TCCCACTGGAAGGTCTCCAAGGG - Intergenic
1056432041 9:86537464-86537486 TCCCACTGGAAGGCCTTCCGGGG - Intergenic
1056581548 9:87890441-87890463 TCCTTCTGGGGGGTCTTCATGGG - Intergenic
1057019741 9:91687677-91687699 TCCCTCTGGAAGATCTTCAGGGG + Intronic
1057020052 9:91690273-91690295 TCCCTCTGGAAGATCTTCAGGGG - Intronic
1057116352 9:92526123-92526145 TCCCACTGGAAGGTCTTCATGGG - Intronic
1057452811 9:95180210-95180232 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1058281248 9:103117661-103117683 TCCTACTGGACAGTCTTCAGGGG - Intergenic
1058434560 9:104950374-104950396 TCCCACTGGAAGGTCTTCAAGGG + Intergenic
1058712008 9:107687546-107687568 TCCCACTGGAAGGTCTTCAGAGG + Intergenic
1059028557 9:110664544-110664566 TCCTACTGGAAGGTCCTCAGGGG + Intergenic
1059419662 9:114183151-114183173 GCCTGGTGGGAGGGCTTCAGGGG + Intronic
1059526671 9:114997800-114997822 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1059714615 9:116902180-116902202 TCCCACTGGAAAGTCTTCTGGGG - Intronic
1059951520 9:119467605-119467627 TCCCACTGGAAGGTCTACAGGGG - Intergenic
1060011555 9:120047718-120047740 TCCCACTGGAAGGTCTTTAGGGG + Intergenic
1060081795 9:120654768-120654790 TCCCACTAGAAGGTCTTCGGGGG - Intronic
1060129699 9:121083483-121083505 TTCCACTGGAAGGTCTTCAAGGG + Intronic
1060510474 9:124228607-124228629 TCCTGCTGGGAGGCTGTCAGTGG - Intergenic
1060854571 9:126904927-126904949 TCCTACTGGGGGCTCGGCAGAGG - Intergenic
1060924026 9:127442991-127443013 TCCAACTGGAAGATCTTCAGGGG + Intronic
1061311387 9:129765207-129765229 TCCCACTGGAAGGTCTTCAGGGG + Intergenic
1061644127 9:131985832-131985854 TCCCAGTGGAAGGTCTTCAAAGG - Intronic
1062427680 9:136513391-136513413 ACCTGCCGGGAGGGCTTCAGCGG - Exonic
1186033823 X:5398953-5398975 TCCCACTGGAAGGTATTCAGGGG - Intergenic
1186071424 X:5825665-5825687 TCCTGCAGGGAGGTTTTGAGTGG + Intergenic
1186286663 X:8051488-8051510 TTCCACTGGAAGGTCTTCTGGGG - Intergenic
1186577071 X:10777922-10777944 TTCTGCTGGAAGGTCTTCAGAGG + Intronic
1186697304 X:12049758-12049780 TCCCACTGGCAGGTTTTCAGGGG - Intergenic
1186791295 X:13001741-13001763 TCCCACTGGAAGGTCCTCAGGGG - Intergenic
1187209904 X:17219189-17219211 TGCCACTGGAAGATCTTCAGGGG - Intergenic
1187395266 X:18913861-18913883 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1187762286 X:22601148-22601170 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1188084795 X:25890660-25890682 TCCCACTGGAAGGTCTTCAGAGG + Intergenic
1188509083 X:30914395-30914417 TCCCACCGGAAGTTCTTCAGAGG + Intronic
1188594447 X:31880960-31880982 CCCCACTGGAAGGTCTTCATGGG - Intronic
1188777455 X:34238444-34238466 CCCCACTGGAAGGGCTTCAGGGG + Intergenic
1188824457 X:34813374-34813396 TCTCACCGAGAGGTCTTCAGGGG - Intergenic
1188850106 X:35121673-35121695 TCCCACTGGAAGGTCCTCAGGGG + Intergenic
1188939378 X:36217931-36217953 TCTTTCTGTTAGGTCTTCAGTGG + Intergenic
1189022276 X:37353132-37353154 TTCCACTGGAAGGTTTTCAGGGG - Intronic
1189132292 X:38512561-38512583 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1189158241 X:38782252-38782274 TCCCACTGAAAGGTCTTCAGGGG + Intergenic
1189621199 X:42840120-42840142 TTCCACTGGAAGGTCTTCAGGGG - Intergenic
1189965828 X:46371825-46371847 TCCCAGTGGAAGGTCTTCAAAGG + Intergenic
1190427019 X:50343137-50343159 TCCCATTGGAAGTTCTTCAGGGG - Intronic
1190574073 X:51815333-51815355 TCCCACCGGAAGTTCTTCAGGGG - Intronic
1191056568 X:56247712-56247734 TCCCACTGGAAGATCTTCAGGGG + Intronic
1191127192 X:56970140-56970162 TCTCACTGGGAGGTCTTCAGGGG + Intergenic
1192127491 X:68515555-68515577 TCCTATTGGAAGGTCTTCTGGGG + Intronic
1192385102 X:70660594-70660616 TCCCACTGGAAAGTCCTCAGGGG + Intronic
1192407703 X:70903059-70903081 TCCCACTGGAAGTTCTTCAGGGG + Intronic
1192861184 X:75073046-75073068 TTTTACTGGAAGGTCTTCAGGGG + Intronic
1193037952 X:76973705-76973727 TCCTACTGTTAGGTTTTTAGAGG - Intergenic
1193089635 X:77480574-77480596 TCCTACTAGAAGGTCTTCGAGGG + Intergenic
1193145664 X:78073055-78073077 TCCCACTGGAAGGTCTTTGGGGG + Intronic
1193372933 X:80720300-80720322 TCCCACTGGAAGGTCTTCCGGGG - Intronic
1193749772 X:85327167-85327189 TCCTGCTGGCAGGTTTCCAGAGG + Intronic
1193911424 X:87310985-87311007 TCCCTCTGGAAGGTCTTGAGGGG - Intergenic
1193959353 X:87904750-87904772 CCTCACTGGAAGGTCTTCAGAGG + Intergenic
1194311500 X:92314318-92314340 TCTCACTGGAAGATCTTCAGAGG + Intronic
1194413836 X:93586409-93586431 TCCCCCTGGAAGGTCTTCAGGGG + Intergenic
1194461975 X:94181704-94181726 GTCCACTGGAAGGTCTTCAGGGG + Intergenic
1194637917 X:96368351-96368373 TCCCACTGGAAGGTCTTCATGGG - Intergenic
1194640302 X:96396110-96396132 TCCCACTGGAAGGTCTTCAGGGG - Intergenic
1194697062 X:97065781-97065803 TCCCACTGGAAGGTCTTCAAGGG - Intronic
1194820977 X:98506661-98506683 TACTGCTGGAAGATCTTCAGGGG - Intergenic
1195040756 X:101011913-101011935 TCCCACTAGAAGGTCTTCAGGGG + Intronic
1195058416 X:101169737-101169759 TTCTACTGGAAGGTCTTCGGGGG - Intergenic
1195101621 X:101560650-101560672 TCCTTCTGGGAGGTCATTGGTGG + Intergenic
1195342731 X:103920780-103920802 CCCTTCTGTGAGCTCTTCAGGGG + Intronic
1195551119 X:106172573-106172595 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1195571813 X:106405450-106405472 TCCCACTGGAAAGTCTTCAGGGG + Intergenic
1195738391 X:108036775-108036797 TCTTACTGGGAGTCCTCCAGAGG - Intergenic
1195781694 X:108473405-108473427 TCCCACTGGAAGGTCTTTGGGGG - Intronic
1195849308 X:109265534-109265556 TTCTACTAGAAGGTCTTCAGGGG + Intergenic
1196034594 X:111130407-111130429 TTCTCCTGCTAGGTCTTCAGTGG - Intronic
1196041313 X:111207676-111207698 TCCAACTGGAAGGACTTTAGGGG - Intronic
1196265378 X:113638173-113638195 TCACACTGGAAGGTCTTCAGGGG + Intergenic
1196606155 X:117659600-117659622 TCCTACTGGAAGATATTCAGGGG - Intergenic
1196641461 X:118067729-118067751 TCCCACTGGAAGGTCTTCAGGGG + Intronic
1196960741 X:120997951-120997973 TCCCATTGGAAGGTCTTCAGGGG + Intergenic
1197419533 X:126221648-126221670 TCCTACTGGAAAGTCTTCAGGGG + Intergenic
1197444340 X:126530969-126530991 TCCCACTGGTAGGTCTTCAGGGG + Intergenic
1197919345 X:131574890-131574912 GACAACTGGAAGGTCTTCAGAGG - Intergenic
1198193446 X:134334739-134334761 TCTCACTGGGAGGTCTTCAGGGG + Intergenic
1199335352 X:146613110-146613132 TCCCACTGGAAGGTCCTCAGGGG + Intergenic
1199940620 X:152623298-152623320 TCCCACTGGAAGGTCTCCAGGGG - Intergenic
1200619774 Y:5428452-5428474 TCTCACTGGAAGATCTTCAGAGG + Intronic
1200909154 Y:8515586-8515608 TCCTTCTGGTAGTACTTCAGGGG + Intergenic
1201638490 Y:16152206-16152228 TTCCACTGGAAGGTATTCAGGGG + Intergenic
1202273568 Y:23093831-23093853 TCCTCCTTGGAGGCTTTCAGTGG + Intergenic
1202292458 Y:23326851-23326873 TCCTCCTTGGAGGCTTTCAGTGG - Intergenic
1202426565 Y:24727575-24727597 TCCTCCTTGGAGGCTTTCAGTGG + Intergenic
1202444224 Y:24942511-24942533 TCCTCCTTGGAGGCTTTCAGTGG - Intergenic