ID: 1156517186

View in Genome Browser
Species Human (GRCh38)
Location 18:37690327-37690349
Sequence GTCCTACTGGGAGGTCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1445
Summary {0: 2, 1: 42, 2: 320, 3: 506, 4: 575}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156517186_1156517193 -10 Left 1156517186 18:37690327-37690349 CCCTGAAGACCTCCCAGTAGGAC 0: 2
1: 42
2: 320
3: 506
4: 575
Right 1156517193 18:37690340-37690362 CCAGTAGGACAAGATGTGGAGGG No data
1156517186_1156517197 28 Left 1156517186 18:37690327-37690349 CCCTGAAGACCTCCCAGTAGGAC 0: 2
1: 42
2: 320
3: 506
4: 575
Right 1156517197 18:37690378-37690400 TGATGATTCTGACCCTGTGTAGG 0: 24
1: 271
2: 486
3: 505
4: 570
1156517186_1156517194 -9 Left 1156517186 18:37690327-37690349 CCCTGAAGACCTCCCAGTAGGAC 0: 2
1: 42
2: 320
3: 506
4: 575
Right 1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG No data
1156517186_1156517196 -1 Left 1156517186 18:37690327-37690349 CCCTGAAGACCTCCCAGTAGGAC 0: 2
1: 42
2: 320
3: 506
4: 575
Right 1156517196 18:37690349-37690371 CAAGATGTGGAGGGGGAAGACGG No data
1156517186_1156517195 -8 Left 1156517186 18:37690327-37690349 CCCTGAAGACCTCCCAGTAGGAC 0: 2
1: 42
2: 320
3: 506
4: 575
Right 1156517195 18:37690342-37690364 AGTAGGACAAGATGTGGAGGGGG 0: 12
1: 230
2: 429
3: 429
4: 727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156517186 Original CRISPR GTCCTACTGGGAGGTCTTCA GGG (reversed) Intergenic
902554835 1:17240780-17240802 GTCCTGCTGGGGGGTCTGCGGGG + Intronic
902841464 1:19076783-19076805 CTCCTCCTGGAAGGTTTTCAGGG + Exonic
903750898 1:25619841-25619863 GCCCTACTGGGAGGTCGAGAGGG - Intronic
904117932 1:28175993-28176015 ATCCCACTGGGAGGTGTTGATGG - Intronic
904263091 1:29302062-29302084 GTCCCACTGGGAGGTCTTTAGGG - Intronic
904436340 1:30500166-30500188 ATCCCACTGGAAGGTCTTCAGGG + Intergenic
904491457 1:30862483-30862505 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
904722253 1:32519083-32519105 GTCCCACTGGAAGGTCTTCAGGG + Intronic
904975550 1:34453453-34453475 GGCCTAATGGGAGGTGTTTAGGG - Intergenic
905360640 1:37417481-37417503 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
905829254 1:41051513-41051535 GTCCCACTGGAAGGTCTTCAGGG - Intronic
905838001 1:41146099-41146121 AGCCTACTGGAAGGTCTTCAGGG - Intronic
906029435 1:42706100-42706122 GTCCCACTGAAAGGTCTTCAGGG + Intergenic
906547490 1:46630828-46630850 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
906784116 1:48599103-48599125 ATCACACTGGAAGGTCTTCAGGG + Intronic
906920313 1:50057066-50057088 GTTCCACTAGAAGGTCTTCAAGG - Intronic
907081968 1:51631973-51631995 GTCCCACTGGAAGGTCTTTAGGG + Intronic
907087668 1:51691861-51691883 GTCCCGCTGGAAGGTTTTCAGGG + Intronic
907117510 1:51982101-51982123 GTCCCACTGGAAGGTCTTCAGGG - Intronic
907222651 1:52918476-52918498 GTCCCACTGGAAGGTCTTCAGGG - Intronic
907500190 1:54873558-54873580 GTCCCACTGGAAAGTCTTCAGGG - Intronic
907624854 1:56020034-56020056 GTCCCACTAGAAGGTCTTCGGGG + Intergenic
907768446 1:57435655-57435677 GTCCCAGTGGAAGGTCTTCAGGG + Intronic
908025053 1:59941627-59941649 CTCCCACTGGAAGATCTTCAGGG - Intergenic
908067146 1:60418555-60418577 GCCCCACTGCAAGGTCTTCAGGG - Intergenic
908309282 1:62860168-62860190 GTCCCACTAGAAGGTCTCCAGGG + Intronic
908444084 1:64185098-64185120 GTCCCACTGGAAGATCTTCAAGG + Intergenic
908500311 1:64736794-64736816 GTCCCACTGGAAGATCTTCAGGG - Intergenic
908771148 1:67597235-67597257 GTCCCGCTGGAAGATCTTCAGGG + Intergenic
908806064 1:67934081-67934103 GTCCCACTGTAAGGTCTTCAGGG - Intergenic
908839869 1:68268353-68268375 GTCCCACTAAAAGGTCTTCAGGG - Intergenic
909004393 1:70257768-70257790 GTCCCACCGGAAGGTCTTAAGGG - Intergenic
909361620 1:74766364-74766386 GTACCACTGGAAGGTCTTCAGGG - Exonic
909400548 1:75224477-75224499 GTCCCACTGGAAGGTCTTCAGGG - Intronic
909418649 1:75436973-75436995 GACCCACTGGAAGGTCTTCAGGG + Intronic
909610287 1:77544656-77544678 TGCCCACTGGAAGGTCTTCAGGG + Intronic
909782864 1:79569472-79569494 GTCCCACTGGAAAGGCTTCAGGG + Intergenic
909830795 1:80187144-80187166 GTCCCACTGAGCAGTCTTCAGGG - Intergenic
909886914 1:80953137-80953159 GTCCCACTGGAAGGTCTTCCGGG + Intergenic
910003482 1:82365725-82365747 GTCCCACTAGAAGGTCTTTAGGG + Intergenic
910346542 1:86245375-86245397 GTCCCAATGGAAGGACTTCAGGG + Intergenic
910595563 1:88976713-88976735 GTCCCACTGGAAGGTCTTCAGGG - Intronic
910667125 1:89737910-89737932 GTCCCACTGGAAGGTCTTCAGGG + Intronic
910900970 1:92120330-92120352 GTCCCACTGGAAGGTCTTCGGGG + Intronic
910943831 1:92566707-92566729 GTCCCACTGGAAGATCTTCAGGG - Intronic
910947033 1:92604459-92604481 GTCCCACTGGAAGGTCTTCAGGG + Intronic
911061808 1:93754949-93754971 GTCCCACTGGAAGGTCTTCAGGG - Intronic
911085024 1:93969151-93969173 GTCCCACTGGGAAGTCTCCAGGG - Intergenic
911135438 1:94434229-94434251 GTCCCACTGGAAGGTCTTCAGGG + Intronic
911195596 1:94991969-94991991 GTCCCACTGAAAGGTCTTCAGGG + Intronic
911211229 1:95139977-95139999 GTCCCACTGGAAGGTCTTCAGGG + Intronic
911275180 1:95851719-95851741 GTTCCACTAGAAGGTCTTCAGGG + Intergenic
911327524 1:96486000-96486022 GTCCCACTGGAAGGTTTTCAGGG - Intergenic
911539289 1:99139147-99139169 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
911544122 1:99196052-99196074 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
911545305 1:99209110-99209132 GTCCCACTAGAAGGTCTTCAGGG + Intergenic
912037776 1:105343494-105343516 GTCCCACTGAGAAGTCTTCAAGG - Intergenic
912155189 1:106909779-106909801 GTCCTGCTGGAAGTTCCTCAGGG - Intergenic
912611174 1:111046159-111046181 TTTCTACTGTGAGGTCTTCTTGG + Intergenic
912705950 1:111912616-111912638 GTCCCACTGGAAGGTCATCTGGG - Intronic
912909473 1:113743344-113743366 GTCCTACTGTAGGGTCTTCAGGG + Intronic
912913287 1:113785246-113785268 GTCCTGCTGAAAAGTCTTCAGGG + Intronic
913025640 1:114836268-114836290 GTCCCTCTGGCAGGTCTTCAAGG + Intergenic
913065248 1:115246671-115246693 TTCCTACTAGGAGGGCTTAATGG - Intergenic
913136470 1:115894380-115894402 GTCCCACTGGCAGGTCTTCAGGG - Intergenic
913194849 1:116447325-116447347 GTCCCACTGGAAGGTATTCAGGG - Intergenic
913675999 1:121141010-121141032 GTCCCACTCGGAGGTCTTTAGGG + Intergenic
914027894 1:143928953-143928975 GTCCCACTCGGAGGTCTTTAGGG + Intergenic
914406593 1:147380700-147380722 GTCCCACTGGGAGGTCTTCAGGG + Intergenic
914778020 1:150756215-150756237 GTCCCACTGGAAGGTCTTCAGGG + Intronic
914889519 1:151610689-151610711 GTCTCACTGGAAGGTCTTCATGG + Intergenic
914937905 1:151996295-151996317 GTCCCACTGAAAGGTCTCCAGGG - Intergenic
915029371 1:152863451-152863473 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
915251797 1:154595372-154595394 GTCCCACTGTAAGGTGTTCAGGG - Intronic
915374664 1:155382626-155382648 GTTCTACTGAAAGGTCTTCAGGG - Intronic
915506964 1:156363751-156363773 GTCACACTGGAAGGTCTTCAGGG + Intronic
915621349 1:157087147-157087169 GTCCCACGGGAAAGTCTTCAGGG - Intergenic
915621555 1:157089076-157089098 GTCCCACGGGAAAGTCTTCAGGG - Intergenic
916227614 1:162505259-162505281 GTCTTACTGGAATGTCTGCAGGG + Intronic
916325027 1:163546679-163546701 GTCTCACTGGAAGATCTTCAGGG + Intergenic
916404071 1:164480029-164480051 GTTCTACTGGAAGACCTTCAGGG - Intergenic
916410160 1:164539267-164539289 GTCCCACTGGAAGGTCTCCAGGG - Intergenic
916813766 1:168330049-168330071 ATCCCACTGGAAGGTCTTCAGGG - Intergenic
916897025 1:169175239-169175261 GTCCCACTGGAAGGTCTTTAGGG + Intronic
917114012 1:171583426-171583448 GTCCCACTGGGAGGTCTTCAGGG + Intronic
917260527 1:173162449-173162471 GCTCCACTGGAAGGTCTTCAGGG + Intergenic
917588159 1:176449429-176449451 TTCTTACTGGAAGGTCTTCAGGG + Intergenic
917633345 1:176911626-176911648 GTCCCACTGGCAGGTCTCTAGGG + Intronic
918031476 1:180816969-180816991 CTCCCACTGGAAGGTCTTCGGGG - Intronic
918174093 1:182028185-182028207 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
918817994 1:189214846-189214868 GTCCCATTGGAAGGTCTTCAGGG - Intergenic
918916387 1:190645294-190645316 GTCCCACTGGAAGGTATTCAGGG + Intergenic
918934533 1:190903853-190903875 GTTCCACTGGATGGTCTTCAGGG - Intergenic
919014237 1:192009830-192009852 GTCCCACAGGAAGGTCTTCGTGG + Intergenic
919144480 1:193616282-193616304 GTTCCACTGGAAGGTCTTCAGGG - Intergenic
919240442 1:194908558-194908580 GTCCCACTGAAAGGTCTTCAAGG + Intergenic
919295468 1:195693871-195693893 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
919302001 1:195782124-195782146 GTTCAACTGGGAAGTCTTCTAGG + Intergenic
919378409 1:196822622-196822644 GTCCCACTGGAAGGTCTTCACGG + Intronic
919388101 1:196946659-196946681 GTCCCACTAGAAGATCTTCAGGG + Intronic
919405661 1:197179632-197179654 GTCCCACTGGAAGGTCTTCAGGG - Intronic
919649618 1:200133875-200133897 GTCCCATTGGAAGGTCTTCAGGG - Intronic
920324465 1:205151812-205151834 GTCCCACTGGAAGGTTTTCGGGG + Intronic
920463369 1:206159848-206159870 GTCCCACTCGGAGGTCTTTAGGG + Intergenic
920680247 1:208066769-208066791 GTCCCACTGTGAGGTCTTCAGGG - Intronic
920717169 1:208350927-208350949 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
921274089 1:213500314-213500336 GCCCCACTGGAGGGTCTTCAAGG + Intergenic
921399825 1:214709143-214709165 TTCCCACTGGAAGGTCTTCAGGG + Intergenic
921498581 1:215871789-215871811 ATCCAGCTGGGAAGTCTTCACGG + Intronic
921563849 1:216692225-216692247 GTCCTACTGGAAGGTCTTCAGGG - Intronic
921643637 1:217586480-217586502 GTCTCACTGGAAGGTCTTCAGGG + Intronic
921722185 1:218485015-218485037 GTCCCAGCGGAAGGTCTTCAGGG - Intergenic
921770465 1:219032332-219032354 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
922122735 1:222688962-222688984 GTCCCACTGGAAGGTCTTCCAGG - Intronic
922217079 1:223528601-223528623 ATCCTAATGGGAGGTGTTAATGG - Intergenic
922399931 1:225242525-225242547 GTCCCACTGGAAGTTCTTCAGGG + Intronic
922480099 1:225934299-225934321 GTCCCAGTAGAAGGTCTTCAGGG + Intergenic
922501717 1:226101903-226101925 GTCCCACTGGAAGGTCTTCCAGG - Intergenic
922881098 1:228981511-228981533 ATGCCACTGGGAAGTCTTCAGGG - Intergenic
922968398 1:229713053-229713075 GTCTCACTGGAAAGTCTTCAAGG + Intergenic
923002075 1:230015006-230015028 GTCCCACTGGAAGTGCTTCAGGG - Intergenic
923128165 1:231050570-231050592 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
923312641 1:232750058-232750080 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
923405858 1:233659291-233659313 GTCCCACTGGAAGGTCTTCAGGG + Intronic
923417907 1:233782741-233782763 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
923925565 1:238623305-238623327 GTCCCACTGGAAGGTATTCAGGG - Intergenic
1062790787 10:303942-303964 GTCCAACTGGAGGGTCTTTAGGG + Intronic
1062794813 10:336748-336770 GTCCCACTGGAGGGCCTTCAGGG - Intronic
1063283493 10:4658045-4658067 GCCCCATTGGAAGGTCTTCAGGG + Intergenic
1064530188 10:16300659-16300681 ATCTCACTGGGAGGTCTTCAGGG + Intergenic
1064767668 10:18691602-18691624 ATCCCACTGGAAGGTCTTCAGGG - Intergenic
1065631116 10:27682034-27682056 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1065703229 10:28445520-28445542 GTCCAAGTGGGAGGTATTAAGGG - Intergenic
1065781485 10:29172425-29172447 GTCCCACTGGAAAGTCTTCTGGG + Intergenic
1066290812 10:34012960-34012982 GTACTGCTGAGAGGTCTGCAAGG - Intergenic
1066678179 10:37910404-37910426 GTTCCTCTGGAAGGTCTTCAGGG + Intergenic
1066700801 10:38126041-38126063 GTCCTGGTGGGAGGTGATCATGG - Intergenic
1066990890 10:42512258-42512280 GTCCTGGTGGGAGGTGATCATGG + Intergenic
1067124346 10:43503144-43503166 GTTCCACTGGAGGGTCTTCAAGG - Intergenic
1067250808 10:44585574-44585596 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1067756614 10:49010511-49010533 GCCCTACTGGCTGGTCTTTATGG + Intergenic
1068065432 10:52124911-52124933 GTCCCCTTGGAAGGTCTTCAGGG + Intronic
1068362985 10:56004194-56004216 GTCCTACTGGAAGGACTTCAGGG + Intergenic
1068418179 10:56753095-56753117 GTCCTACTGGCAGGTCTTCAAGG - Intergenic
1068441334 10:57058472-57058494 GTCCCACTGGAAGGTCTTCTGGG + Intergenic
1068466175 10:57395727-57395749 TTCCCACTGGAAGGTCTTCAAGG + Intergenic
1068484415 10:57638900-57638922 GTCCCACTGGCAGGTCTTCAGGG - Intergenic
1068546420 10:58351529-58351551 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1068672745 10:59740464-59740486 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1068795315 10:61072913-61072935 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1069051099 10:63795576-63795598 GTCCCACTGGAAGGTCTCCAGGG + Intergenic
1069118732 10:64540829-64540851 GTCCCACTGGGAGGTCTTCAGGG - Intergenic
1069125712 10:64629747-64629769 GTCCCACTGAAAGTTCTTCAGGG - Intergenic
1069211217 10:65761895-65761917 GTCCCACTGGAAGGTCTTGAGGG + Intergenic
1069357460 10:67603474-67603496 GTCCCACTGAAAGGTCTTCAGGG - Intronic
1069418604 10:68225288-68225310 GTCGCACTGGAAGGTGTTCAGGG - Intergenic
1070098712 10:73364627-73364649 ATCCCACTGGAAGGTCTTCAGGG + Intergenic
1070701593 10:78605604-78605626 GTCCCACTGGAAGGGTTTCAGGG - Intergenic
1071047659 10:81402049-81402071 GTCCCATTGGAAGGTCTTCGTGG + Intergenic
1071339610 10:84632277-84632299 GTCCCACTGGAAGGTTTTCAGGG - Intergenic
1071445653 10:85744164-85744186 GTCTTTCTGAGAAGTCTTCAAGG - Intronic
1071461248 10:85898688-85898710 GTCTCACTAGAAGGTCTTCAGGG + Intronic
1071540975 10:86483667-86483689 GTGCCACTGGAAGTTCTTCAAGG - Intronic
1071701475 10:87942685-87942707 GTCCCACTGGAAGGTCTTAAGGG - Intronic
1071742625 10:88378090-88378112 GTCCCACTAGAAGGTCTTCAAGG + Intronic
1071863151 10:89696828-89696850 GTTCTACTGGAATGTTTTCAGGG + Intergenic
1071946454 10:90651041-90651063 TTCCTACTGGAAGGTCTCCAGGG + Intergenic
1071978692 10:90981345-90981367 GTCCCACTGGAAGGTCTTTGGGG - Intergenic
1072061351 10:91814139-91814161 CTCCCACTGGAAGGTCTTTAGGG - Intronic
1072111081 10:92320495-92320517 GTCCCACTAGAAGGTCTTCAGGG - Intronic
1072386090 10:94929668-94929690 GTCCCACTGTAAGGTTTTCAGGG + Intergenic
1073274095 10:102293558-102293580 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1074342753 10:112650342-112650364 GTCCCACTGGAAGATCTGCAGGG + Intronic
1074626177 10:115189437-115189459 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1074728730 10:116344958-116344980 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1075163563 10:120045849-120045871 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1075422984 10:122317774-122317796 GTCCCACTGGAAGGCCTTCAGGG + Intronic
1075498109 10:122945521-122945543 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1075770053 10:124926513-124926535 GTCCCACTGGAAGGTCTTCGGGG + Intergenic
1076096945 10:127739662-127739684 GTCCTAGAGGGGGGTCATCAAGG - Exonic
1076101053 10:127778752-127778774 GTCCTACTAGAAAGTCGTCAAGG + Intergenic
1076158077 10:128218889-128218911 GTCCCATTGGAAGGTCTTGAGGG - Intergenic
1076165930 10:128282813-128282835 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
1076182001 10:128416761-128416783 GTCCCACTGGAAGTTCTTGAGGG - Intergenic
1076907501 10:133370609-133370631 GTCCTCCTCGAAGGTCTTCAGGG + Exonic
1077751987 11:4981935-4981957 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1077871625 11:6267455-6267477 GTCCCACTGGAAGGTCATCAGGG + Intronic
1078031437 11:7755442-7755464 GTCCCACTGGAAGGTGTTCAGGG - Intergenic
1078125005 11:8552700-8552722 GTTCCTCTGGAAGGTCTTCAGGG + Intronic
1078281869 11:9910574-9910596 GTCTCACTGGAAGTTCTTCAGGG - Intronic
1078329100 11:10404198-10404220 GTCCCACTGGAAGATCTTCAGGG - Intronic
1078343460 11:10520459-10520481 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1078644528 11:13127831-13127853 GTCCCACTGCAAGGTCTTCAGGG - Intergenic
1078749701 11:14149179-14149201 GTCCCACTGGAAGGTCCTCGGGG - Intronic
1078777329 11:14405638-14405660 GTCCCACTGGAAGGCCTTCAGGG - Intergenic
1079118904 11:17663327-17663349 GTCCCACTGGAAGGTATTCAGGG + Intergenic
1079199451 11:18363098-18363120 GTCCCACTGAAAAGTCTTCAGGG + Intronic
1079352869 11:19707505-19707527 GTCCCTCTGGAAGGTCTTCAGGG + Intronic
1079540579 11:21568752-21568774 GTCCCACTTGAAGGTCTTCAGGG + Intronic
1079680929 11:23297405-23297427 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1079777389 11:24549316-24549338 GTCCTACTGGAAGGTCTCCATGG + Intronic
1080090060 11:28336953-28336975 GTCCCACTGGAAGGTGTTCAGGG - Intergenic
1080369932 11:31624902-31624924 TTCCCACTGGAAGGTCTTCAGGG + Intronic
1080589994 11:33714829-33714851 GTCCCACTGGAAGGTCTTAGGGG + Intronic
1080724813 11:34886198-34886220 GTCTCAGTGGAAGGTCTTCAGGG - Intronic
1080870670 11:36234121-36234143 CTCTTACTGGGAGTTCTTCAAGG + Intergenic
1081004231 11:37714155-37714177 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1082724232 11:56716053-56716075 GTCTTACCGGATGGTCTTCAAGG - Intergenic
1082892115 11:58150921-58150943 GTCTTACTAGAAGGTCTTCAGGG - Intronic
1083072908 11:60005153-60005175 GTCCCACTGGAAGGTCTTCGTGG - Intergenic
1084293215 11:68190526-68190548 GTCCCACTGGAGCGTCTTCAGGG - Intronic
1084753185 11:71217609-71217631 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1084930957 11:72555400-72555422 GTTCTACTTTGAGTTCTTCAAGG + Intergenic
1085241050 11:75055975-75055997 GTCCCACTGGAAGATCTTCAGGG - Intergenic
1085555468 11:77416438-77416460 GTCCCACTGGAAGGTCTTTAGGG + Intronic
1085677365 11:78536409-78536431 GTCCTACTGAAAGGTCTTCAGGG - Intronic
1086293842 11:85342425-85342447 GCCCCACTGGAAGGTGTTCAGGG + Intronic
1086601077 11:88634572-88634594 ATCCTACCAGAAGGTCTTCAGGG + Intronic
1086643547 11:89190304-89190326 GTCCCACTGGAAAATCTTCAGGG - Intronic
1086799878 11:91159752-91159774 GCCTCACTGGAAGGTCTTCAGGG + Intergenic
1087114106 11:94505323-94505345 GTCCTGCTGGGAGGTGTTCAGGG - Intergenic
1087156763 11:94912312-94912334 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
1087230202 11:95652654-95652676 GTACTGCTGGGTGGTATTCATGG - Intergenic
1087432450 11:98070699-98070721 GTCCCACTGGAAGTTCTTTAGGG - Intergenic
1087475496 11:98628644-98628666 CTCCCACTGGAAGGTCTTCAAGG + Intergenic
1087502228 11:98972151-98972173 GTCTTAATGGAAGGTCTTCAGGG + Intergenic
1087666059 11:101049206-101049228 ATCTCACTGGAAGGTCTTCAGGG + Intronic
1087819689 11:102697940-102697962 GTCCCACTGGAAAGTCTTCAGGG + Intronic
1087921627 11:103873329-103873351 GTCACACTGGAAGGTCTTCAGGG - Intergenic
1087976088 11:104548899-104548921 GTCCTACTGGAAGGTCTTCAGGG + Intergenic
1088056235 11:105582996-105583018 TTCCCACTGGAAGGTCTTTAGGG - Intergenic
1088086860 11:105991629-105991651 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1088096782 11:106109628-106109650 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1088118680 11:106341716-106341738 GTCCCACTGGAAGCTCTTCAGGG - Intergenic
1088266165 11:107989861-107989883 GTCCCACAGGAAGGTCTTCAGGG + Intergenic
1088291317 11:108241162-108241184 GTCCCCCTGGGAGATCTTCAGGG + Intronic
1088336497 11:108710526-108710548 GTCCCACTAGAAGGCCTTCAGGG + Intronic
1088453328 11:110006126-110006148 GTCCCACTGAAAGGTCTTCAGGG + Intergenic
1088462652 11:110098123-110098145 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1088744046 11:112790121-112790143 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1088968957 11:114754620-114754642 GTCCCACTCAGAGGTCCTCAGGG + Intergenic
1088993988 11:114980025-114980047 GTCCCACTAGTAGGTCTTCAGGG - Intergenic
1089419473 11:118320308-118320330 TTCCTGCTGGAAGCTCTTCAAGG + Intergenic
1089812247 11:121141649-121141671 GGCCAACAGGGAGGTTTTCAGGG + Intronic
1089995370 11:122901999-122902021 GTCTCACTGGAAGGTCTTCAGGG + Intronic
1090041212 11:123293700-123293722 GTCCCACTGGAAGGTCTTTAGGG + Intergenic
1090361224 11:126174138-126174160 GTCCCACTGGAAGCTCTTCAGGG + Intergenic
1090491429 11:127164428-127164450 GCCTCACTGGGAGCTCTTCAGGG + Intergenic
1090516712 11:127436394-127436416 GTCCCAGTGGAAGGTCTTCAGGG + Intergenic
1090970174 11:131635308-131635330 ATCCCACTGGAAGGTTTTCAGGG - Intronic
1091063709 11:132489248-132489270 GCCCCGCTGGGAGGTCTTCAGGG + Intronic
1091361233 11:134979898-134979920 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1091364168 11:135003767-135003789 GTCCCACTGGAACATCTTCAGGG + Intergenic
1091628803 12:2142627-2142649 GTGCCACTGGAAGGTCTTCGGGG - Intronic
1091700667 12:2658734-2658756 GTCCTATCGGAAGGTCTTCAGGG - Intronic
1091766920 12:3127238-3127260 GTCCCGCTGGAAGGTCTTCAGGG + Intronic
1091812751 12:3413521-3413543 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1092110296 12:5956383-5956405 GTTCCACTGGAAAGTCTTCAGGG - Intronic
1092285930 12:7129340-7129362 GGCCTACAGGGTGCTCTTCATGG - Intergenic
1092499897 12:9034902-9034924 GTCCCACTGGGAGTTCTTCAGGG - Intergenic
1092546482 12:9456367-9456389 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1093058852 12:14582081-14582103 GTCCTACTGTAAGGTATTTAGGG + Intergenic
1093122666 12:15291646-15291668 GTCCCATTGGAAGGTCCTCAGGG + Intronic
1093407883 12:18827558-18827580 GTCCCACTGGCAGGTCTTCAGGG + Intergenic
1093439051 12:19171918-19171940 GTCCCACTGTAAGATCTTCAGGG + Intronic
1093835042 12:23818902-23818924 ATCTCACTGGAAGGTCTTCAGGG + Intronic
1093956398 12:25224305-25224327 GTCCCACTGGAAGATCTTCAGGG - Intronic
1094030056 12:26001667-26001689 GTCGTACTGGAAGGTCTTCAGGG + Intronic
1094416272 12:30218811-30218833 TTCCCGCTGGAAGGTCTTCAGGG - Intergenic
1094446607 12:30537817-30537839 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1094455488 12:30627950-30627972 GTCCCCCTGGAAGGTCTTAAGGG - Intergenic
1094506458 12:31065707-31065729 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1094737208 12:33248554-33248576 CTCCCACTGGAAGGTCTTCAGGG + Intergenic
1095170738 12:39032949-39032971 GTCCCATAGGAAGGTCTTCAGGG - Intergenic
1095222480 12:39633360-39633382 GTTCCACAGGAAGGTCTTCAGGG + Intronic
1095223997 12:39656684-39656706 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1095715146 12:45336902-45336924 GTCTCACTGGAAGGTCTTCAGGG - Intronic
1095807161 12:46332163-46332185 GTCTTACTGGAGGGTCTTCAGGG + Intergenic
1096057921 12:48670428-48670450 GTCCCAGTGGAAGGTCTTCGGGG - Intronic
1096342664 12:50815234-50815256 ATCCCACTGGAAGGTCTTTAGGG - Intronic
1096398233 12:51283389-51283411 GTCCCACTAGAAGGTCTTCAGGG - Intronic
1096474949 12:51902971-51902993 GTCCCACTGGTAGGTCTTCAGGG + Intergenic
1096590081 12:52652207-52652229 GTGCTGCTGGGAGGCTTTCAGGG + Intergenic
1096911929 12:54992826-54992848 ATCCCACTGGAAGGTCTTCAGGG + Intergenic
1097003239 12:55896259-55896281 GTCCCACTGGAAGGTTTTCTGGG + Intergenic
1097025561 12:56052738-56052760 GTCCCACTGGAAGATCTTCAGGG + Intergenic
1097184445 12:57189079-57189101 ATCCTACTGTGAGCTCTACAGGG - Intronic
1097272495 12:57785345-57785367 GTCCTGCTGGAAGGTCTTCAGGG + Intronic
1097490718 12:60267125-60267147 GTCCTACTGAAAAGTCTTCAGGG + Intergenic
1097630882 12:62060691-62060713 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1097649417 12:62278194-62278216 GTCCCATTGGAAGGTCTTCATGG + Intronic
1098017149 12:66117727-66117749 GTCCCACTGCAAGGCCTTCAGGG - Exonic
1098108697 12:67098441-67098463 ATACCACTGGAAGGTCTTCAGGG - Intergenic
1098274059 12:68796046-68796068 GTCCCACTGGTACGTCCTCATGG + Intergenic
1098351434 12:69565711-69565733 GTCCCACTGGAAAGTCTTCAGGG + Intronic
1098782281 12:74702015-74702037 GTTCAACTGGCAGGTCTTCTAGG - Intergenic
1098785848 12:74754058-74754080 GTCCCACTGGAAAGTCTTCAAGG - Intergenic
1098796627 12:74896771-74896793 GTCTGACTGGAAGGTGTTCAGGG + Intergenic
1098800274 12:74948793-74948815 GTCCCACTGGAAGGTCTTCGGGG + Intergenic
1098880455 12:75912007-75912029 GTCCCACTGGGAGGTCTTCATGG - Intergenic
1099546100 12:83981914-83981936 GTCCCACTGGAAGGTCGTCAGGG + Intergenic
1099559722 12:84155992-84156014 GTTCTACTGGAAGATTTTCAGGG - Intergenic
1099670257 12:85682371-85682393 GTCCCACTAGAAGATCTTCAGGG + Intergenic
1100152369 12:91754987-91755009 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1100314284 12:93429673-93429695 GTCCTACTCGAAGGTCTTCAGGG - Intronic
1100457002 12:94762048-94762070 GTCCCACTGGGAGGTCTTCAGGG - Intergenic
1100692634 12:97054811-97054833 GTCCCTCTGGAAGATCTTCAGGG - Intergenic
1100807876 12:98306571-98306593 ATTCCACTGGAAGGTCTTCAGGG + Intergenic
1100967175 12:100025766-100025788 GTCCTACTGGAAGGTCTTCAGGG + Intergenic
1101050795 12:100861951-100861973 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1101110753 12:101483345-101483367 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1101555371 12:105803787-105803809 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1101563091 12:105878731-105878753 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1101619078 12:106365962-106365984 GTCCCACTGGAGGGTCTTCATGG + Intronic
1101673010 12:106894245-106894267 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1101784191 12:107867961-107867983 GCCCCACTGGAAGTTCTTCAAGG + Intergenic
1101989402 12:109472392-109472414 GTCCCACTAGAAGGTCTTCAGGG + Intronic
1102918005 12:116769438-116769460 GTCCCACTGGAAGATCTTCAGGG - Intronic
1103178664 12:118888155-118888177 GTCCTACTGGAAGGTCTTCAGGG + Intergenic
1103229588 12:119317744-119317766 ATCCCATTAGGAGGTCTTCAGGG + Intergenic
1104659919 12:130604033-130604055 GTCCTGCTGGAAGGTCTCCAGGG - Intronic
1104675944 12:130712510-130712532 GTCCCGCTGGGAGGTCTCCAGGG + Intronic
1105203994 13:18204241-18204263 GTCCCAGTGAAAGGTCTTCAGGG + Intergenic
1105683773 13:22756625-22756647 GACCCACTGGAAGGTCTTCAGGG - Intergenic
1105760325 13:23508087-23508109 GTCCCACTGGGAGGTCTTCAGGG - Intergenic
1105795936 13:23852827-23852849 GTCCTACTAGAAGGTCTGCAAGG - Intronic
1105832920 13:24181643-24181665 GTCCCACTAGAAGGTCTTCAGGG + Intronic
1105939448 13:25134219-25134241 GGCCTAATGGGAGGTGTTTAGGG + Intergenic
1106175404 13:27326322-27326344 GTCCCACTGGAAGACCTTCAGGG + Intergenic
1106406120 13:29475527-29475549 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1106417829 13:29560253-29560275 GTCCCACCGGAAGGTCTTCAGGG + Intronic
1106957722 13:34960101-34960123 GTCCCACTGAAAAGTCTTCAGGG - Intronic
1107268811 13:38589988-38590010 GTTCCACTGGAAGGTCTGCAGGG - Intergenic
1107294751 13:38897122-38897144 GTCCCGCTGGAAGGTCTTCAGGG + Intergenic
1107321924 13:39199008-39199030 GTCCCACTGGAAGGTCTGCAGGG - Intergenic
1107445044 13:40462921-40462943 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
1107454719 13:40544427-40544449 GTCCCACTGGAAGGTCTGCAGGG - Intergenic
1107986668 13:45782042-45782064 GTCCTACTGGGAAGGCTTATAGG + Exonic
1108384860 13:49889867-49889889 GTCCCACTGGAGGGTCTTCAGGG - Intergenic
1108387071 13:49908880-49908902 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1108453722 13:50592235-50592257 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1108531040 13:51327439-51327461 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1108567512 13:51715484-51715506 GTCCCACTGGAAGGTCTTCGGGG + Intronic
1108583416 13:51846682-51846704 GTCCCACTGGAAGTTCTTCAGGG - Intergenic
1108747162 13:53407874-53407896 GTCCCATTGAAAGGTCTTCAGGG + Intergenic
1108767850 13:53655692-53655714 GTCCCACTGGGAAGTCTTCAGGG + Intergenic
1108812433 13:54244644-54244666 GTATCACTGGAAGGTCTTCAGGG + Intergenic
1108825154 13:54404577-54404599 GTCCCACTGAAAGGTCTTCAGGG + Intergenic
1109104740 13:58236816-58236838 GTCCCACTGGAAGGTCTTCGGGG + Intergenic
1109110087 13:58305884-58305906 ATCCCACTGGAAGGTCTTGAGGG + Intergenic
1109126783 13:58527890-58527912 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1109454177 13:62561898-62561920 GTCCCTCTGGAGGGTCTTCAGGG - Intergenic
1109472102 13:62821455-62821477 ATCCCACTGGAAGGCCTTCAGGG - Intergenic
1109505411 13:63294461-63294483 GTCCCACTGGTAGGTCTTCAGGG + Intergenic
1109587439 13:64425257-64425279 GGCCAACTGGAAGGTCTTCATGG + Intergenic
1109591885 13:64495321-64495343 ATTCCACTGGAAGGTCTTCAGGG - Intergenic
1109663440 13:65496733-65496755 GTCCCACTGGAAGTTCTTCATGG + Intergenic
1109831034 13:67789194-67789216 GTCCTACTGGAAGGTCTTTAAGG - Intergenic
1109860764 13:68195252-68195274 GTCCCACTAGAAGGCCTTCAAGG + Intergenic
1109990080 13:70042837-70042859 GTCCCACTGGAGAGTCTTCAGGG - Intronic
1110454138 13:75671090-75671112 GTCCCACTGGAAGGCCCTCAGGG + Intronic
1110473379 13:75885762-75885784 ATTCCACTGGAAGGTCTTCAGGG + Intergenic
1110717074 13:78718181-78718203 GTCCCACTGGAAGGTCTTTCAGG + Intergenic
1110758440 13:79203162-79203184 GTCCCACTGGAAGGACTTCAGGG - Intergenic
1110769604 13:79325380-79325402 GTCCCACTGGAAAGTCTTGAGGG - Intronic
1110786062 13:79527862-79527884 GTCCCACTGGAAGGTCGTCAAGG - Intronic
1110903215 13:80850985-80851007 GTCTTTCTGGAAGGTCTTCAGGG - Intergenic
1110933130 13:81248564-81248586 GTCCCACTGAAAAGTCTTCAAGG + Intergenic
1111053507 13:82917498-82917520 GTCCTACTGGAAGGTCTTCAGGG - Intergenic
1111289961 13:86153276-86153298 GTCCCACTGGTAGGTCGTCAGGG + Intergenic
1111349140 13:87003069-87003091 TTCCCACTGGCAGGTCTTCAGGG - Intergenic
1111370972 13:87316059-87316081 GTCCCACCAGGAGGTCTTCAGGG - Intergenic
1111421409 13:88016451-88016473 GTCCCCCTGGAAGGTCTTCAGGG - Intergenic
1111509316 13:89240559-89240581 GCCCCACTGGAAGGTCTTCAGGG + Intergenic
1111591908 13:90358759-90358781 GTCCCATTGGAAGTTCTTCAGGG - Intergenic
1111753708 13:92365776-92365798 GTCCTACTGTGGGGTCTTCAGGG + Intronic
1111762598 13:92484215-92484237 GTACTACTGGAGGGACTTCAAGG + Intronic
1111787047 13:92801638-92801660 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1111861769 13:93716375-93716397 GTCTCACTGGAAGGTCTTCAGGG - Intronic
1112253941 13:97810797-97810819 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1112470434 13:99683620-99683642 GTCCCAGTGGAAGGTCTTTAGGG + Intronic
1112942485 13:104881222-104881244 GTCCTACTGGAAGGTCTTCAGGG + Intergenic
1113030529 13:105989364-105989386 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1113125481 13:106973869-106973891 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1113137061 13:107102859-107102881 GTCCTACTGGAAGGTCTTCAGGG - Intergenic
1113390907 13:109895549-109895571 GTCCCACTGGGAGTTTGTCAGGG + Intergenic
1113529402 13:111010293-111010315 GTCCCACTGCAAGATCTTCAGGG - Intergenic
1113694442 13:112333910-112333932 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1114382135 14:22218118-22218140 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1114464002 14:22907795-22907817 GTCCCACTGGAAGGTCTTCAAGG - Intronic
1114879246 14:26763259-26763281 GTCCCACTGGAAGGTGTTCAGGG + Intergenic
1114951349 14:27758175-27758197 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1115210413 14:30962045-30962067 ATCCCACTGGAAGGTCTTCAAGG - Intronic
1115255000 14:31390957-31390979 GTCCCACTGGATGGTCTTCAAGG - Intronic
1115286258 14:31716117-31716139 GTCCCACTGAAAGGTCTTCAGGG + Intronic
1115404962 14:33004943-33004965 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1115916836 14:38324626-38324648 GTCCCACTTGAAGGTCTTCAGGG + Intergenic
1115930674 14:38489453-38489475 GTCTTACTGGGCTGTCTTCAAGG + Intergenic
1116105630 14:40500397-40500419 GTCCCACTGGACGGTTTTCAGGG - Intergenic
1116106112 14:40508991-40509013 GTCCCACTGGTAAGTCTTCAGGG - Intergenic
1116425918 14:44791117-44791139 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1116700900 14:48240400-48240422 GTCCCACTGGAAGGTCTTCGGGG + Intergenic
1116753775 14:48920493-48920515 GTCCCTCTGAAAGGTCTTCAGGG + Intergenic
1116814052 14:49567222-49567244 GTCCTCCTGGCACATCTTCAGGG - Intergenic
1117113545 14:52485118-52485140 GTCCCTTTGGAAGGTCTTCAGGG - Intronic
1117149356 14:52869833-52869855 GTCTCACTGGAAGGTCTTCAGGG - Intronic
1117197723 14:53357251-53357273 ATCCCACTGGAAGGTCTTCAAGG - Intergenic
1117235190 14:53766980-53767002 GTCCCACTGGAAGGCCTTCAAGG + Intergenic
1117344154 14:54816623-54816645 GTTCTGCTGGAAGGTCTTCACGG - Intergenic
1117558876 14:56915324-56915346 GTCCCACTGGAAAGCCTTCAGGG + Intergenic
1117732550 14:58737950-58737972 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1117863333 14:60116806-60116828 GTTCCACTGGAAAGTCTTCAGGG - Intronic
1117873797 14:60228872-60228894 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1118079818 14:62345686-62345708 GTCCCACCGGGATGTCTTCAGGG + Intergenic
1118307165 14:64664558-64664580 GTACCACTGGAAGGTCTTTAGGG + Intergenic
1118512605 14:66492093-66492115 GGCCTTCTGGTAGTTCTTCAAGG - Intergenic
1118698257 14:68406954-68406976 GTCTCACTGGAAAGTCTTCAGGG + Intronic
1118802068 14:69199726-69199748 GTCCCACTGGAAAGTCTTCAGGG + Intronic
1118839589 14:69500638-69500660 GTCCTGGTGGGAGATCTTCATGG - Exonic
1118896404 14:69949310-69949332 GTCCCACTGGCAGGTGTTGAGGG + Intronic
1119314644 14:73682752-73682774 GTCCCACTGGAAAGTCTTCAGGG + Intronic
1120065451 14:80035187-80035209 GTCCCACTGGAAGGCCTTCAGGG - Intergenic
1120199555 14:81521892-81521914 GTCCCATTGGAAGGTCTTCAGGG - Intronic
1120712980 14:87812154-87812176 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1121584452 14:95053545-95053567 GTTCCACTGGAAGGTCTTCAGGG + Intergenic
1121855304 14:97263836-97263858 GTCTCCCTGGAAGGTCTTCAGGG - Intergenic
1122116030 14:99527710-99527732 GTCCTTGAGGGAGGTCTCCAGGG - Intronic
1122291684 14:100683913-100683935 GTCCTGCTGGGCGGACGTCAGGG - Intergenic
1123642287 15:22408561-22408583 GTCCCTCTGGGGGGTCTTCATGG - Intergenic
1123966224 15:25461438-25461460 GTCACACTGGCAGGTTTTCAGGG - Intergenic
1124163557 15:27296954-27296976 GTCCCACTGGAAGGTTTTCAGGG - Intronic
1124449189 15:29770018-29770040 GTCCTAGTGGGAGGTCTTCAGGG - Intronic
1124506916 15:30285404-30285426 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1124665900 15:31592465-31592487 GTCCCACTGGTAGGTCTTCAGGG + Intronic
1124736641 15:32253257-32253279 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1125147089 15:36483818-36483840 GTCCCACTAGAAGGTCTTCAGGG - Intergenic
1125322600 15:38504545-38504567 ATCCTATTGGAAGGTCTTTAGGG + Intronic
1125436769 15:39654037-39654059 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1125444160 15:39735926-39735948 GTCCCACTGGAAGGTCTTCAAGG + Intronic
1125456320 15:39862951-39862973 GTCCCATAGGAAGGTCTTCAGGG - Intronic
1125519849 15:40341862-40341884 GACCCACTGGAAGGTCTTCAGGG - Intergenic
1125990678 15:44104067-44104089 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1126329676 15:47518778-47518800 GTCCCACTGGAAAGCCTTCAGGG + Intronic
1126402724 15:48290248-48290270 ATCCCACTGGAAGGTCTTCCAGG + Intronic
1126440265 15:48680715-48680737 GTCCCACTGGAAGGTCTTCAAGG + Intergenic
1126477532 15:49081165-49081187 GTCCCACTGGATGGTCTTCAAGG - Intergenic
1126494420 15:49274853-49274875 GTCCTACTGGAAGGTCTTCAGGG + Intronic
1126523860 15:49628190-49628212 GTCCCACTGGAAGCTCTTCAGGG + Intronic
1126529462 15:49696922-49696944 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1126702017 15:51376836-51376858 GTCCTATTGGAGGGTCTCCAGGG + Intronic
1126880902 15:53096129-53096151 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1127024408 15:54787315-54787337 ATTCTACTGAGAGATCTTCAGGG + Intergenic
1127662209 15:61110633-61110655 GTCCCCCTGGCAGGTCTTCAAGG - Intronic
1127690957 15:61397044-61397066 GTCCCACTGAAAGCTCTTCAAGG - Intergenic
1127897995 15:63319596-63319618 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1128334193 15:66775620-66775642 GTCCTGCTGGGAGGGTTCCAGGG - Intronic
1128494491 15:68186212-68186234 GTCCCACTGCATGGTCTTCAGGG - Intronic
1128948026 15:71843796-71843818 TTCCTCCTGGGTCGTCTTCAAGG - Intronic
1129067131 15:72914691-72914713 GCCCCACTTGGAGGTCTTCTTGG + Intergenic
1129490607 15:75921874-75921896 GTCCCACTGCAAGGTCTTCAGGG + Intronic
1129620459 15:77139201-77139223 GTCCCAGTGGCAGGTCTTCAGGG + Intronic
1129961093 15:79685286-79685308 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1130021763 15:80237471-80237493 ATCCCACTGGAAGGGCTTCAGGG - Intergenic
1130156252 15:81352704-81352726 GTCCCACTGGAAGGTCTTCGGGG - Intronic
1131179120 15:90228265-90228287 GTCCTACTGGAAGGAGTTCCTGG + Exonic
1131412534 15:92222009-92222031 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1132033150 15:98455419-98455441 GTCCCACTGGAAGGTCTCCAGGG - Intronic
1132508445 16:324436-324458 GTCCTCCGGGGAGGTTTGCAAGG + Intronic
1132569739 16:638858-638880 GACTTACTGGGAGGCCCTCAGGG - Intronic
1133016555 16:2944946-2944968 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1133023369 16:2976663-2976685 CTCCTACGGAGAGGTCTTCAAGG - Exonic
1134789434 16:16975634-16975656 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1135488669 16:22888046-22888068 GTCCCACTGGGAGCTCTGGAAGG - Intronic
1137300890 16:47146416-47146438 GTGCTACTGGGTGATCTTCCAGG - Intergenic
1138356859 16:56388803-56388825 GTCCCACTGGAACGTCTTCAGGG + Intronic
1138552530 16:57755346-57755368 GGCCTGCTGGGGGATCTTCACGG - Exonic
1139002399 16:62528500-62528522 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1139072170 16:63395941-63395963 GTCCTGCTGGAAGGACTTCAGGG - Intergenic
1139104174 16:63806218-63806240 GTCTCACTGGAAGGTCTTCAGGG - Intergenic
1140274935 16:73500198-73500220 CTCCCACTGGAAGGTCTTCAGGG - Intergenic
1140716580 16:77731749-77731771 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1140956889 16:79874535-79874557 CTCCTACTGGGAAGTTCTCAGGG + Intergenic
1141928713 16:87186206-87186228 GCCCTCCTGGGAGGTCGTCCTGG - Intronic
1142105383 16:88299695-88299717 GAGCTGCTGGGAGGTCTTCAGGG + Intergenic
1143300553 17:5907113-5907135 GTCTCACTGGAAGGTCTTCAGGG + Intronic
1143339379 17:6197983-6198005 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1144117770 17:12116709-12116731 GCCCCACTGGAAGGTCCTCAGGG + Intronic
1144224668 17:13133315-13133337 TTCCTTCTGTGAGGTTTTCAGGG + Intergenic
1144312101 17:14023387-14023409 GTCCCACCGGAAGGTCTTCAGGG - Intergenic
1144332659 17:14237932-14237954 GTCCCACCGGAAGGTCTTCAGGG + Intergenic
1144370107 17:14582209-14582231 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1145085525 17:19935728-19935750 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1145735383 17:27226369-27226391 GTCCCACTGGGAGATCTTCGGGG - Intergenic
1145786907 17:27599974-27599996 GTCCCACCGGAAGGTCTTCGGGG + Intronic
1145820890 17:27834388-27834410 GTCCCACTGGAAGGTCTTTGGGG + Intronic
1145834504 17:27944137-27944159 GAACTACTGGGAGTTCCTCAAGG + Intergenic
1146078040 17:29750986-29751008 GCCACACTGGAAGGTCTTCAAGG + Intronic
1146643535 17:34559983-34560005 GTTGCACTGGAAGGTCTTCAGGG - Intergenic
1146702975 17:34978262-34978284 GTCCTACTGGAAGGCCTTCAGGG + Intronic
1146980206 17:37153326-37153348 GTGCTTCTGGGAGTTCATCATGG - Intronic
1147683136 17:42267378-42267400 GTTCCACTGAAAGGTCTTCAGGG - Intronic
1148223198 17:45879593-45879615 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1148731005 17:49836596-49836618 ATAATACTGTGAGGTCTTCAAGG + Intergenic
1149169998 17:53798136-53798158 GTCCTTTTGGAAGGTCTTCAGGG - Intergenic
1149426749 17:56562215-56562237 GTCCGATTGGAAGGCCTTCAGGG - Intergenic
1149629046 17:58105651-58105673 GTCTTACTAGAAGGTTTTCAGGG - Intergenic
1149743734 17:59073847-59073869 GTCCCATTGAAAGGTCTTCACGG + Intronic
1149889526 17:60374279-60374301 GTCCCACTGGAAAGTCTTCAGGG + Intronic
1150011027 17:61503863-61503885 GTCCCACTGGAAGGTCCTCAGGG + Intergenic
1150120042 17:62593637-62593659 GTCCCACTGGAAGCTCTTCAGGG + Intronic
1150607158 17:66703368-66703390 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1150683098 17:67298910-67298932 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1150867832 17:68872670-68872692 GTCCCACTGGAAGGTCTTCGGGG - Intronic
1151059049 17:71069889-71069911 GTCCCACTAGAAGGTCTTCAGGG + Intergenic
1151141958 17:72001948-72001970 GTCCCACTGGAAGCTCTTCAGGG + Intergenic
1152721057 17:81924013-81924035 GGCCGACTGGGAGGTCTAGAGGG - Intronic
1153084003 18:1262210-1262232 GTCTCACTGGAAGGTGTTCAGGG + Intergenic
1153198634 18:2627243-2627265 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1153470123 18:5434935-5434957 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1153510712 18:5848846-5848868 GTCCCAGTGGGAAGTCTACAAGG + Intergenic
1153566556 18:6424744-6424766 GTCCCACTTGAAGGTCTTCAGGG - Intergenic
1153692865 18:7610953-7610975 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1153728533 18:7982402-7982424 CTCCCACTGGAAGGTCTTCAGGG + Intronic
1153955703 18:10093994-10094016 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1154494061 18:14942994-14943016 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1154969197 18:21390400-21390422 GTCCTACTGGAAGGTCTTCAGGG - Intronic
1155227934 18:23746379-23746401 GACCTTTTGGGAGGTCTACAAGG + Intronic
1155410384 18:25538027-25538049 GTCCCACAGGAAGGTTTTCAGGG + Intergenic
1155623833 18:27812055-27812077 ATTCCACTGGAAGGTCTTCAGGG + Intergenic
1155632919 18:27915965-27915987 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1155663981 18:28284817-28284839 GTCCCAGTGGAAGGTCTTCAGGG + Intergenic
1155694076 18:28662754-28662776 GTCCCACTGGAAAGGCTTCAGGG + Intergenic
1155822912 18:30400758-30400780 GTCCCACTGGAAGGTTTTCAGGG - Intergenic
1156089618 18:33450427-33450449 ATCCTACTAGAAGCTCTTCAGGG + Intergenic
1156517186 18:37690327-37690349 GTCCTACTGGGAGGTCTTCAGGG - Intergenic
1156615072 18:38773141-38773163 GTTCCACTGGAAGGTCTTCAGGG + Intergenic
1156666657 18:39416634-39416656 GTTCTACTCGAAGGACTTCAGGG + Intergenic
1156729027 18:40167431-40167453 GTCCCACTGACAAGTCTTCAAGG - Intergenic
1156826536 18:41436222-41436244 GTCCCACTGGGAGGGCCTCCAGG - Intergenic
1156974527 18:43202763-43202785 GTCCCACTGGAGGGTCTTCAGGG + Intergenic
1157052352 18:44181283-44181305 GCCCCAGTGGGAGGTCTTCAGGG + Intergenic
1157129111 18:44986738-44986760 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1157147308 18:45176948-45176970 TTTCTACTTGGATGTCTTCATGG + Intergenic
1157443081 18:47724913-47724935 CTCCTGCTGGGTGGTTTTCAGGG + Intergenic
1157717386 18:49897310-49897332 GTTCCACTGGAAGGTCTTCAGGG - Intronic
1157890859 18:51416358-51416380 GTCCCACTAGAAGGTGTTCAGGG + Intergenic
1157987948 18:52461259-52461281 TTCCCATTGGAAGGTCTTCAGGG + Intronic
1158084117 18:53629888-53629910 GTCTCACTGGAAGATCTTCATGG - Intergenic
1158158577 18:54453820-54453842 GTTCCACTGGAAGGTCTTCAGGG + Intergenic
1158889624 18:61860786-61860808 GTCCCATTGGAAGGTCTTCAGGG - Intronic
1159187222 18:64990782-64990804 GTCCCACTGGAAGGTCTTTGGGG - Intergenic
1159273075 18:66178580-66178602 GTGTCACTGGAAGGTCTTCAGGG + Intergenic
1159389209 18:67766576-67766598 GTCCCAGTGGAAGGTCTTCAGGG + Intergenic
1159870271 18:73753502-73753524 GTCCCACTGGAAAGTCTTCAGGG - Intergenic
1160097213 18:75885438-75885460 GTCCCACAGGAAGGTCTTCAGGG - Intergenic
1160368038 18:78346083-78346105 GTTCCACTGGAAGGTCTTCAGGG + Intergenic
1160457369 18:79011853-79011875 ATCCCACTGGGAGGTCTCCTGGG - Intergenic
1162413320 19:10519034-10519056 GCCATGCTGGGAGATCTTCAGGG - Intergenic
1163010507 19:14422559-14422581 GACCTAGTGGGAGGTCTTTTTGG + Intergenic
1163081644 19:14948153-14948175 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1164675716 19:30099484-30099506 ATCCCACTGGAAGATCTTCAGGG - Intergenic
1165195662 19:34101017-34101039 GTCTCATTGGAAGGTCTTCAGGG - Intergenic
1165200903 19:34144075-34144097 GGCCCACTAGAAGGTCTTCAGGG + Intergenic
1165586413 19:36920087-36920109 GCCCCACTGGAAGATCTTCAGGG - Intronic
1165648265 19:37463741-37463763 GTTCCACTGGAAGGTCTTCAGGG - Intronic
1165699157 19:37924300-37924322 GTCCCACTGGAAGGTCTTCGGGG + Intronic
1166445754 19:42856302-42856324 GTCCTACCTGGAGGTGTGCAGGG + Intronic
1166941636 19:46370419-46370441 GTCCCACTGGAAGGTCCTCTGGG + Intronic
1167293877 19:48638354-48638376 GAACTACTTGAAGGTCTTCATGG + Intronic
1167653981 19:50751355-50751377 ATCCCACTGGAAGATCTTCAGGG - Intergenic
1168399162 19:56074079-56074101 GTCCCCCTAGAAGGTCTTCAGGG + Intergenic
925110737 2:1334390-1334412 GTCCTACTTTTAGTTCTTCAAGG - Intronic
925311950 2:2890983-2891005 GTCCTACTGTAAGGTAGTCAGGG - Intergenic
925630077 2:5882928-5882950 GTCCCATTGGAAGGTTTTCAGGG - Intergenic
925669837 2:6299794-6299816 GTCCCACCAGAAGGTCTTCAGGG - Intergenic
925915835 2:8605113-8605135 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
925959321 2:9001079-9001101 GTCCCACTGAAAGGTCTTCAGGG + Intronic
926303879 2:11623481-11623503 GTCCCACTAGAAGGTCTTCAGGG - Intronic
926433329 2:12813360-12813382 GTCCACCTGGGAGGTCTTCCAGG - Intergenic
927422284 2:22946043-22946065 GTCCCATTGGAAGGACTTCAGGG + Intergenic
928221978 2:29411206-29411228 GTCCCACTGGAAGGTCTTCAGGG + Intronic
928255002 2:29714597-29714619 ATCCTGGTGGGAGGTCGTCAGGG - Intronic
928736878 2:34301350-34301372 GTCCCACTGGAAGGTGTTCAGGG + Intergenic
928793384 2:34985921-34985943 GTCCCACTGGAAGGTCTTTAGGG + Intergenic
928842456 2:35626532-35626554 ATCCCATTGGAAGGTCTTCAGGG + Intergenic
928874500 2:36021708-36021730 GTCCCACTGGGAGGTGTTCAGGG - Intergenic
928933239 2:36647147-36647169 TTCCTACTGGAAAGTCTTCAAGG - Intergenic
928956161 2:36870853-36870875 GTCCCACTAGAAGGTCTTCAGGG - Intronic
929240080 2:39645226-39645248 GTCCCCTTGGAAGGTCTTCAGGG + Intergenic
929253799 2:39787696-39787718 TACCCACTGGGAGGTATTCAGGG - Intergenic
930144574 2:47988569-47988591 GTCTCCCTGGAAGGTCTTCAGGG - Intergenic
930181467 2:48363145-48363167 GTCCCACTGGAAGGTCTTTAGGG - Intronic
930182817 2:48381805-48381827 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
930535451 2:52640227-52640249 GTCCCACTGAAAGGTCTTCGGGG - Intergenic
930652789 2:53979165-53979187 GTTGCACTGGAAGGTCTTCAAGG - Intronic
931024748 2:58098001-58098023 ATCCCCCTGGAAGGTCTTCAGGG - Intronic
931193305 2:60026396-60026418 GTCCCACCGGAAAGTCTTCAGGG + Intergenic
931260836 2:60617368-60617390 GTCCCTCTGGTAGGTTTTCAGGG - Intergenic
931423255 2:62147431-62147453 GTCCCACTGGACGGTCTCCAGGG - Intergenic
931823389 2:65974877-65974899 GTGCGTCTGGGAGGTCTTTATGG - Intergenic
931898405 2:66760216-66760238 GTCCCATTGGAAGGTCTTCAGGG - Intergenic
932443426 2:71754126-71754148 GTCCCACTAGAAGGTCTTCAAGG - Intergenic
932444816 2:71772300-71772322 GTCCCACTGGAAGGTCTACAGGG - Intergenic
932585737 2:73027174-73027196 TTCCCACTGGAAAGTCTTCAGGG - Intronic
932690723 2:73911033-73911055 GGCCCACTGGAAGGTCTTCAGGG + Intronic
933120782 2:78534884-78534906 GTCCCACTGGAAGGTCCTCAGGG - Intergenic
933410111 2:81914914-81914936 GTCCCACTGGTAGATCTTCAGGG + Intergenic
933433637 2:82216277-82216299 GCCCCACTAGAAGGTCTTCAGGG + Intergenic
934029623 2:88031199-88031221 GTCCCACTGGGGGGTCTTCAGGG - Intronic
934486003 2:94711526-94711548 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
934544362 2:95202550-95202572 GTCCCAGTGGAAGGTCTTCAAGG - Intergenic
934962783 2:98691808-98691830 GTCCCACTGGAAGGCCTTCAGGG - Intronic
935080480 2:99788344-99788366 GTCCCACTGGGAGGTCTTCAGGG - Intronic
935083357 2:99821186-99821208 TTCCCACTGGAAGGTCTTCAAGG + Intronic
935178040 2:100666396-100666418 GTCCCACTGAAACGTCTTCAGGG - Intergenic
935314829 2:101822000-101822022 GTCCCAGTAGAAGGTCTTCAAGG + Intronic
935423602 2:102896121-102896143 GTTCCACTGGAGGGTCTTCAGGG - Intergenic
935644409 2:105322053-105322075 GTCCCACTGGAAGGTCTTCGGGG - Intronic
935716240 2:105941585-105941607 GTCCCACTGGAAGGTCTTGAGGG + Intergenic
935818667 2:106871726-106871748 GTCCCACTGGAAGGTCTTCAGGG + Intronic
935866290 2:107391264-107391286 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
936000560 2:108824479-108824501 GTTCCACTGGAAGGTCTTCGGGG + Intronic
936143539 2:109962674-109962696 ATCCCACTGGAAGGTCTTCAGGG + Intergenic
936180222 2:110260637-110260659 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
936201149 2:110408792-110408814 ATCCCACTGGAAGGTCTTCAGGG - Intronic
936289089 2:111205313-111205335 GTCCCACTGGAGGGTCTTCAGGG - Intergenic
936579558 2:113685982-113686004 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
936616144 2:114049524-114049546 TTCCTTCTGGAAGATCTTCAGGG + Intergenic
936933663 2:117816500-117816522 GTCCCACTGGAAGATCTTCAGGG + Intronic
937260960 2:120586661-120586683 GTGCTACTGGCAGGCTTTCAGGG - Intergenic
937431131 2:121839338-121839360 GTCCCACTGGAAGTTCTTCAAGG - Intergenic
937580195 2:123475684-123475706 GTCCCACTGATAGGTCTTCAGGG - Intergenic
937658112 2:124400023-124400045 GTCTTAATGGGAGATCTTCCTGG - Intronic
937704876 2:124908720-124908742 GTCCCACTGAAAGGTCTTCAAGG - Intronic
937725595 2:125161469-125161491 GTCCCATTATGAGGTCTTCAGGG - Intergenic
937733812 2:125265356-125265378 CTCCCACTGGAAGGTCTTCAGGG - Intergenic
938652967 2:133402552-133402574 GGCCTAGTGGGAGGTGTTCGTGG + Intronic
938813547 2:134876539-134876561 GTCCCACTGGAAGGTCTTCGGGG + Intronic
939075767 2:137600858-137600880 GTCCTACTAGAAGGTCTTCAGGG - Intronic
939144198 2:138392663-138392685 GTCTCACTGGAAGGTCTTCAGGG - Intergenic
939330216 2:140749614-140749636 GTCCCACTGGAAGGTCTTCAGGG + Intronic
939464137 2:142535513-142535535 GTCCCAGTGGAAGGTCTTCAGGG - Intergenic
939694601 2:145308945-145308967 GTCCTACTGGCCAATCTTCAGGG - Intergenic
939975540 2:148713234-148713256 GTCCCACTGGAAGCTCTTTAGGG - Intronic
940005670 2:149007499-149007521 GTCCCACTGGGAAGTCTTAATGG - Intronic
940023004 2:149175840-149175862 GTCCCACTGGAAGGTCTTCAGGG + Intronic
940038606 2:149335246-149335268 GTCCCACTGGAAGGTCTTCAGGG - Intronic
940113168 2:150177670-150177692 GTCCCACTCAGAGGTCTTCAGGG - Intergenic
940697577 2:156998715-156998737 GTCTCACTGGAAGGTCTTCAGGG + Intergenic
941074872 2:160995515-160995537 GGCCCATTGGAAGGTCTTCAGGG - Intergenic
941250742 2:163158702-163158724 GTCCCATTGGAAGGTCCTCAGGG + Intergenic
941549423 2:166896361-166896383 GTCCCACTGGAAGGTTTTCAGGG - Intronic
942151442 2:173079773-173079795 GGCTCACTGGAAGGTCTTCAGGG + Intronic
942264820 2:174212806-174212828 GTCCCACTGGAAGGTCTTCAGGG + Intronic
942266916 2:174237291-174237313 GTCCCACAGGAAGGTTTTCAGGG + Intronic
942493498 2:176513709-176513731 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
942819162 2:180090592-180090614 ATCCCACTGGAAGGTCTTCAGGG - Intergenic
942872739 2:180754988-180755010 GTTCCACTGGAAGGTTTTCAGGG + Intergenic
942920580 2:181368502-181368524 GTCCCATTAGTAGGTCTTCAGGG - Intergenic
943265176 2:185721443-185721465 GTCCCACTGGAAGGTCTTTAAGG - Intergenic
943292269 2:186089197-186089219 GTTCCACTGGAAGGTCTTTAGGG + Intergenic
943346185 2:186739601-186739623 GTCCTACTGGAAGGTCTTCAGGG + Intronic
943404048 2:187457030-187457052 GTCCTACTGGAAGGTCTTCAGGG + Intergenic
943563276 2:189488597-189488619 GTCCCCCTGGAAGGTCTTCAGGG - Intergenic
943741978 2:191419663-191419685 GTCCCACTGGAAAGTCTTCAGGG - Intronic
943769306 2:191697886-191697908 GTCCCACTGGAAGGTCTTGAGGG + Intergenic
944009893 2:194962048-194962070 CTCCCACTGGAAGGTCTTCAGGG - Intergenic
944034461 2:195277041-195277063 GTCCCACTGGTAGATCTTCAGGG - Intergenic
944317515 2:198299082-198299104 CTCCCACTGGAAGGTCTTCAGGG - Intronic
944329566 2:198449572-198449594 GTCCCACTGGAAGGTCTACAGGG - Intronic
944879434 2:203996548-203996570 GTCCCACCGGAAGGTCTTCAGGG + Intergenic
944986108 2:205179011-205179033 ATCCCACTGGAAGGTCTTCAGGG - Intronic
945197247 2:207248433-207248455 ATCCCACTGAAAGGTCTTCAGGG - Intergenic
945226852 2:207540238-207540260 GTCCCACTGGAATGTCTTCAAGG - Intronic
945292535 2:208140032-208140054 GTACCACTGGAAGATCTTCACGG + Intergenic
945433080 2:209787957-209787979 GTCCCAAAGGAAGGTCTTCAGGG - Intronic
945637750 2:212378063-212378085 GTCCCATTGGAAGGTCTTCACGG + Intronic
945758011 2:213874510-213874532 GTCCCACTGGAAGTTCTTCAGGG + Intronic
945906020 2:215594194-215594216 GTCTTACCAGAAGGTCTTCAGGG - Intergenic
946087065 2:217184833-217184855 CTCCCACAGGAAGGTCTTCAAGG + Intergenic
946385135 2:219379347-219379369 GTCTCACTGGAAGGTCTTCAGGG - Intronic
946816408 2:223582973-223582995 GTACCACTGGAAGGTCTTCAGGG - Intergenic
947038134 2:225883392-225883414 ATCCCACTGGAAGGTCTTCAGGG - Intergenic
947410009 2:229827594-229827616 GTCCCACTGGAAGGTCTTCAGGG + Intronic
947550786 2:231044780-231044802 GTCCCACTGGAAGGTCTTCAGGG + Intronic
947675010 2:231971036-231971058 GTCCTGCTGAAAAGTCTTCAGGG + Intronic
947861647 2:233363205-233363227 ATCCCACTGGAAGGTCTTCAGGG - Intronic
947980771 2:234407487-234407509 GTCCCACTGGAAGGTTTTCAGGG - Intergenic
948336847 2:237215549-237215571 GTTCCATTGGAAGGTCTTCAGGG - Intergenic
1168792376 20:588052-588074 GTTCCACTGGAAGGTTTTCAGGG + Intergenic
1168936063 20:1666000-1666022 GTCCCACTGGAAGGCCTTCAGGG - Intergenic
1168962316 20:1877785-1877807 TGACTGCTGGGAGGTCTTCAGGG - Intergenic
1169057883 20:2638600-2638622 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1169685259 20:8264257-8264279 GTCCCACTGGAAGGTCTGCAGGG + Intronic
1170120336 20:12904757-12904779 GTCCTGCTGGAAGGTCTTCAGGG - Intergenic
1170334843 20:15257915-15257937 GTCCCACTGGGAGGTCTTCAGGG - Intronic
1170381795 20:15768935-15768957 GTCTCACTGGAAGGTCTTCAGGG + Intronic
1170515455 20:17125117-17125139 GTCCCACTGGAAGGTTTTTAGGG + Intergenic
1170751896 20:19156260-19156282 GTCCCACTGGAAGGTCTTTCAGG + Intergenic
1172332069 20:34082127-34082149 GTTCCACTGAGAGCTCTTCAGGG - Intronic
1172738301 20:37145694-37145716 GCCCCACTGGAAGGTATTCAGGG + Intronic
1173029819 20:39344891-39344913 GCCCTACTAGAAGGTATTCAGGG - Intergenic
1174114019 20:48214629-48214651 GTCCCATTGGGAGGTCAGCAGGG + Intergenic
1174147681 20:48463499-48463521 GCCCCTCTGGGAGGTGTTCATGG + Intergenic
1174167830 20:48597900-48597922 GTCCCAGTGGGAGGTCAGCAGGG - Intergenic
1174884489 20:54317445-54317467 GTCCCACTAGAAGGTCTTCAGGG + Intergenic
1174943405 20:54957186-54957208 GTCCCACAGGAAGGTCTTCAGGG + Intergenic
1175301289 20:57944812-57944834 GTCCCACTGGAAGGTCTTCGGGG + Intergenic
1175549418 20:59807386-59807408 GTCCCACTGGAAGATCTTCAGGG + Intronic
1175652978 20:60744210-60744232 GTCCCATTGGAAGGTTTTCAGGG - Intergenic
1176068009 20:63209810-63209832 GCCCCACTGGAAGGTATTCAGGG + Intronic
1176675034 21:9769880-9769902 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1176687010 21:9858270-9858292 GTCCCACTGTAAGGTCTTCCAGG - Intergenic
1176713978 21:10333839-10333861 GTCCCAGTGAAAGGTCTTCAGGG - Intergenic
1177447766 21:21219808-21219830 GTCCCACTGGAAAGTCTTCAGGG - Intronic
1177572270 21:22902605-22902627 GTCCCACTGCAAGATCTTCAGGG - Intergenic
1177664382 21:24134833-24134855 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1178946819 21:36955175-36955197 GTCCTCCTGGAAGGTCTTCACGG - Intronic
1179115219 21:38485118-38485140 GTGCCACTGGAAGGTCTGCAGGG - Intronic
1179196916 21:39172641-39172663 GTCCCGCTAGAAGGTCTTCAGGG + Intergenic
1179410324 21:41157474-41157496 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1179580689 21:42341969-42341991 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1180129308 21:45816626-45816648 GTCCCGCTGGAAGGTCCTCAGGG + Intronic
1180254727 21:46617952-46617974 TTCCCCCTGGAAGGTCTTCAAGG - Intergenic
1180662787 22:17483093-17483115 GTCCCACTGGAACGTCTTCAAGG - Intronic
1180761034 22:18207742-18207764 GTCCAAGTGAAAGGTCTTCAGGG - Intergenic
1180774633 22:18416877-18416899 GTCCAAGTGAAAGGTCTTCAGGG + Intergenic
1180807788 22:18727698-18727720 GTCCAAGTGAAAGGTCTTCAGGG + Intergenic
1181070745 22:20335886-20335908 GTCCAAGTGAAAGGTCTTCAGGG + Intergenic
1181193730 22:21163831-21163853 GTCCAAGTGAAAGGTCTTCAGGG + Intergenic
1182675760 22:32038239-32038261 GCCCCACTGAAAGGTCTTCAGGG - Intergenic
1182869222 22:33631565-33631587 GTCCCACTGGAAGGTCCTCAGGG + Intronic
1183593058 22:38792702-38792724 GTCCCGCTGGACGGTCTTCAGGG + Intronic
1184082221 22:42230716-42230738 GGCCCACTGGAAGGTCTTTAGGG - Intronic
1184307963 22:43620585-43620607 GTCCTATAGGAAGTTCTTCAGGG + Intronic
1184641882 22:45877219-45877241 GTCCTCCTGACAGGTCTGCAAGG - Intergenic
1184824388 22:46937703-46937725 GTCCCACTGGAAGGTCTTCAGGG - Intronic
949252174 3:1998633-1998655 ATCCCACTGGAAGGTCTTCAGGG + Intergenic
949255751 3:2043931-2043953 GTCCTACTGGAAGGTCTTCGGGG + Intergenic
949849560 3:8409263-8409285 TACCCACTGGGAGGTCTCCAGGG - Intergenic
950245693 3:11415671-11415693 GACCCACTGGAAGGTCTTCAGGG + Intronic
950277891 3:11679238-11679260 GTCCCACTGGAAGGTCTTCAGGG - Intronic
950667873 3:14508207-14508229 GCCCTACTGTGAGGTCTGCTGGG - Intronic
951444302 3:22760119-22760141 GTCCTGCTGGAAAGTCTTCAGGG - Intergenic
951475156 3:23097216-23097238 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
951527382 3:23666686-23666708 GTCCCACTGGAAGGTTTTCAGGG + Intergenic
951999071 3:28764136-28764158 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
952033001 3:29167038-29167060 TCCCGACTGGAAGGTCTTCAGGG + Intergenic
952084771 3:29805515-29805537 GTCCAACTGGAAGATCTTCAGGG - Intronic
952114279 3:30160379-30160401 CTTCCACTGGAAGGTCTTCAGGG - Intergenic
952178919 3:30897042-30897064 GTCGCGCTGGAAGGTCTTCAGGG + Intergenic
952975375 3:38689995-38690017 GTCCCACTGGAAGGTCTTAGGGG - Intergenic
953066559 3:39477720-39477742 ATCCCACTGGAAGTTCTTCAGGG - Intronic
953223384 3:40995149-40995171 GTTCCACTGGTAGGTCTTCGGGG + Intergenic
953399424 3:42600234-42600256 GTCCTACTGTTAGGTCTTTTAGG - Intronic
953448861 3:42990006-42990028 CACCTGCTGGGAGGTCTGCATGG + Intronic
953638120 3:44680276-44680298 GTCCCACTGGAAGGTCTTCCCGG + Intergenic
953678662 3:45023193-45023215 GTCTCAGTGGGAGGTCTTCAGGG + Intronic
953819798 3:46196779-46196801 TTCCCACTGGAAGGCCTTCAGGG - Intronic
954174173 3:48830326-48830348 GTACCACTGGAAGGTCTTTAGGG + Intronic
954585036 3:51726534-51726556 GTCCCACTGGAAGGTCGTCAGGG - Intergenic
954924817 3:54224161-54224183 GTCCCACTGGAAGGCCTTCATGG + Intronic
954975846 3:54693664-54693686 GTCCCACTGGAAGGTCTTCAGGG - Intronic
955138447 3:56244502-56244524 ATCCCACTGGAAGGTCTTCAGGG - Intronic
955308260 3:57856547-57856569 ATCCCACTGAAAGGTCTTCAGGG + Intronic
955371716 3:58357378-58357400 GTCCCACTGGAAGGTCTTCTGGG + Intronic
955540149 3:59967133-59967155 GTCCCACTGAAAGGCCTTCAGGG + Intronic
955578306 3:60390604-60390626 GTCCCACTGGAAGGTCTTTAGGG - Intronic
955607082 3:60716499-60716521 ATCCAACTGGCAGGTCTTCAGGG + Intronic
956201534 3:66711268-66711290 GTCTTACTGTGATGTTTTCATGG + Intergenic
956300492 3:67767104-67767126 GTAGTTCTGTGAGGTCTTCAGGG + Intergenic
956427358 3:69150330-69150352 GTCCCACTGGAAGGTCTTCAAGG - Intergenic
956896056 3:73661092-73661114 GTCTCACTGGAAGGTCTTCAGGG + Intergenic
956955228 3:74330718-74330740 GTCTCACTGGGAGGTCTGCAGGG - Intronic
956996746 3:74834504-74834526 GTCCCACTGGAAGGTCCTCAGGG + Intergenic
957021081 3:75127088-75127110 GTCCCATTGGAAGGTCTTTAAGG - Intergenic
957275588 3:78087030-78087052 GTCCCACTGGAAGGTATTCAGGG + Intergenic
957460486 3:80512077-80512099 GTCCCACTGGAAGCTCTTCAGGG - Intergenic
957592147 3:82213155-82213177 GTCCCATTGGAAGATCTTCAGGG - Intergenic
957820742 3:85370812-85370834 GTCCCAGTGGAAAGTCTTCAGGG - Intronic
957838653 3:85636210-85636232 GTCCCACTGGAAGGTCTTCAAGG - Intronic
958168042 3:89902468-89902490 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
958437199 3:94111703-94111725 ATCCCACTGGAAGGTCTTCAGGG + Intronic
958587408 3:96107319-96107341 GTCCCACTGGAAGGTCTTCAAGG + Intergenic
958647825 3:96895157-96895179 GTCCCACTGAAAGGTCTTCAGGG - Intronic
958761541 3:98315015-98315037 GTGCCACTGGAAGGTCTTTAGGG - Intergenic
958882940 3:99693420-99693442 GTCCCACTGGAAGAACTTCAGGG - Intronic
958948472 3:100391383-100391405 GTCCCACTGGAAGATCTTCAAGG - Intronic
958982643 3:100741276-100741298 GTCCCACTGGAAGGTCTTCAGGG - Intronic
959184040 3:103021575-103021597 GTCTCACTGGAAGGTCTTCAGGG - Intergenic
959204660 3:103290557-103290579 GTCCCACTGGAAGATCGTCAGGG - Intergenic
959272010 3:104223681-104223703 GTCCCACTGGAAGGTTTTCAGGG - Intergenic
959386840 3:105719844-105719866 GTCCCACTGGAAGGTCTTCAGGG - Intronic
959569932 3:107872430-107872452 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
959636006 3:108571087-108571109 GTCCCACTGGAAGGTCTTCAGGG + Intronic
959652582 3:108765649-108765671 ATCCCACTGGAAGGTCTTCAGGG + Intergenic
959657827 3:108830017-108830039 GTCCCAGTAGAAGGTCTTCAAGG - Intronic
959845914 3:111033232-111033254 GTCTTGCTGGAAGGTCTTCAGGG - Intergenic
960125925 3:113998426-113998448 GTTCCACTGAAAGGTCTTCAAGG - Intronic
960129495 3:114039612-114039634 GTCTCACTAGAAGGTCTTCAGGG - Intronic
960135921 3:114104919-114104941 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
960138267 3:114127408-114127430 GTCCCATTAGAAGGTCTTCAAGG + Intergenic
960458813 3:117907410-117907432 GTCCCACTGGAAAGTCTTCAGGG - Intergenic
960601734 3:119465619-119465641 GTCCCTCTGGAAGATCTTCAGGG - Intronic
960689588 3:120331561-120331583 AGCCTACTGGAAGGTCTTAAAGG + Intronic
961098653 3:124179384-124179406 GTCTCACTGGAAGGTCTTCAGGG + Intronic
961204545 3:125071194-125071216 GCCCCAGTGGCAGGTCTTCAGGG + Intergenic
961595532 3:128013118-128013140 GTCCCACTGGAAGGTCTTCAAGG - Intergenic
961989956 3:131178569-131178591 GTCCCACTGGGAGATCTCCATGG + Intronic
962208396 3:133455001-133455023 GTCCCACTGAAAGGTCTTCAGGG + Intronic
962256642 3:133874918-133874940 CTCCCACTAGAAGGTCTTCAAGG + Intronic
962441410 3:135421294-135421316 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
962534035 3:136310751-136310773 GGCCTACTGGGATGTATTCTAGG + Intronic
962656631 3:137551921-137551943 GTCCTACTGGAAGGTCTAGAGGG + Intergenic
962828014 3:139116581-139116603 GTCCCACTGGAAGGTCTTCAGGG + Intronic
962885593 3:139623322-139623344 GTCCCACTAGAAGGTCTGCAGGG + Intronic
962914702 3:139889683-139889705 GTTCCACTAGAAGGTCTTCAGGG - Intergenic
963024336 3:140903807-140903829 GTCCCACAGGAAGGTGTTCAGGG + Intergenic
963134993 3:141894680-141894702 GCCCCACTGGAAGGTCTTCAGGG + Intronic
963144551 3:141979500-141979522 GTCCTACTGGAAGGTCTTCAGGG - Intronic
963216034 3:142749488-142749510 GTCCCAATGGAAGGTCTTCAGGG - Intronic
963258133 3:143166861-143166883 GTCCCACTGGAAGGTCTTCACGG - Intergenic
963493908 3:146035855-146035877 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
963608557 3:147436289-147436311 GTCTTACTAGAAAGTCTTCAGGG + Intronic
963886532 3:150588977-150588999 GTCTCACTGGAAGGTGTTCAGGG - Intronic
964127727 3:153253559-153253581 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
964147161 3:153478407-153478429 GTCCCACTGGAAGGTTTTCAGGG + Intergenic
964201941 3:154127486-154127508 GTCCCACAAGAAGGTCTTCAGGG + Intronic
964423104 3:156525260-156525282 GTTCCTCTGGGAAGTCTTCAGGG - Intronic
964592612 3:158382192-158382214 GTCCCATTGGAAGATCTTCAGGG + Intronic
964593985 3:158400523-158400545 GTCCCACTGGAAGGTCTTCAGGG - Intronic
964780648 3:160333655-160333677 GTCCCACTGGAAGGTCTTCAGGG + Intronic
964987262 3:162759190-162759212 GTCCCACTGGGAGTTCTGCAGGG - Intergenic
965055174 3:163702045-163702067 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
965160161 3:165122956-165122978 GTCCCACTGGAAGGTCTATAAGG + Intergenic
965258458 3:166446899-166446921 GTGTCACTGGAAGGTCTTCAGGG + Intergenic
965352169 3:167627043-167627065 GTTTTACTGGGAGGAATTCAAGG + Intronic
965555509 3:170014192-170014214 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
965990601 3:174812666-174812688 GTCTCACTGGAATGTCTTCAGGG - Intronic
966025036 3:175268816-175268838 GTCCCACTGGAAGTTTTTCAGGG + Intronic
966110429 3:176394609-176394631 GTCCCACTGGGAGGTTTTCAGGG + Intergenic
966161466 3:176973272-176973294 GTCCCATTGGAAGGTCTTCGGGG + Intergenic
966343240 3:178949141-178949163 TTCCCACTGAAAGGTCTTCAGGG + Intergenic
966418267 3:179711672-179711694 GTCCCACTGGAAAGTCTTCTGGG + Intronic
966438486 3:179917218-179917240 GTCCCACTGGAAAGTCTTCTGGG + Intronic
966499072 3:180617495-180617517 GTCCCACTTGAAGGTCTTCAGGG - Intronic
966618379 3:181937283-181937305 GTCCCACTGGAAGGTTTTCAAGG - Intergenic
967127706 3:186439913-186439935 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
967939055 3:194752509-194752531 ATCCTACCGGAAGCTCTTCAGGG + Intergenic
968057056 3:195699777-195699799 GTCTCTCTGGAAGGTCTTCAGGG + Intergenic
968462130 4:731447-731469 ATCCTGCAGGGAGGTCCTCAGGG + Intronic
969906310 4:10399534-10399556 GTCCCACTGGAAGGTCTCCAAGG + Intergenic
969925394 4:10580508-10580530 GTCCTACTAGAAGGTCTTCAGGG - Intronic
969928326 4:10606312-10606334 GTCCCACTGGAAGGTCGTCAGGG + Intronic
970396507 4:15672998-15673020 GTCACCCTGGAAGGTCTTCAAGG + Intronic
970634904 4:17998554-17998576 GTCCCACTGGAAAATCTTCAGGG + Intronic
970673283 4:18419473-18419495 GTCCAAATGGAAGGTCTTCAGGG + Intergenic
970845897 4:20536975-20536997 GTCCCAGTGGAAGGTCTTCAGGG + Intronic
970889050 4:21021679-21021701 GTCCTGCTGGAAGGTCTTTAGGG + Intronic
970984267 4:22137517-22137539 GTTCCACTGGAAGATCTTCAGGG + Intergenic
971001989 4:22333649-22333671 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
971047676 4:22823597-22823619 GTCCCACTGGAAGGTTTTCAGGG - Intergenic
971383676 4:26123824-26123846 GTTCCACTGGAAGGTCTTCAGGG + Intergenic
971390722 4:26182900-26182922 TTCCTACTGGAAGGTCTTTGGGG + Intronic
971791296 4:31173151-31173173 GTCCCACTGAGAGGTCTTCATGG - Intergenic
971822968 4:31583067-31583089 GTCCCACTGGGAGGTCTTCAGGG - Intergenic
971965231 4:33545898-33545920 GTCCCACTGGAAAGTCTTCAGGG - Intergenic
972001370 4:34039555-34039577 GTCCTACTGGAAGGTCTTCAGGG + Intergenic
972004363 4:34080408-34080430 GTTCCACTGGAAGGTATTCAAGG + Intergenic
972030319 4:34448551-34448573 CACCCACTGGAAGGTCTTCAGGG - Intergenic
972258744 4:37386746-37386768 GACCTAGTGGGAGGTGTTCATGG + Intronic
972680031 4:41296498-41296520 GTCTCACTGGAAGGTCTTCAGGG - Intergenic
972748623 4:41966614-41966636 GTTCCACTGGAAGGTCTTCAGGG - Intergenic
973086679 4:46071611-46071633 GTCCCACTAGAAGGTCTTCAGGG - Intronic
973286891 4:48428522-48428544 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
973561980 4:52146093-52146115 GTCCTACTGGAAGGTTTTCAGGG - Intergenic
973576346 4:52293526-52293548 GTCTCACTGGAAGGTCTTCAGGG + Intergenic
973636120 4:52862959-52862981 GCCCCCCTGGGAGGTCTTGAAGG + Intronic
974191173 4:58505458-58505480 TTCTCACTGGAAGGTCTTCAGGG + Intergenic
974204680 4:58686059-58686081 GTCCCAGTGGAAGGTCTTCAGGG - Intergenic
974362802 4:60903812-60903834 GTCCCACTGGACAGTCTTCAGGG - Intergenic
974516353 4:62918239-62918261 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
974679254 4:65139762-65139784 GTCCCACGAGTAGGTCTTCAGGG - Intergenic
974683286 4:65192837-65192859 GTCCCACTGAAAGGCCTTCATGG + Intergenic
974855094 4:67452073-67452095 GTCCCACTGAAAGGTCTTCAAGG + Intergenic
975077618 4:70231834-70231856 TTCCTACTGGAAGATCTTCAGGG - Intronic
975200780 4:71585875-71585897 GTCCCACTAGAAGATCTTCAGGG - Intergenic
975405521 4:73984216-73984238 GTCCCACTAGAAGCTCTTCATGG - Intergenic
975545111 4:75552367-75552389 GTTCCACTGGAAGATCTTCAGGG + Intergenic
975564711 4:75741989-75742011 GTTCCACTGGAAGGTCTTCAGGG + Intronic
975601884 4:76109360-76109382 GTTCCACTGGAAGGTCTTCAGGG + Intronic
975663783 4:76713446-76713468 GTCCCTCTGGAAGGTCTGCAGGG + Intronic
976002904 4:80393006-80393028 ATCCCACTGGAAAGTCTTCAGGG - Intronic
976072372 4:81256432-81256454 ATCCATCTGGGTGGTCTTCAGGG + Intergenic
976394563 4:84542292-84542314 GTCCCACTGGAAGGATTTCAGGG + Intergenic
976423754 4:84875820-84875842 GTCTCACTGGAAGGTCTTCAGGG + Intronic
976459883 4:85297925-85297947 GTCCCAGTGGAAGTTCTTCAGGG + Intergenic
976463794 4:85344358-85344380 GGCCTAATGGGAGGTTTTCATGG + Intergenic
976672319 4:87667013-87667035 TTCCTACTGTGAGGTTTCCAGGG - Intergenic
976834353 4:89353658-89353680 GTCCCACCAGAAGGTCTTCAGGG + Intergenic
976896142 4:90114672-90114694 CTCCCACTGGAAGGTCTTCAGGG + Intergenic
977263820 4:94831109-94831131 GTCCCACTAGAAGGTCTTCAGGG - Intronic
977676348 4:99752197-99752219 GTCCCACTGGAAGGTCTTTGGGG + Intergenic
977741553 4:100490050-100490072 GTCCCACTGGAAGGTCTTCAAGG - Intronic
977841004 4:101704622-101704644 GTCTCACTGGAAGGTCTTCAGGG + Intronic
977991141 4:103443995-103444017 GTCCCACTGTATGGTCTTCAGGG - Intergenic
978091817 4:104726554-104726576 GTGCTACTGGAAGGTTTCCATGG + Intergenic
978142060 4:105329302-105329324 GTCCTGGTGAGAGATCTTCAGGG - Intergenic
978292315 4:107156226-107156248 GTTTCACTGGAAGGTCTTCAGGG - Intronic
978484798 4:109239995-109240017 GTCTCACTGGAAGGTCTTCAGGG + Intronic
978715470 4:111837527-111837549 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
978824472 4:113004490-113004512 GCTCCACTGGAAGGTCTTCAGGG + Intronic
979194736 4:117907000-117907022 GCCCTACTATAAGGTCTTCAGGG - Intergenic
979504038 4:121474262-121474284 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
979681107 4:123460855-123460877 GTTCCACTGGAAGGTCTTCAGGG - Intergenic
979765153 4:124455591-124455613 GTCTCACTGGAAGGTCTTCAGGG + Intergenic
979794291 4:124827126-124827148 GTCCGACTGGAAGGTCTTCATGG - Intergenic
979844035 4:125485533-125485555 GTCCCAGTGGAAGGTCTTCAGGG + Intronic
980069756 4:128231042-128231064 GTCCTACCAGAAGGTCTTCAGGG - Intergenic
980158209 4:129132009-129132031 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
980164977 4:129214935-129214957 GTCCCATTGGGAGGTTTTCAGGG - Intergenic
980199073 4:129631032-129631054 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
980251766 4:130324943-130324965 GTCCTACTGGAAGGTTTTCAGGG + Intergenic
980350399 4:131676381-131676403 GTCCCACTGGAAGGTCTTCCAGG - Intergenic
980408801 4:132388108-132388130 GTCCTACTGGAATGTCTTCAGGG - Intergenic
980441287 4:132848825-132848847 GTTCCACTGGGACGTCTTAATGG + Intergenic
980515582 4:133854257-133854279 ATCCCTCTGGAAGGTCTTCAGGG - Intergenic
980578689 4:134719518-134719540 ATCATACTGGCAGGTTTTCAGGG - Intergenic
980867607 4:138571800-138571822 GTCCCACTGAAAGGTCTTCAGGG + Intergenic
981037013 4:140182197-140182219 GTCCCACCGGAAGGTCTTCAGGG - Intergenic
981041139 4:140223260-140223282 GTCCTTCTGAAAGGTCTTCACGG + Intergenic
981081483 4:140643013-140643035 GTCCTCCACGGAGGACTTCATGG + Intronic
981125477 4:141101419-141101441 GTCCCATTGGAAGGTCTTCAGGG + Intronic
981186094 4:141805496-141805518 GTCCCACTAGAAGGTTTTCAGGG - Intergenic
981202786 4:142001284-142001306 GTCCCCCTGGAAGGTCTCCAGGG + Intergenic
981582153 4:146260835-146260857 GTGCTTCTGGGAGGTCTTCAAGG - Intronic
981674715 4:147328558-147328580 GTCCAACTGGAAGGTCTCCAGGG - Intergenic
981798874 4:148633061-148633083 GTCCCACTGAAAGGTCTTCAGGG + Intergenic
981811313 4:148778881-148778903 GTTCCACTGGAAGGTCTTCAGGG + Intergenic
981914617 4:150020619-150020641 GTCCCGCTGGAAGGTCTTTAGGG + Intergenic
981943183 4:150308626-150308648 GTCCCACTGGAAGGTCTTCAGGG - Intronic
982027870 4:151269942-151269964 GTCCCACTGGAAGGTGTTCAGGG + Intronic
982082321 4:151802557-151802579 GTCCCACTGGCAGGTCTTCAGGG - Intergenic
982153206 4:152486585-152486607 GTCTCACTGGAAGGTCTTCAGGG + Intronic
982561603 4:156934865-156934887 ATCCCACTGGAAGGTTTTCAGGG + Intronic
982802430 4:159721881-159721903 GTCCCACTGGAAGTTCTTCCGGG + Intergenic
982950006 4:161682632-161682654 GTCCCACTGGAAGGTCTTCAAGG + Intronic
983254706 4:165384791-165384813 CTCATACAGGGAGCTCTTCAGGG + Intronic
983282083 4:165693765-165693787 GTCCCATTGGAAGGTCTTTAGGG - Intergenic
983366752 4:166800471-166800493 GTCCCACTGGAAGCTCTTCAGGG - Intronic
983474858 4:168201474-168201496 GTCCCACTGGAAGGTTTTCAGGG + Intergenic
983483463 4:168304235-168304257 GTCCCACTGGAAAGTCTTCAGGG - Intronic
983578200 4:169281553-169281575 GTCTTACTGGAAGGTTTTCAGGG - Intergenic
983757062 4:171351862-171351884 TTCCCACTGGAAAGTCTTCACGG - Intergenic
984276869 4:177621414-177621436 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
984281973 4:177681382-177681404 GTCCCACTTGTAAGTCTTCAGGG - Intergenic
984787090 4:183577475-183577497 GTGCCACTGGAAGGTCTTCAGGG - Intergenic
984868631 4:184307842-184307864 GTCCAACTGGAAGGTCTTCAGGG + Intergenic
985060687 4:186074912-186074934 GTCCCACTGGAAGCTCTTTAGGG + Intronic
985138067 4:186809239-186809261 GTCCCACTGGGAGGGCTTCAGGG + Intergenic
985235945 4:187874409-187874431 GTCTCACTGGAAGGTCTTCAGGG + Intergenic
985294008 4:188415212-188415234 GTCCCACGGGAAGGGCTTCAGGG - Intergenic
985300248 4:188480886-188480908 GTCCTTCTGGGTAGTCTTCCTGG + Intergenic
985400520 4:189588812-189588834 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
985796415 5:1965416-1965438 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
986285753 5:6357316-6357338 GCCCCCCTGGGATGTCTTCAGGG - Intergenic
986894846 5:12353257-12353279 GTCCTGCTGGAAGGTCTTCTAGG + Intergenic
987040022 5:14053593-14053615 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
987480261 5:18446973-18446995 GTCCCATTGGAAGATCTTCAAGG + Intergenic
987484405 5:18506316-18506338 GTCTCACTGGAAGGTCTTCTAGG - Intergenic
987766389 5:22236845-22236867 GGTCCACTGGAAGGTCTTCAGGG + Intronic
987767744 5:22256658-22256680 GTCCCACTGGAAGGTCTTTAAGG - Intronic
987802465 5:22716706-22716728 GTCCCACTGGAAGGTCTTCAGGG - Intronic
988080979 5:26415200-26415222 GTCCTACTGGAAAGTCATCATGG - Intergenic
988135379 5:27164041-27164063 GGCCCACAGGAAGGTCTTCAGGG - Intergenic
988226340 5:28416652-28416674 GGTCCACTGGAAGGTCTTCAGGG + Intergenic
988647829 5:33114270-33114292 GTCCCACTGGAAGGTCTTCATGG + Intergenic
988661494 5:33274831-33274853 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
988831458 5:34991231-34991253 GTCCCATTGGAAGATCTTCAAGG - Intergenic
988960091 5:36361596-36361618 GTCCCACTGGAAGGTCATCAGGG + Intergenic
989037504 5:37191080-37191102 TTTCTACTGGAAAGTCTTCAGGG - Intronic
989175297 5:38518839-38518861 GTCCCACTGGAAGGTCTTCGGGG - Intronic
989712948 5:44423206-44423228 TCCCTACTTGGAGGTCATCAGGG - Intergenic
989761045 5:45017102-45017124 GTACCACTGGAAGGTCTTCAGGG - Intergenic
990053145 5:51533498-51533520 GCCCCACTGAAAGGTCTTCAGGG - Intergenic
990091016 5:52049073-52049095 GTCCCACTGGAAGGTCTTCAGGG - Intronic
990108876 5:52298110-52298132 GTCCCACTGGAAGGTCTTTAAGG + Intergenic
990172674 5:53071510-53071532 GTCCTTCTGGGAGGACTTCTGGG + Intronic
990313540 5:54562863-54562885 GCCCCACTGGAAGGTCCTCAGGG - Intergenic
990480738 5:56208171-56208193 GTCCCACTGGAAGCTCTTCAGGG + Intronic
990667494 5:58090188-58090210 GTCCCACTGGAAGGTCCTCGGGG - Intergenic
990813926 5:59761660-59761682 GTCCCACTGGAAGCTCTTCTGGG + Intronic
990847474 5:60159191-60159213 GTCCCACTGGAAGGTCTTTAGGG + Intronic
991065421 5:62419541-62419563 GTCTCACTGGAAGGTCTTCGGGG + Intronic
991072490 5:62499928-62499950 GTCCCACTAGAAGGTCTTCTGGG + Intronic
991157476 5:63456167-63456189 GTATTACTGGAAGGTCATCAGGG + Intergenic
991191198 5:63876067-63876089 GACCCACTGGGAGCTATTCATGG + Intergenic
991375913 5:65966806-65966828 GTCTGACTGGAAGGTCTTCAGGG - Intronic
991711323 5:69411679-69411701 GTCCCACTGGGATGTGATCAGGG + Intronic
992057953 5:73011577-73011599 GTACTACTGGAAGGTCTTCAGGG + Intronic
992065390 5:73103065-73103087 ATCCCACTGGAAGGTCCTCAGGG + Intergenic
992407984 5:76477748-76477770 GTCCCACTGAAAGGTCTGCATGG - Intronic
992501013 5:77343991-77344013 GTCCCACTGGAAGGTCCTCAGGG + Intronic
992517952 5:77515369-77515391 GTCCCATCAGGAGGTCTTCAGGG + Intronic
992671461 5:79065152-79065174 GTCCCACTGGAAGGTCTTCAGGG + Intronic
992705936 5:79392315-79392337 GTCCCACTAGAAGGTCTTCAAGG - Intronic
992901784 5:81303538-81303560 GTCCTACTGGAAGGTTTTCAGGG + Exonic
992943126 5:81782683-81782705 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
993088550 5:83395368-83395390 TGCCCACTGGAAGGTCTTCAGGG + Intergenic
993089510 5:83407790-83407812 GTCCCACTGGAAGGCCTTCAGGG + Intergenic
993297888 5:86166584-86166606 GTCTCACTGGAAGGTCTTCAGGG + Intergenic
993461240 5:88184985-88185007 ATACCACTGGAAGGTCTTCAGGG + Intergenic
993469789 5:88293396-88293418 GTCCCACTGGAAGTTCTTCAGGG - Intergenic
993522914 5:88926685-88926707 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
993853397 5:93039475-93039497 GTTTCACTGGAAGGTCTTCAGGG - Intergenic
993894242 5:93512152-93512174 GTCCCACTGGGAGCTCTTCAAGG - Intergenic
994053218 5:95385726-95385748 GTCCCACTGGAAAATCTTCAGGG - Intergenic
994111798 5:96014266-96014288 GTCCCACTGGAAGGTTATCAGGG + Intergenic
994588803 5:101747836-101747858 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
994638107 5:102367739-102367761 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
994680301 5:102878607-102878629 GTCCTCCTGGAAGGTGTTCAGGG - Intronic
995433250 5:112105799-112105821 GTCCCACTAGAAGGTCTTCAGGG - Intergenic
995469003 5:112480450-112480472 GTGATTCTGGGAGGTCTTGAGGG - Intergenic
995720563 5:115127915-115127937 GTCCCACTGGAAGGTCTTCTGGG - Intronic
995757152 5:115518668-115518690 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
995900250 5:117057268-117057290 GTCCCACTGGAAGATTTTCAGGG - Intergenic
996419821 5:123250282-123250304 GTCCCATTGGAAAGTCTTCAGGG - Intergenic
996436636 5:123440617-123440639 GTCTCACTGGAAGGTCTTCAGGG + Intergenic
996504105 5:124249978-124250000 ATCCCACTGGAAGGTCTTCAGGG + Intergenic
998067005 5:139167369-139167391 GTCCCACTGGAAGGTCTTCAGGG - Intronic
998258277 5:140606860-140606882 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
998281632 5:140814324-140814346 GTCCCACTGGAAGGTCTTCTGGG + Intronic
998578007 5:143338453-143338475 ATCCCACTGGAAGGCCTTCAGGG - Intronic
998615844 5:143739623-143739645 GTCCGACTGGAAGGTCTTCAGGG + Intergenic
998791511 5:145770608-145770630 GTCCCATTGGAAAGTCTTCAGGG - Intronic
998794715 5:145806417-145806439 ATCCCACTGGAAAGTCTTCAGGG + Intronic
998927668 5:147144224-147144246 GTCCCACTAGAAGGTCTTCAGGG - Intergenic
998981162 5:147704032-147704054 GTCCCACTAGAAGGTCTTCAGGG + Intronic
999077568 5:148811432-148811454 ATCCTACTGGAAGGCCTTTAAGG + Intergenic
999215207 5:149927948-149927970 GTCCCCCTGGAACGTCTTCAGGG + Intronic
1000425817 5:161090143-161090165 GTCTCACTGGAAGGTCTTCAGGG + Intergenic
1000695165 5:164371675-164371697 GTCCCACTGGAAGGTCCTTAGGG - Intergenic
1000709282 5:164550658-164550680 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1001153785 5:169255344-169255366 GTCCCACTGGTAAGTCTTCAAGG - Intronic
1001395220 5:171414394-171414416 GTCTCACTGGAAGGTCTTCAGGG + Intergenic
1002324144 5:178394444-178394466 GTCTTCCTTGGAGATCTTCAGGG - Intronic
1002385574 5:178863746-178863768 GCCCCACTGGAAGGTCTTCAGGG - Intronic
1002972632 6:2039692-2039714 CTCCTGCTGGAAGGTCTTCAGGG + Intronic
1003287598 6:4748092-4748114 GTCACACTGGGAGGTTTTCCAGG + Intronic
1004540911 6:16549037-16549059 GTCCCACTGAGAGGTCTTCAGGG + Intronic
1004578633 6:16925248-16925270 GTTGCACTGGAAGGTCTTCAGGG + Intergenic
1004587710 6:17018204-17018226 GTCCCACTGGGAGGTCTTCACGG - Intergenic
1004591015 6:17051760-17051782 GTCCCACTGGAAGCTCTTCAGGG - Intergenic
1004948862 6:20645921-20645943 GTCCCACTGGAAGATCTTCAGGG + Intronic
1005105077 6:22215238-22215260 GTCCCAGTAGAAGGTCTTCAGGG - Intergenic
1005124994 6:22436840-22436862 GTCCCACTGGGAGGTCTTCAGGG + Intergenic
1005308695 6:24538573-24538595 GCCCCGCTGGAAGGTCTTCAGGG + Intergenic
1005776759 6:29141451-29141473 GTCCCACTGGAAGGTTTTCAGGG + Intergenic
1006332416 6:33401623-33401645 GTCTCACTGGAAGATCTTCAGGG + Intronic
1006960326 6:37923383-37923405 TTCCCACTGGAAGGTCTTCAGGG + Intronic
1006965746 6:37982851-37982873 TTCCTACTGGAAGGTCTTCAGGG - Intronic
1007020037 6:38510811-38510833 GTCCCACTGGAAGGCCTCCAGGG + Intronic
1007083311 6:39124449-39124471 GTCCTACTGTTAGGAATTCAAGG + Intergenic
1007127395 6:39438420-39438442 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1007741850 6:44015898-44015920 GTCCCACTGGAAGTTCTTCAGGG - Intergenic
1007869357 6:45015877-45015899 GTCCCACTGGAAGGTCTTCAAGG + Intronic
1008001870 6:46369183-46369205 GTCCCACTGGAAGGTCTTCAAGG + Intronic
1008238752 6:49083255-49083277 GTCCCACTGGAAGGTCTTTAGGG + Intergenic
1008627369 6:53330913-53330935 GTCCCACTGGAAGGCCTTCAGGG + Intronic
1008772070 6:54991624-54991646 GTCCCATTGGAAGGTCTTCAGGG - Intergenic
1009319660 6:62271606-62271628 GTCCTACTGGGAGGTCTTCAGGG - Intronic
1009557888 6:65198216-65198238 GTCCCACTGGAAGGTGTGCAGGG + Intronic
1010026996 6:71230406-71230428 GTCCCACTGGAAGATCTTCAGGG - Intergenic
1010052075 6:71517509-71517531 GTCCTACTGGAAGGTCTTGAGGG + Intergenic
1010588033 6:77678820-77678842 GTCCCACCGGAAGGTCTTCAGGG - Intergenic
1010617883 6:78035298-78035320 ATCCTACTGGAAGGTCCTCCAGG + Intergenic
1011176564 6:84567711-84567733 GCCCTATTGAGAGGTCTACATGG - Intergenic
1011249157 6:85352692-85352714 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1011456772 6:87558951-87558973 GTCCCACTGGAAAGTCTTCAGGG - Intronic
1011856347 6:91696775-91696797 GTCCCACTGGAAAGTTTTCAAGG - Intergenic
1011885928 6:92095663-92095685 GTCCCTCTGGAAGGTCTTCAGGG - Intergenic
1011934628 6:92759950-92759972 GTCCTGCTGGAAGGTCTTCAGGG - Intergenic
1012055513 6:94403586-94403608 GTCCCACTGGAAGGTCTGCAGGG - Intergenic
1012077085 6:94703055-94703077 GTCCCACTGGAAGGTCTTCAAGG + Intergenic
1012114849 6:95283965-95283987 GTCCCACTGAAAGGTCTTCAGGG - Intergenic
1012146474 6:95690110-95690132 GTTTCACTGGAAGGTCTTCAGGG - Intergenic
1012152486 6:95771863-95771885 GTTCCACTGAGAGGTCTTCAGGG - Intergenic
1012178349 6:96118752-96118774 GTCTCACTGGGAGGTCTTCAGGG - Intronic
1012236537 6:96823303-96823325 GTCCCACCGGAAGGTCTTCAGGG - Intronic
1012529982 6:100223817-100223839 GTCCTACCAGAAGGTTTTCAGGG - Intergenic
1012919629 6:105208002-105208024 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1013098316 6:106966391-106966413 GTCCTTCAGGGATGTCCTCAAGG - Intergenic
1013385596 6:109627218-109627240 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1013473169 6:110483790-110483812 GTCCCACTGGAATGTCTTCAAGG - Intergenic
1013637823 6:112045989-112046011 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1013759828 6:113504928-113504950 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
1013811610 6:114050757-114050779 GTTCCACGGGAAGGTCTTCAGGG - Intergenic
1013858372 6:114603530-114603552 GTCCGACCAGAAGGTCTTCAGGG + Intergenic
1013887838 6:114991554-114991576 GTCCCACTGGAAAGTCTTCAGGG - Intergenic
1013968024 6:115979213-115979235 GTTCTACTGGAAGGTCTTTAGGG - Intronic
1014052928 6:116976823-116976845 GTCCCTCTGGAAGATCTTCAAGG - Intergenic
1014158644 6:118140713-118140735 GTCCCACTGGAAGGTCTTTAGGG - Intronic
1014218021 6:118771886-118771908 GTCCCACTGGAAAGTCTTCAGGG + Intergenic
1014579417 6:123118045-123118067 GTGCCACTGGAAGGTCTTAAGGG - Intergenic
1014843981 6:126253253-126253275 GTCCCACAGGAAGGTCTTCAGGG + Intergenic
1015302049 6:131664183-131664205 GCCCTACTGAAAGGTCTTCAGGG - Intronic
1015424337 6:133048474-133048496 GTCCTACTGGAAGGTCTTCAGGG - Intergenic
1015696110 6:135981647-135981669 TTCCCACAGGAAGGTCTTCAGGG + Intronic
1015781168 6:136867379-136867401 GTCCTGCTGGAAGGTTTTCGGGG - Intronic
1015840196 6:137468463-137468485 GTCCCACTGGAAGGTCCTCGGGG - Intergenic
1015914067 6:138197253-138197275 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1015942684 6:138467592-138467614 GTCCTACTGGAAGTTCCTCGGGG - Intronic
1016474692 6:144414239-144414261 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1016543426 6:145193431-145193453 GTCCCACTGGAAGTTTTTCATGG - Intergenic
1016561086 6:145395840-145395862 GTCCTACTGGGCAGGCTACATGG + Intergenic
1016592295 6:145759945-145759967 GTCCCACTGGAAGGCCTTTAGGG - Intergenic
1016716770 6:147242064-147242086 GTCCCACTAGAAGGTCTTCAGGG - Intronic
1017072196 6:150585369-150585391 GTCCCACTGGAGGGTCCTCAGGG - Intergenic
1017204816 6:151793290-151793312 GTCCCACTGGAAAGTCCTCAGGG + Intronic
1017460011 6:154640286-154640308 GTCCCACTGGAAGATCTTCAGGG - Intergenic
1017599546 6:156065545-156065567 GTCCCACTGAAAGTTCTTCAGGG - Intergenic
1017600915 6:156080144-156080166 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1017655884 6:156629265-156629287 GTCCCACTGGAAGGTGTTTAGGG - Intergenic
1017669276 6:156754759-156754781 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1017833174 6:158151128-158151150 GTCCCACTGTGAGGTCTTCAGGG - Intronic
1017862997 6:158416337-158416359 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1018041614 6:159928954-159928976 GTCCCACTGGGAGGTCCTCAGGG - Intergenic
1018191899 6:161316329-161316351 GTCCCACTGGGAGGTCTTCAGGG - Intergenic
1018256137 6:161921257-161921279 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1018308118 6:162479638-162479660 GTCCCACTGGAGGGTCTTCAGGG + Intronic
1018355616 6:163011918-163011940 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1018402492 6:163439114-163439136 GGCCCACTGCCAGGTCTTCATGG + Intronic
1018527769 6:164733086-164733108 GTCCCACTGGGAGGTCTTCAGGG - Intergenic
1018539098 6:164857881-164857903 GTCCCAGTAGAAGGTCTTCAGGG + Intergenic
1018631115 6:165823376-165823398 GTCCCATTGGAAGGTCTTCAGGG + Intronic
1018859756 6:167703036-167703058 GTCCCACTGGAAGGTCTGCAGGG + Intergenic
1018886777 6:167945285-167945307 GTCCCACGGGAAGGTCTTCAGGG + Intronic
1019098950 6:169611783-169611805 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1020094737 7:5362004-5362026 GTCCTCCAGGGAGGACTTCATGG + Exonic
1020388679 7:7635016-7635038 GTCCCAGTGGAAGTTCTTCAAGG + Intergenic
1020505796 7:8986417-8986439 GTCCCACTGGAAGATCTTCAGGG + Intergenic
1020516605 7:9128901-9128923 GTCCCACTGAAAGGTGTTCAGGG + Intergenic
1020636655 7:10703745-10703767 GTCCCAGTGAAAGGTCTTCAGGG - Intergenic
1020740795 7:12014627-12014649 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1020832233 7:13107069-13107091 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1021165329 7:17332436-17332458 GTCCCACTGGAAGGTCTGCGGGG - Intronic
1021384047 7:20006366-20006388 GTCCTACAGGAGGGTCTTCAGGG - Intergenic
1021615165 7:22496060-22496082 GTCCCACTGGAAGGTCTTCAAGG - Intronic
1021696550 7:23281859-23281881 GTCCCAGTGGGTGGTCTTCAGGG - Intergenic
1021743557 7:23713706-23713728 GTCCTACTAGAAGGTCTTCAGGG + Intronic
1021760390 7:23897791-23897813 GTCCCACTGGAAAGCCTTCAGGG - Intergenic
1021830262 7:24599937-24599959 GTCCCACTGGAAAGTCTTCAGGG + Intronic
1022037909 7:26551264-26551286 TTCCTACTGGAAGATGTTCAAGG + Intergenic
1022906944 7:34866871-34866893 GACCACATGGGAGGTCTTCAAGG + Intronic
1022971775 7:35524996-35525018 GTCCAACTGGGTGGTCTTCAGGG + Intergenic
1023281086 7:38570811-38570833 GTCCTACTGGAAGGTTTTCAGGG - Intronic
1023308692 7:38858984-38859006 GTCCTGCTGGAAGGCCTTCAGGG - Intronic
1023527925 7:41124264-41124286 GTCCCACTGGGAGGTCTTCAGGG - Intergenic
1023720474 7:43088412-43088434 CTCCTACAGAGAGGTCTGCATGG + Intergenic
1023952206 7:44855543-44855565 GTCACACTGGAATGTCTTCAAGG + Intergenic
1024277160 7:47687337-47687359 GTCCCACAGGAAGGTCTTCAGGG + Intergenic
1024345388 7:48308235-48308257 GTCCCACTGGGCGGTCTTCAGGG + Intronic
1024401667 7:48930741-48930763 GTCCCACTGGGAGGTCTTCCGGG + Intergenic
1024784850 7:52895549-52895571 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1024923456 7:54586721-54586743 GTCCCACTGGAGAGTCTTCAGGG + Intergenic
1024949703 7:54847167-54847189 GTCCCACTGGAAGGCCTTCAGGG + Intergenic
1025270723 7:57511214-57511236 GACCCACTGGAAGGTCTTCAGGG + Intergenic
1025952752 7:66158361-66158383 GGCCTAATGGGAGGTCATGAGGG + Intergenic
1026147083 7:67756496-67756518 GTCCCACTGGGAGGTCTTCAGGG - Intergenic
1026419897 7:70223749-70223771 GTCACACTGCAAGGTCTTCAGGG - Intronic
1026565170 7:71483978-71484000 GTCCCACTGGTAGGTCTTCAGGG + Intronic
1027329919 7:77081379-77081401 GTCCCACTGAAAGGCCTTCAGGG - Intergenic
1027475440 7:78625022-78625044 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1027545791 7:79525922-79525944 GTCCCACTGGAGGATCTTCAGGG + Intergenic
1027839021 7:83283489-83283511 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1027892853 7:83998899-83998921 GTCCTACTGGAAGGACTTCAGGG + Intronic
1027937567 7:84629693-84629715 TTCCTACTGGAAGGTCTTCAAGG - Intergenic
1028239465 7:88402032-88402054 GTCCCACTGGAGGATCTTCAGGG + Intergenic
1028368646 7:90065031-90065053 GTCCCACTGGAAGGTTTTCAGGG - Intergenic
1028377331 7:90158563-90158585 GTCCCACTGGAAGGTCTTCAAGG + Intronic
1028402633 7:90441107-90441129 GTCCCGCTGGAAGTTCTTCAGGG + Intronic
1028601322 7:92603555-92603577 GTCCCACGGGAAGGACTTCAGGG - Intergenic
1028607108 7:92666994-92667016 GTCCCACTAGGAGGGCTTCAGGG - Intronic
1028786701 7:94802627-94802649 GTCCCATTGGAATGTCTTCAGGG - Intergenic
1028878836 7:95856266-95856288 GTCCCCCTGGACGGTCTTCAGGG + Intronic
1028977248 7:96927641-96927663 GTCCCACTGGAAGGAATTCAGGG - Intergenic
1029785847 7:102789962-102789984 GTCCCACTGAAAGGCCTTCAGGG + Intronic
1030102587 7:105959610-105959632 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1030123361 7:106132167-106132189 GTCCCAGTGGAAGGTCTTCAGGG - Intergenic
1030276890 7:107731044-107731066 GTCCCACTGGAAGGTCATCAGGG + Intergenic
1030493038 7:110263395-110263417 ATCCCACTGGAATGTCTTCAGGG - Intergenic
1030573723 7:111259950-111259972 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1030767314 7:113426655-113426677 GTTCCACTGGAAGGTCTTCAGGG - Intergenic
1031002358 7:116431313-116431335 GTCCTATTGGAAGGTCTTCAGGG - Intronic
1031091235 7:117357405-117357427 GTCCCACTGGAAGGTCTTCAAGG - Intergenic
1031191934 7:118563807-118563829 GTCCCACTGGAAAGCCTTCAAGG - Intergenic
1031226536 7:119045872-119045894 GTCCCACTAGACGGTCTTCAGGG + Intergenic
1031634720 7:124088442-124088464 GTCCCACTGGAAAATCTTCAGGG + Intergenic
1031716246 7:125112264-125112286 GTCTCACTGGAAGGTCTTCAGGG + Intergenic
1031891949 7:127304769-127304791 GCCCCACTAGAAGGTCTTCAGGG - Intergenic
1031948909 7:127871109-127871131 GTCCCACTGGAAGGTTTTCAGGG + Intronic
1032627149 7:133604124-133604146 GTCCCACTGGAAGATCTTCAGGG + Intronic
1032631327 7:133655672-133655694 GTCCCACCAGAAGGTCTTCAGGG + Intronic
1032735087 7:134685062-134685084 GTCCCACTGGAGGGTCTTCAGGG + Intergenic
1032857908 7:135851541-135851563 GTCCCACTGGAGGGTCTTCAGGG + Intergenic
1032908622 7:136403105-136403127 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1032977846 7:137245707-137245729 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1033429620 7:141277421-141277443 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1033784075 7:144708865-144708887 ATCCCACTAGAAGGTCTTCAGGG - Intronic
1034023216 7:147668486-147668508 GTCCCACTGGGACGTTCTCAGGG - Intronic
1034057469 7:148050269-148050291 GTCCTACTGCGAGGTCTTCAGGG - Intronic
1034092085 7:148373026-148373048 GTCACACTGGGAGGTCTTCAGGG + Intronic
1034535536 7:151723685-151723707 AACCTACAGGGAGCTCTTCAAGG + Intronic
1034709104 7:153175070-153175092 GTCCCATGGGAAGGTCTTCAGGG + Intergenic
1035064153 7:156093334-156093356 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1035358387 7:158293850-158293872 GTCCCACAGGAAGGTCTTCAGGG + Intronic
1035416937 7:158697182-158697204 GTCCCAGTGGAAGGTCTTCAGGG - Intronic
1035899407 8:3441951-3441973 GTCCCACTGGAAAGTCTTCGGGG - Intronic
1035914780 8:3607250-3607272 GTCCCACTGGGAAGTCTTCAGGG + Intronic
1036021244 8:4849049-4849071 GTCCCACTAGAAGGTCTTCAGGG - Intronic
1036083733 8:5589656-5589678 GTCCCACTGGAAGGTCTTCACGG + Intergenic
1036113548 8:5933139-5933161 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1036180155 8:6577258-6577280 GTGCTGCTGGGATGTTTTCATGG + Intronic
1036444984 8:8813456-8813478 GTCGCACTGGAAGATCTTCAGGG - Intronic
1036535614 8:9648507-9648529 GTCCCACTGAAAGGTCTTCGTGG + Intronic
1036630282 8:10508680-10508702 GTCCCACTGGGAGGTCTTCAGGG + Intergenic
1036734082 8:11293114-11293136 GCCCCACTGGAAGGTCTTCAGGG - Intronic
1037414613 8:18636108-18636130 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1037458999 8:19090322-19090344 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1037560551 8:20070450-20070472 GTTCCACTGGAAGGTCTTCAGGG + Intergenic
1037788660 8:21918533-21918555 GTCCTCCTAGTAGGTCTTCCTGG - Intergenic
1037867160 8:22454322-22454344 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1037870732 8:22493663-22493685 GTCCCACTGGAAGGCCTTCAGGG + Intronic
1038371925 8:27002760-27002782 GCCCCACTGGAAGGCCTTCAGGG - Intergenic
1038415809 8:27394950-27394972 GTCCCACTGGAAGCTCTTCAGGG + Intronic
1038628141 8:29214477-29214499 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1038710157 8:29936341-29936363 GTCCCACTGGGAGGTCTTCAGGG - Intergenic
1038868674 8:31468426-31468448 GTCCTGCTGGACGGTCTCCAGGG - Intergenic
1038922891 8:32104792-32104814 GTCCTACTGGAAGGTCTTCAGGG + Intronic
1039125961 8:34202162-34202184 GTCCCACTGGGAGGTCTTCAGGG + Intergenic
1039305929 8:36262795-36262817 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1039715615 8:40105250-40105272 GTCCCACGGGAAGGTCTTTAGGG + Intergenic
1040449622 8:47531306-47531328 GTCCCACTGGCTGGCCTTCATGG + Intronic
1040675486 8:49744253-49744275 GACCTTCTGGGAGGACTTCCTGG + Intergenic
1040695928 8:49998688-49998710 GTCCCCCTGGAAGGTCTTCAGGG + Intronic
1040724143 8:50361247-50361269 GTCCCACTGGAAAGTCTTCAGGG + Intronic
1040750739 8:50703412-50703434 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1040789890 8:51215943-51215965 ATCCCACTGGAAGGTCTTTAGGG - Intergenic
1040837755 8:51750303-51750325 ATCCCACTGGAAGGTCCTCAGGG + Intronic
1040896270 8:52372091-52372113 GTCTCACTGGAAGGTGTTCAGGG - Intronic
1040902871 8:52434965-52434987 GTCCCACTGGAAGGTCTTGCGGG - Intronic
1040991748 8:53359147-53359169 GTCCTACTGGAAGGTCTTCAAGG + Intergenic
1041369676 8:57145565-57145587 GTCCCACTGAAAGGTTTTCAGGG - Intergenic
1041440481 8:57890663-57890685 GTCCCACTGGAAAGTCTTCAGGG + Intergenic
1041610926 8:59847924-59847946 GTCCCACTAGAAAGTCTTCAGGG - Intergenic
1041861813 8:62522571-62522593 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1041995921 8:64057890-64057912 ATCCCACTGGAAGGTCTTCAGGG - Intergenic
1042156843 8:65853396-65853418 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1042310746 8:67377151-67377173 GTCCTACTGGAAGGTTTTCAGGG + Intergenic
1042406325 8:68409332-68409354 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1042797593 8:72681460-72681482 TCCTTACTGGAAGGTCTTCAGGG + Intronic
1042849976 8:73207151-73207173 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1043061484 8:75510056-75510078 GTCCCATTGGAAGGTTTTCAGGG - Intronic
1043106380 8:76117502-76117524 GTCCTACTGGAAAGTCTTCCGGG + Intergenic
1043307220 8:78810199-78810221 GTCCCACTGGAAGGTGTTCAGGG + Intergenic
1043491859 8:80757208-80757230 GTTCTACTGGAAGGTGTTCAGGG - Intronic
1043759171 8:84044536-84044558 GTCCCACTGGAAGGTCTGCAGGG - Intergenic
1043997361 8:86834786-86834808 GTCCCACTGGAAGGGCTTCAGGG + Intergenic
1044003365 8:86912815-86912837 GTCCCCCTGGAAGGTCTTCAGGG - Intronic
1044117400 8:88351481-88351503 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1044246756 8:89957206-89957228 GTCCCACTGGAAAGTCTTCTGGG - Intronic
1044280802 8:90353582-90353604 GTCCCACCCGAAGGTCTTCAGGG + Intergenic
1044460306 8:92436708-92436730 GTCCTAATGGGTGATCTTCTAGG - Intergenic
1044518003 8:93162170-93162192 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1044538059 8:93380335-93380357 GTCCCAGTGGAAGGTCTTCGGGG - Intergenic
1044546257 8:93463566-93463588 GTCCCACTAGAAGGTATTCAGGG + Intergenic
1044807041 8:96018999-96019021 GTCCCACTGGAAAGTCTTCAGGG - Intergenic
1044872772 8:96636395-96636417 GTCCCACTGGAAGGTCCTCAGGG - Intergenic
1045196554 8:99937316-99937338 GTTCTACTGAAAGGTCTTAACGG - Intergenic
1045444360 8:102244706-102244728 GTCCCACTGGAAGGTCTCCAGGG - Intergenic
1045484350 8:102619273-102619295 GTCCCACTGGAAGGTCTTCATGG - Intergenic
1045858154 8:106788295-106788317 GTCCCACTGGAAGGTGTTCAGGG + Intergenic
1046013648 8:108579875-108579897 GCCCCACTGGAAGGTCTTTAGGG + Intergenic
1046116341 8:109788774-109788796 GTCCCACTGGAAGCTCTTTAGGG - Intergenic
1046663107 8:116970252-116970274 GTCCCACTGGAAGGACTTTAGGG + Intronic
1046838881 8:118835381-118835403 GTCCCACTGGAAAGTCTTCAGGG - Intergenic
1046890007 8:119412556-119412578 GTCCCACTGGAAGGTTGTCAGGG - Intergenic
1047136620 8:122086019-122086041 GTCCCACTGGAAGGTCTTTGGGG - Intergenic
1047142580 8:122158025-122158047 GTCCCACTGGAAGGCCTTCAGGG - Intergenic
1047351131 8:124075410-124075432 GTCCCACTGGAAGGTCTTCAAGG + Intronic
1047430609 8:124788316-124788338 GTCCCACTGGAAGGGCTTCAGGG - Intergenic
1047932189 8:129739925-129739947 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1048171765 8:132113832-132113854 GTCTTGCTGGAAGGTCTTCAGGG + Intergenic
1048227801 8:132606336-132606358 GTCCCATGGGAAGGTCTTCAGGG - Intronic
1048602815 8:135936499-135936521 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1048789675 8:138088543-138088565 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1049127187 8:140802191-140802213 GTCCCACTGGGAGGTCTTCAGGG - Intronic
1049141264 8:140956647-140956669 GTCCCACTGGAAAGTCTTTAGGG - Intronic
1049703086 8:144023817-144023839 GTCCTAAGGGGAGGTCCTGAGGG - Intronic
1050285056 9:4092648-4092670 ATCCCACTGGAGGGTCTTCAGGG + Intronic
1050495832 9:6241069-6241091 GCCCTACTGGAAGTTCTTCAGGG + Intronic
1050499297 9:6278462-6278484 GTCCCACTGGAATTTCTTCAGGG + Intergenic
1050757296 9:9021642-9021664 GTCCCACTAGAAGATCTTCAGGG - Intronic
1050848610 9:10256291-10256313 GTCCCACTGGAAGGTCTTCGGGG + Intronic
1050889071 9:10800365-10800387 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1051034446 9:12726155-12726177 GTCCCACTGGAAGTTCTTTAGGG - Intergenic
1051046232 9:12877558-12877580 GTCCCACTGGAAGGTTTTCAGGG - Intergenic
1051128259 9:13830300-13830322 GTCCCACTGAAATGTCTTCAGGG + Intergenic
1051181474 9:14416395-14416417 GTCTCACTGGAAGGTCTTCAGGG - Intergenic
1051474908 9:17495338-17495360 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1051643075 9:19241633-19241655 GTCCTACTGGAAGGTCTTCAGGG + Intronic
1051647498 9:19283280-19283302 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1051710926 9:19929783-19929805 GTCCCACTGGAAGTTCTTCAGGG - Intergenic
1051943758 9:22540767-22540789 GTCCCAGGGGAAGGTCTTCAGGG + Intergenic
1052011426 9:23414350-23414372 GTCTCACTGGGAGGTCGTCAGGG - Intergenic
1052168890 9:25369429-25369451 GTCCCACTGGAAGGTCTTCAAGG + Intergenic
1052269241 9:26609104-26609126 GTCTTTCTGGGGGGTCCTCAAGG - Intergenic
1052361747 9:27568944-27568966 GTCCCACTGGAAGGTTTTTAGGG - Intronic
1052514811 9:29466529-29466551 GTCCCACCGGAAGGTCTTGAAGG + Intergenic
1052744644 9:32428376-32428398 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1053671792 9:40372801-40372823 ATCCCACTGGAAGGTCTTCAGGG - Intergenic
1053782311 9:41623328-41623350 GTCCCACTGGAAGGTCTTCCAGG + Intergenic
1053921605 9:42999159-42999181 ATCCCACTGGAAGGTCTTCAGGG - Intergenic
1054170261 9:61833483-61833505 GTCCCACTGGAAGGTCTTCCAGG + Intergenic
1054382907 9:64512845-64512867 ATCCCACTGGAAGGTCTTCAGGG - Intergenic
1054512826 9:66003509-66003531 ATCCCACTGGAAGGTCTTCAGGG + Intergenic
1054667277 9:67747332-67747354 GTCCCACTGGAAGGTCTTCCAGG - Intergenic
1054859700 9:69937077-69937099 GTGCCACTGGGAGGTCTTTAGGG + Intergenic
1054978510 9:71176258-71176280 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1055121306 9:72663989-72664011 GTCCCACTGGAAGATCTTCATGG + Intronic
1055179788 9:73371251-73371273 GACCCACTGGAAGGTCTTCAGGG - Intergenic
1055287827 9:74748480-74748502 GTCCCACTGGAAGGTGTTCAGGG - Intronic
1055342374 9:75297623-75297645 GTCCCACTGGAAGGTCTTTAGGG - Intergenic
1055393782 9:75851705-75851727 GTCCCAGTGGAAGGCCTTCAGGG + Intergenic
1055630403 9:78217765-78217787 GTCCTAATGGAAGGTCTTCAGGG + Intergenic
1055832169 9:80393038-80393060 GTCCCACTGATAGGTCTTTAGGG + Intergenic
1055991229 9:82108175-82108197 GTCCCACTGGAAGGTTTTCAGGG - Intergenic
1056242518 9:84662465-84662487 GTCCCACTGGAAGATCTTCAGGG + Intergenic
1056317485 9:85404686-85404708 ATCCCACTGGAAGGTCTCCAAGG - Intergenic
1056432042 9:86537465-86537487 GTCCCACTGGAAGGCCTTCCGGG - Intergenic
1056443948 9:86646506-86646528 CTCCCACTGGAAGGTCTTCAGGG - Intergenic
1056581549 9:87890442-87890464 GTCCTTCTGGGGGGTCTTCATGG - Intergenic
1056748605 9:89327673-89327695 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1056876535 9:90338661-90338683 GGCCTAATGGGAGGTGTTTAGGG + Intergenic
1056961424 9:91127403-91127425 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1057019740 9:91687676-91687698 GTCCCTCTGGAAGATCTTCAGGG + Intronic
1057020053 9:91690274-91690296 GTCCCTCTGGAAGATCTTCAGGG - Intronic
1057046372 9:91889380-91889402 GTCCTATTGGGGCGCCTTCATGG - Intronic
1057116353 9:92526124-92526146 GTCCCACTGGAAGGTCTTCATGG - Intronic
1057452810 9:95180209-95180231 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1057494418 9:95549279-95549301 GTCCCACTAGAAGGTCTTCAGGG - Intergenic
1057762133 9:97884807-97884829 GTTCCACTGGAAGGTTTTCAGGG + Intergenic
1058281249 9:103117662-103117684 GTCCTACTGGACAGTCTTCAGGG - Intergenic
1058434559 9:104950373-104950395 GTCCCACTGGAAGGTCTTCAAGG + Intergenic
1059028556 9:110664543-110664565 GTCCTACTGGAAGGTCCTCAGGG + Intergenic
1059174089 9:112153381-112153403 GTCCCACTGGAAGGTTGTCAAGG + Intronic
1059183285 9:112240764-112240786 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1059218123 9:112585807-112585829 GTAATACTGAAAGGTCTTCAGGG + Intronic
1059526672 9:114997801-114997823 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1059718968 9:116940419-116940441 GTCCCACTGGAAGGTCTTCAGGG - Intronic
1059951521 9:119467606-119467628 GTCCCACTGGAAGGTCTACAGGG - Intergenic
1060011554 9:120047717-120047739 ATCCCACTGGAAGGTCTTTAGGG + Intergenic
1060129698 9:121083482-121083504 GTTCCACTGGAAGGTCTTCAAGG + Intronic
1060255763 9:122029383-122029405 ATCCCACTGGAAGGTCTTCAAGG - Intronic
1060322127 9:122572190-122572212 GCCCTAGTGGGAGGTGATCATGG - Intergenic
1060868305 9:127017864-127017886 GTCCCACTGGAAGGTTTTCAGGG + Intronic
1060924025 9:127442990-127443012 GTCCAACTGGAAGATCTTCAGGG + Intronic
1061311386 9:129765206-129765228 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1061973083 9:134055168-134055190 GCCCTGCTGGGAGGGCTTCATGG - Intronic
1185759053 X:2675348-2675370 GTTCTACTGTTAGTTCTTCAAGG + Intergenic
1185943830 X:4352442-4352464 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1186033824 X:5398954-5398976 GTCCCACTGGAAGGTATTCAGGG - Intergenic
1186296324 X:8153032-8153054 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1186697305 X:12049759-12049781 GTCCCACTGGCAGGTTTTCAGGG - Intergenic
1186791296 X:13001742-13001764 GTCCCACTGGAAGGTCCTCAGGG - Intergenic
1187209905 X:17219190-17219212 GTGCCACTGGAAGATCTTCAGGG - Intergenic
1187395265 X:18913860-18913882 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1187762287 X:22601149-22601171 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1188442472 X:30226238-30226260 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1188594449 X:31880961-31880983 CCCCCACTGGAAGGTCTTCATGG - Intronic
1188824458 X:34813375-34813397 GTCTCACCGAGAGGTCTTCAGGG - Intergenic
1188850105 X:35121672-35121694 GTCCCACTGGAAGGTCCTCAGGG + Intergenic
1189022277 X:37353133-37353155 GTTCCACTGGAAGGTTTTCAGGG - Intronic
1189028324 X:37423051-37423073 ATCCCACTTGAAGGTCTTCAGGG - Intronic
1189132291 X:38512560-38512582 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1189158240 X:38782251-38782273 GTCCCACTGAAAGGTCTTCAGGG + Intergenic
1189428548 X:40926295-40926317 GTCCCACTGGAAGATCTTCAAGG - Intergenic
1189621200 X:42840121-42840143 GTTCCACTGGAAGGTCTTCAGGG - Intergenic
1189765450 X:44367738-44367760 GTCCCACTGGAAGATCTTCAGGG - Intergenic
1189800909 X:44691070-44691092 GTCCTATTGGTAGGTCCCCAGGG - Intergenic
1190427020 X:50343138-50343160 GTCCCATTGGAAGTTCTTCAGGG - Intronic
1190574074 X:51815334-51815356 GTCCCACCGGAAGTTCTTCAGGG - Intronic
1191056567 X:56247711-56247733 GTCCCACTGGAAGATCTTCAGGG + Intronic
1191127191 X:56970139-56970161 TTCTCACTGGGAGGTCTTCAGGG + Intergenic
1191789836 X:64957970-64957992 GTCCCACTGGAAAGTCTTCAAGG + Intronic
1191801821 X:65089880-65089902 TTCCCACTGGAAGGTCTTCAGGG + Intergenic
1192127490 X:68515554-68515576 GTCCTATTGGAAGGTCTTCTGGG + Intronic
1192344888 X:70294236-70294258 GTCCTACTGGAAAGTCTTCAGGG + Intronic
1192385101 X:70660593-70660615 GTCCCACTGGAAAGTCCTCAGGG + Intronic
1192407702 X:70903058-70903080 GTCCCACTGGAAGTTCTTCAGGG + Intronic
1192861183 X:75073045-75073067 GTTTTACTGGAAGGTCTTCAGGG + Intronic
1193089634 X:77480573-77480595 GTCCTACTAGAAGGTCTTCGAGG + Intergenic
1193145663 X:78073054-78073076 GTCCCACTGGAAGGTCTTTGGGG + Intronic
1193237642 X:79128843-79128865 GTCCCACTGGAAGATCTTTAGGG - Intergenic
1193372934 X:80720301-80720323 GTCCCACTGGAAGGTCTTCCGGG - Intronic
1194236468 X:91390214-91390236 GTCCCACCGGAAGGTCTTTAAGG + Intergenic
1194314878 X:92365099-92365121 GTCCTACTGGGAGGTTTTCAGGG + Intronic
1194413835 X:93586408-93586430 GTCCCCCTGGAAGGTCTTCAGGG + Intergenic
1194637918 X:96368352-96368374 GTCCCACTGGAAGGTCTTCATGG - Intergenic
1194640303 X:96396111-96396133 GTCCCACTGGAAGGTCTTCAGGG - Intergenic
1194697063 X:97065782-97065804 GTCCCACTGGAAGGTCTTCAAGG - Intronic
1194820978 X:98506662-98506684 GTACTGCTGGAAGATCTTCAGGG - Intergenic
1194904982 X:99564209-99564231 TTTCCACTGGCAGGTCTTCAGGG + Intergenic
1194918703 X:99736375-99736397 ATCCCACTGGAAGATCTTCAGGG - Intergenic
1195040755 X:101011912-101011934 GTCCCACTAGAAGGTCTTCAGGG + Intronic
1195058417 X:101169738-101169760 TTTCTACTGGAAGGTCTTCGGGG - Intergenic
1195143746 X:101991566-101991588 GTGCCACTGGAAGGTCTTCAGGG + Intergenic
1195289305 X:103416418-103416440 GTCCCACTGGGAGGTCTTAAGGG + Intergenic
1195342729 X:103920779-103920801 GCCCTTCTGTGAGCTCTTCAGGG + Intronic
1195364060 X:104110777-104110799 GCCCTTCTGTGAGCTCTTCAGGG - Intronic
1195551118 X:106172572-106172594 GTCCCACTGGAAGGTCTTCAGGG + Intronic
1195571812 X:106405449-106405471 GTCCCACTGGAAAGTCTTCAGGG + Intergenic
1195781695 X:108473406-108473428 GTCCCACTGGAAGGTCTTTGGGG - Intronic
1195849307 X:109265533-109265555 GTTCTACTAGAAGGTCTTCAGGG + Intergenic
1195892817 X:109714064-109714086 GTCCCACTGGAAGGTCTTTAAGG - Intronic
1196041314 X:111207677-111207699 GTCCAACTGGAAGGACTTTAGGG - Intronic
1196265377 X:113638172-113638194 GTCACACTGGAAGGTCTTCAGGG + Intergenic
1196568246 X:117233733-117233755 GTTCTACTGGAAAATCTTCAAGG + Intergenic
1196606156 X:117659601-117659623 GTCCTACTGGAAGATATTCAGGG - Intergenic
1196641460 X:118067728-118067750 ATCCCACTGGAAGGTCTTCAGGG + Intronic
1196641671 X:118069290-118069312 ATCTCACTGGAAGGTCTTCAGGG - Intronic
1196960740 X:120997950-120997972 GTCCCATTGGAAGGTCTTCAGGG + Intergenic
1197047257 X:122012445-122012467 GTCCCACTGGAAGGTCTTCAAGG - Intergenic
1197230717 X:124000786-124000808 GTCCTACTGGAAGGTCTTCAGGG - Intronic
1197419532 X:126221647-126221669 ATCCTACTGGAAAGTCTTCAGGG + Intergenic
1197444339 X:126530968-126530990 GTCCCACTGGTAGGTCTTCAGGG + Intergenic
1197877952 X:131131442-131131464 GTCCCACTGGAAGGTCTTCAGGG + Intergenic
1198193445 X:134334738-134334760 GTCTCACTGGGAGGTCTTCAGGG + Intergenic
1198942572 X:141973356-141973378 GTTCTTCTGAGGGGTCTTCAGGG - Intergenic
1199020698 X:142874211-142874233 GTCCCAATGGAAGGTCTTCAGGG + Intergenic
1199270384 X:145875498-145875520 GTCTCACTGGAAGGTCTTCGGGG - Intergenic
1199335351 X:146613109-146613131 GTCCCACTGGAAGGTCCTCAGGG + Intergenic
1199940621 X:152623299-152623321 GTCCCACTGGAAGGTCTCCAGGG - Intergenic
1200622929 Y:5476629-5476651 GTCCTACTGGGAGGTTTTCAGGG + Intronic
1201638489 Y:16152205-16152227 GTTCCACTGGAAGGTATTCAGGG + Intergenic