ID: 1156517194

View in Genome Browser
Species Human (GRCh38)
Location 18:37690341-37690363
Sequence CAGTAGGACAAGATGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156517187_1156517194 -10 Left 1156517187 18:37690328-37690350 CCTGAAGACCTCCCAGTAGGACA 0: 2
1: 42
2: 330
3: 514
4: 665
Right 1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG No data
1156517183_1156517194 7 Left 1156517183 18:37690311-37690333 CCATGTGTGTTACTGCCCCTGAA 0: 23
1: 114
2: 233
3: 362
4: 519
Right 1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG No data
1156517186_1156517194 -9 Left 1156517186 18:37690327-37690349 CCCTGAAGACCTCCCAGTAGGAC 0: 2
1: 42
2: 320
3: 506
4: 575
Right 1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG No data
1156517185_1156517194 -8 Left 1156517185 18:37690326-37690348 CCCCTGAAGACCTCCCAGTAGGA 0: 2
1: 28
2: 271
3: 432
4: 549
Right 1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156517194 Original CRISPR CAGTAGGACAAGATGTGGAG GGG Intergenic
No off target data available for this crispr