ID: 1156519315

View in Genome Browser
Species Human (GRCh38)
Location 18:37708285-37708307
Sequence CAAAAGGAAGCAGGGAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156519315_1156519320 -4 Left 1156519315 18:37708285-37708307 CCTCTTCTCCCTGCTTCCTTTTG No data
Right 1156519320 18:37708304-37708326 TTTGGCCTCACACACTGAGCAGG No data
1156519315_1156519325 22 Left 1156519315 18:37708285-37708307 CCTCTTCTCCCTGCTTCCTTTTG No data
Right 1156519325 18:37708330-37708352 AGGTTTTATTCTAGTAAACTTGG No data
1156519315_1156519323 2 Left 1156519315 18:37708285-37708307 CCTCTTCTCCCTGCTTCCTTTTG No data
Right 1156519323 18:37708310-37708332 CTCACACACTGAGCAGGGCCAGG No data
1156519315_1156519326 23 Left 1156519315 18:37708285-37708307 CCTCTTCTCCCTGCTTCCTTTTG No data
Right 1156519326 18:37708331-37708353 GGTTTTATTCTAGTAAACTTGGG No data
1156519315_1156519321 -3 Left 1156519315 18:37708285-37708307 CCTCTTCTCCCTGCTTCCTTTTG No data
Right 1156519321 18:37708305-37708327 TTGGCCTCACACACTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156519315 Original CRISPR CAAAAGGAAGCAGGGAGAAG AGG (reversed) Intergenic
No off target data available for this crispr