ID: 1156519317

View in Genome Browser
Species Human (GRCh38)
Location 18:37708293-37708315
Sequence TGTGAGGCCAAAAGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156519317_1156519325 14 Left 1156519317 18:37708293-37708315 CCCTGCTTCCTTTTGGCCTCACA No data
Right 1156519325 18:37708330-37708352 AGGTTTTATTCTAGTAAACTTGG No data
1156519317_1156519323 -6 Left 1156519317 18:37708293-37708315 CCCTGCTTCCTTTTGGCCTCACA No data
Right 1156519323 18:37708310-37708332 CTCACACACTGAGCAGGGCCAGG No data
1156519317_1156519326 15 Left 1156519317 18:37708293-37708315 CCCTGCTTCCTTTTGGCCTCACA No data
Right 1156519326 18:37708331-37708353 GGTTTTATTCTAGTAAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156519317 Original CRISPR TGTGAGGCCAAAAGGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr