ID: 1156519319

View in Genome Browser
Species Human (GRCh38)
Location 18:37708301-37708323
Sequence GCTCAGTGTGTGAGGCCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156519319_1156519325 6 Left 1156519319 18:37708301-37708323 CCTTTTGGCCTCACACACTGAGC No data
Right 1156519325 18:37708330-37708352 AGGTTTTATTCTAGTAAACTTGG No data
1156519319_1156519326 7 Left 1156519319 18:37708301-37708323 CCTTTTGGCCTCACACACTGAGC No data
Right 1156519326 18:37708331-37708353 GGTTTTATTCTAGTAAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156519319 Original CRISPR GCTCAGTGTGTGAGGCCAAA AGG (reversed) Intergenic
No off target data available for this crispr